ID: 1136418419

View in Genome Browser
Species Human (GRCh38)
Location 16:30117286-30117308
Sequence CTGTGGATAAGGAGGTGACT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 274
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 251}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136418412_1136418419 1 Left 1136418412 16:30117262-30117284 CCTGGGATGGGGAGCCCAGGATG 0: 1
1: 1
2: 3
3: 39
4: 386
Right 1136418419 16:30117286-30117308 CTGTGGATAAGGAGGTGACTTGG 0: 1
1: 0
2: 1
3: 21
4: 251
1136418410_1136418419 4 Left 1136418410 16:30117259-30117281 CCTCCTGGGATGGGGAGCCCAGG 0: 1
1: 2
2: 6
3: 49
4: 453
Right 1136418419 16:30117286-30117308 CTGTGGATAAGGAGGTGACTTGG 0: 1
1: 0
2: 1
3: 21
4: 251

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136418419 Original CRISPR CTGTGGATAAGGAGGTGACT TGG Intronic
901039397 1:6354937-6354959 GTATGGATAAGGGAGTGACTTGG - Intronic
901129533 1:6953622-6953644 CTGGGCATAAGGAGGTGACAAGG - Intronic
903298885 1:22363880-22363902 CTGTGGACAAGGAGCCAACTGGG + Intergenic
903852834 1:26318477-26318499 CTGTGGTTATGGAGGTGACAGGG + Intronic
904910590 1:33931468-33931490 CTGAAGGTAGGGAGGTGACTGGG + Intronic
906046803 1:42837373-42837395 CAGTGGGTAAGGAGGTGCCCAGG + Intronic
906312401 1:44763256-44763278 CTGTGGAAGAGCAAGTGACTGGG + Intronic
907647199 1:56255940-56255962 CTGTGGACACGGAGCTCACTTGG - Intergenic
909741525 1:79035891-79035913 GTGTTGATAGTGAGGTGACTAGG + Intergenic
910395664 1:86791316-86791338 CTGTTGATGAGGAGGTAAATTGG + Intergenic
911730167 1:101284138-101284160 CTGTGAGGAAGGAGGTGCCTCGG + Intergenic
911973679 1:104465790-104465812 TTTTAGATAAGGGGGTGACTGGG + Intergenic
912444197 1:109722121-109722143 CTTTGGACAAAGAGGTGACATGG - Intronic
912518822 1:110231796-110231818 CAGTGTTTAAGGAGGTGGCTGGG + Intronic
914316801 1:146520875-146520897 CTGAGAATAAGAAGGTGAATAGG - Intergenic
914352820 1:146855077-146855099 CTGTGGTTAAGGAGGTGGTCAGG - Intergenic
914497554 1:148212485-148212507 CTGAGAATAAGAAGGTGAATAGG + Intergenic
915418441 1:155760431-155760453 CTGTGGATTAGTAAGTGAATGGG - Exonic
919964640 1:202510362-202510384 TTCTGGATAAGGAGGTGACATGG + Intronic
920047704 1:203144301-203144323 CTGTGGATATAGAGATGAATAGG - Intronic
920804544 1:209220131-209220153 CTGTGCGTAGGGAGGAGACTGGG + Intergenic
922594929 1:226806329-226806351 CTGTGGCTAAGCAGGTGGTTGGG - Intergenic
1062945230 10:1456334-1456356 GTGTTGAGAAGGAAGTGACTTGG - Intronic
1063245395 10:4212645-4212667 CTGAGTATTAGGAGGTTACTTGG + Intergenic
1063647857 10:7903809-7903831 CTGTGGATATTGAAATGACTGGG + Intronic
1066390092 10:34971488-34971510 TTTTGGATAAGGGGGTGACTGGG - Intergenic
1066641308 10:37556999-37557021 CCGTTGGTAAGGAGGTAACTGGG - Intergenic
1067762081 10:49056105-49056127 CTGTGGACAGGGAGATGGCTTGG - Intronic
1068779051 10:60899892-60899914 CTGTTGAAAATGAGGTGGCTAGG + Intronic
1074115928 10:110457555-110457577 CTGAGGAGTAGGAGGTGACTGGG + Intergenic
1077044762 11:539860-539882 CTGTGGAGAAGGAGGGAAGTGGG + Intronic
1077187903 11:1243665-1243687 CCCTGGAGAAGGGGGTGACTCGG - Exonic
1077188328 11:1245336-1245358 CCCTGGAGAAGGGGGTGACTCGG - Exonic
1077188860 11:1247436-1247458 CCCTGGAGAAGGGGGTGACTCGG - Exonic
1077589314 11:3479444-3479466 TTTTGGATAAGGGGGTGACCGGG + Intergenic
1078267021 11:9762623-9762645 CTGTGGACAAGGAGGATACGTGG + Intergenic
1079209787 11:18450564-18450586 CAGTGAAGCAGGAGGTGACTGGG - Intronic
1079668382 11:23135522-23135544 CTGGGAAAAACGAGGTGACTAGG - Intergenic
1084423707 11:69072988-69073010 GTGTGGTTAAAGAGGTAACTGGG + Exonic
1084506418 11:69571131-69571153 CTGAGGATCAGGAGGGGTCTGGG - Intergenic
1084827659 11:71743359-71743381 TTTTGGATAAGGGGGTGACCGGG - Intergenic
1087840676 11:102917826-102917848 TTGGGGATTAGGAGGTGATTCGG + Intergenic
1089404525 11:118186575-118186597 CTGTGGATAAGAAGGTTTGTAGG + Intergenic
1090099462 11:123778790-123778812 CTGTGGGTAATGAGGTTCCTGGG + Intergenic
1090493282 11:127185158-127185180 CGGTGGACAAGGAGGAGACAAGG - Intergenic
1091636438 12:2200569-2200591 CTGAGGATACGGTGGTGACAGGG + Intronic
1092153401 12:6266706-6266728 CTGGGAATAGGGAGGTGGCTGGG + Intergenic
1092415601 12:8288350-8288372 TTTTGGATAAGGGGGTGACCAGG + Intergenic
1092435322 12:8442569-8442591 TTTTGGATAAGGGGGTGACCGGG + Intergenic
1092489135 12:8929377-8929399 CTGTGGATAAGGAGGTAGGAAGG - Intronic
1092556076 12:9563402-9563424 CTATGGATTGGGAGGTGGCTAGG - Intergenic
1093288981 12:17299581-17299603 TTTTGGATAAGGGGGTGACTGGG - Intergenic
1094220656 12:27989624-27989646 CTGGGAAGATGGAGGTGACTGGG + Intergenic
1094516017 12:31127246-31127268 CTATGGATTGGGAGGTGGCTAGG + Intergenic
1096475357 12:51906377-51906399 CTGTGGATAACCAGGAGGCTAGG + Intergenic
1097101237 12:56591096-56591118 CAGTGCATAAGGGAGTGACTGGG - Exonic
1098474855 12:70888777-70888799 CTGTGGAGAAGCAGATGTCTAGG - Intronic
1100274355 12:93058360-93058382 GTGTGGATAAGGAAGAGTCTAGG + Intergenic
1100613970 12:96216472-96216494 CTGTGGTTTATAAGGTGACTTGG - Intronic
1103037381 12:117667415-117667437 CTGGGGAGAAGGAGGTGGCATGG + Intronic
1103667170 12:122578009-122578031 CTGTGGGTTAGCAGGTGTCTTGG + Intronic
1104227676 12:126851776-126851798 TTGTTGATAAGGGGGTGTCTAGG - Intergenic
1104669624 12:130671501-130671523 CTGGGGATAGGCTGGTGACTAGG - Intronic
1107490826 13:40878631-40878653 TTTTGGATAAGGGGGTGACTGGG + Intergenic
1111598033 13:90435682-90435704 CTGTAGGTAAGGAGCTGAATTGG - Intergenic
1112133475 13:96549832-96549854 CTATGAATAAGAAGGTGTCTCGG - Intronic
1114736360 14:25047969-25047991 ATGTAGATTAGGAGATGACTGGG - Intronic
1115490533 14:33953612-33953634 CTATGGATAATGGGGTGACCAGG + Intronic
1116787388 14:49302554-49302576 TTGGGGGTAAGGAGGTGAGTTGG + Intergenic
1117541065 14:56746924-56746946 CTGTGGAAAAGCATTTGACTTGG - Intergenic
1117767971 14:59102580-59102602 CTATGGGAAAGGAGGTTACTAGG + Intergenic
1120832390 14:89008869-89008891 GAGTGGATAAGGAGGTGAGCAGG + Intergenic
1120948488 14:90020256-90020278 GTGAGTATAAGGAGGTGACATGG - Intronic
1121216000 14:92248319-92248341 CTGTGGGCAAGGAGTTGACCTGG + Intergenic
1122050986 14:99059658-99059680 CTGGGGATAAGGAGGGGAATAGG - Intergenic
1122903949 14:104793419-104793441 CTGTGGTTTAGGAGGGGCCTGGG - Exonic
1125722936 15:41853752-41853774 CTATGGAGAAGGAGGTGGCACGG - Exonic
1126938949 15:53744562-53744584 CTATGGTTTAGGAGGTGATTGGG - Intronic
1128976277 15:72156062-72156084 CTTTGGATAGGTAGGTGACCTGG + Intergenic
1132353353 15:101154312-101154334 CCGTGACTACGGAGGTGACTTGG + Intergenic
1132738073 16:1397296-1397318 CTGGGGATGAGGAGGTGTCAGGG + Intronic
1132738157 16:1397557-1397579 CTGGGGATGAGGAGGTGTCAGGG + Intronic
1132738186 16:1397644-1397666 CTGGGGATGAGGAGGTGTCAGGG + Intronic
1132738215 16:1397731-1397753 CTGGGGATGAGGAGGTGTCAGGG + Intronic
1132738244 16:1397818-1397840 CTGGGGATGAGGAGGTGTCAGGG + Intronic
1133319580 16:4904656-4904678 CTGTGGATAGGGAGGAAACAGGG + Intronic
1133837313 16:9378517-9378539 CTGTGGATAAAGAGTTAACAAGG + Intergenic
1135509336 16:23068766-23068788 CTGTGGCGAAGGAGATGACACGG + Exonic
1136418419 16:30117286-30117308 CTGTGGATAAGGAGGTGACTTGG + Intronic
1137054639 16:35738275-35738297 CTGTGGCTAAGGAATTGACCTGG + Intergenic
1138044124 16:53703626-53703648 CTGAGGATGTGGAGGTGTCTTGG + Intronic
1138454040 16:57110945-57110967 CGGTGGGTAAGGGGGTGGCTAGG + Intronic
1139981206 16:70860441-70860463 CTGTGGTTAAGGAGGTGGTCAGG + Intronic
1140578819 16:76204411-76204433 CTGAGGATAGAGAGGTGAGTTGG - Intergenic
1141536869 16:84687714-84687736 CTCTGGACAAGGAGGCGAATGGG - Intergenic
1145888647 17:28399487-28399509 CTGTGGATGGGGTGGTGCCTTGG + Exonic
1146284332 17:31564396-31564418 CTGTAGAACAGGAGGTGGCTGGG + Intergenic
1148333517 17:46826204-46826226 CTGTGGAGAAGGTGGTTAGTTGG - Intronic
1151392546 17:73797478-73797500 CAGCGGAAAAGGAGGTGACAAGG + Intergenic
1151869984 17:76830064-76830086 CTGTGGTTAGGGAGTTGGCTGGG + Intergenic
1152253943 17:79226565-79226587 CTGTGGAGCAGGAGGAGCCTGGG + Intronic
1154043288 18:10879792-10879814 CTGTCCATAAAGAGGAGACTAGG + Intronic
1155323018 18:24637435-24637457 CTGTGGACAAGGAGGGGATGGGG + Intergenic
1155349397 18:24891734-24891756 CTGTCGAGAAGGAGGTGTCCTGG - Intergenic
1155502705 18:26503035-26503057 CTGTGAATGGGGTGGTGACTGGG + Intronic
1156435427 18:37122714-37122736 CTGTGAATCAGGAGGTGAGATGG + Intronic
1157446701 18:47751624-47751646 GTGTGGATGAGGAGGGGACAAGG + Intergenic
1157586551 18:48804896-48804918 CTGGGGATGAGGATGAGACTGGG - Intronic
1157623613 18:49030398-49030420 CTGTGAATGATGAGGTGACGGGG - Intergenic
1158817595 18:61121468-61121490 CTGTGGATAAAGATGTGGCCTGG + Intergenic
1160451399 18:78968757-78968779 CCGTGGATAACGAGAAGACTGGG - Intergenic
1160663983 19:314348-314370 CTGTGGTGAGGGACGTGACTGGG + Intronic
1160779402 19:871169-871191 CTGGGGATAAGCAGCTGGCTGGG + Exonic
1161625783 19:5325733-5325755 CTGAGGAGAAGGAGATGAATTGG - Intronic
1161967479 19:7556494-7556516 CAGTGAACATGGAGGTGACTGGG - Exonic
1162068234 19:8138363-8138385 CTGTGGGTGAGGAGGGGACAGGG - Intronic
1162633344 19:11945965-11945987 TTTTGGATAAGGGGGTGACCGGG + Intronic
1162779201 19:12997788-12997810 CTGTGGATACGCCGGTGACATGG + Intronic
1163129235 19:15262050-15262072 CTGTGGATCAGGGGCTGCCTTGG - Intronic
1164480725 19:28609236-28609258 TTTTGGATAAGGGGGTGACGGGG - Intergenic
1164510744 19:28895045-28895067 CTCTGGATAAGAAGGTAATTGGG - Intergenic
1166105303 19:40595202-40595224 CTCTGGAAAAAGAGGTGATTAGG + Intronic
1166201723 19:41241975-41241997 GTGTAGATAAGCAGGTGAGTGGG - Intronic
1168233005 19:55045149-55045171 CTGAGGATGAGGAGGTGGCCCGG - Exonic
926372638 2:12195845-12195867 CTCTGCAGAAAGAGGTGACTTGG - Intergenic
927282313 2:21319976-21319998 CTCTGGATATTGAGGTGCCTGGG + Intergenic
929955642 2:46456558-46456580 CTCTGGATGAGGAGCTGGCTTGG - Intronic
930518209 2:52433474-52433496 TTTTGGATAAGGGGGTGACAGGG - Intergenic
930725236 2:54675484-54675506 CTGTAGATAGGAGGGTGACTGGG + Intergenic
930767014 2:55094943-55094965 GTGTGGAGTAGGAGGTCACTCGG - Intronic
930878299 2:56244562-56244584 CTGTGGATAAGCTGGTACCTAGG + Intronic
931699354 2:64897371-64897393 TTTTGGATAAGGGGGTGACGGGG + Intergenic
932197350 2:69796125-69796147 CCCTGGATATGGAGGTCACTAGG - Intronic
932230731 2:70082230-70082252 CTGTGGATGAGGTGGTGAGGCGG - Intergenic
934126440 2:88897375-88897397 TTGTGGATATGCAGGGGACTTGG - Intergenic
935352149 2:102160592-102160614 AGTTGGATAAGGAGGTGAGTGGG - Intronic
935365287 2:102282941-102282963 CTGTGAAAATGGAGATGACTGGG + Intergenic
937059447 2:118970677-118970699 CTGGGGGAAAGGTGGTGACTTGG + Intronic
937208412 2:120252127-120252149 CTGTGGAGGAGGAGGTGGTTAGG + Intronic
940516615 2:154691502-154691524 TTGTGGAGTAAGAGGTGACTGGG - Intergenic
940683032 2:156810036-156810058 CTGTGGATAAGGAGGACATACGG - Intergenic
940776852 2:157893873-157893895 CAGTGGATAATGAGGTGAACTGG + Intronic
940885036 2:158982237-158982259 TTGTGAATAATAAGGTGACTTGG + Intronic
941516772 2:166490252-166490274 CTGGGGATGAGGGGGTGAATGGG - Intronic
942222333 2:173782394-173782416 CTTTGGATAACGAGATTACTGGG - Intergenic
944353489 2:198758042-198758064 CTGTGGGGAAGGAGTAGACTAGG - Intergenic
945233522 2:207613328-207613350 CTGTTGTTAAGGAGCTGACTTGG - Exonic
946105202 2:217363161-217363183 CTGTGGGAATTGAGGTGACTGGG - Intronic
946652570 2:221909484-221909506 CTGTGGAAAAGACTGTGACTTGG - Intergenic
946689183 2:222298238-222298260 CGGTGGAGAAGGAGGTGAACCGG - Exonic
947727222 2:232408198-232408220 CTGTGCATGAGGAGGGGACACGG + Intronic
948521336 2:238540374-238540396 CTTTGGACCAGGAGGTGTCTTGG - Intergenic
1170825001 20:19786128-19786150 CTCTTGATAAGGAGGTGCCTAGG - Intergenic
1171163175 20:22947077-22947099 CTGTAACTAAGGAGCTGACTTGG + Intergenic
1171294349 20:24004601-24004623 CAGTGGATAAGGAGATAACAGGG - Intergenic
1171376857 20:24699800-24699822 CTGGGGACAAGAAGGTGGCTTGG + Intergenic
1172976304 20:38908388-38908410 CTGTAGTTAAGGAGGTGATCGGG + Intronic
1176131144 20:63497368-63497390 CTGTGGTGAGGGAGGTGACCTGG - Intronic
1181623067 22:24104028-24104050 TTTTGGATACTGAGGTGACTGGG + Intronic
1183186079 22:36292374-36292396 CTGTGGAGAGGGAAGTGACTGGG - Intronic
949157770 3:849072-849094 TTTTGGATAAGGGGGCGACTGGG - Intergenic
949882720 3:8674525-8674547 TTTTGGATAAGGGGGTGACCGGG - Intronic
949931670 3:9083354-9083376 CTCTGGACAAGGAGGAGCCTTGG - Intronic
950411236 3:12839140-12839162 CTTTGCTGAAGGAGGTGACTTGG - Intronic
950884884 3:16354481-16354503 CTGTGTCAAAGGAGGTGACTTGG - Intronic
955187880 3:56732491-56732513 CTGTGGATAAAGAGGTCCCCAGG + Intronic
955214167 3:56971338-56971360 CTGGGGAAAAGGAGATGACTGGG - Intronic
957022172 3:75138921-75138943 TTTTGGATAAGGGGGTGACCGGG - Intergenic
957076510 3:75606934-75606956 TTTTGGATAAGGGGGTGACCGGG + Intergenic
957436791 3:80187913-80187935 CTGAGGACAAGGATGTGGCTAGG - Intergenic
960041967 3:113159177-113159199 CTGTGTATAAGGAATTGACAAGG - Intergenic
960825725 3:121781984-121782006 GTGTGTATAAGGAGGGGAATGGG + Intronic
961271937 3:125696014-125696036 TTTTGGATAAGGGGGTGACCAGG - Intergenic
962733641 3:138304966-138304988 GTGAGGATCAGGAGGTGGCTTGG + Exonic
962869569 3:139476370-139476392 CCCTGGGTAAGGAGGAGACTGGG - Exonic
963107964 3:141662643-141662665 ATGTGGATTTGGAGATGACTGGG - Intergenic
965359457 3:167720053-167720075 CTGTGTTTAATGAGGTGAGTTGG - Exonic
965395601 3:168157412-168157434 CTGTGGATAATGAGCTGATAAGG - Intergenic
965815894 3:172636476-172636498 CTCTGGGTTACGAGGTGACTTGG + Intronic
966925883 3:184644341-184644363 TTCTGGAGAAGGAGGGGACTGGG - Intronic
969459136 4:7318680-7318702 CTGTGGATAAGGGGCTGTGTGGG - Intronic
969595490 4:8147184-8147206 CTGTGGATAAGAATATGAATTGG - Intronic
969785323 4:9453067-9453089 TTTTGGATAAGGGGGCGACTGGG - Intergenic
969788736 4:9477473-9477495 TTTTGGATAAGGGGGCGACTGGG - Intergenic
970850643 4:20598597-20598619 CTATGCACAAAGAGGTGACTGGG + Intronic
973720216 4:53716347-53716369 CTCTGGATCAGGAGTAGACTTGG + Intronic
973966544 4:56168866-56168888 CTATGGATGAGTAGGTGAATGGG + Intergenic
976231138 4:82844393-82844415 CTGTGGATAAGGTGGTACCTGGG + Exonic
977352602 4:95907311-95907333 CTGTCCATAATGAGGTGAGTAGG - Intergenic
977583173 4:98746914-98746936 CAGTGGATAGGGAGGTGAAAAGG - Intergenic
977708461 4:100097445-100097467 TTGTGGATAAGGAGCTGAAGAGG + Intergenic
981604673 4:146528615-146528637 TTTTGGATAAGGGGGTGACCAGG - Intergenic
981644623 4:146985127-146985149 CTCAGAATAGGGAGGTGACTGGG + Intergenic
982313563 4:154009577-154009599 CTCTGGCTCTGGAGGTGACTGGG + Intergenic
984994376 4:185414514-185414536 CTCTGTATGTGGAGGTGACTTGG - Intronic
985182435 4:187279836-187279858 CTGAGGATAGGGCGGAGACTCGG + Intergenic
987169350 5:15238121-15238143 CAGTGGATTTGGGGGTGACTGGG - Intergenic
989078427 5:37589478-37589500 CAGTGGTTGAGGAGGTCACTTGG + Intronic
989622411 5:43397473-43397495 CTGTGGACCAGGAGGGTACTTGG - Intronic
990233904 5:53745882-53745904 CTGTGGCTCAGACGGTGACTGGG + Intergenic
990889137 5:60630294-60630316 CTCTGGGCAAGGAGCTGACTCGG - Intronic
990890503 5:60644104-60644126 CTGTGGATAAGGACCAGATTTGG - Intronic
991646345 5:68804149-68804171 CTGTCGAAAAGGAGGTGAACTGG - Intergenic
994732087 5:103504459-103504481 CTGAGGATAGGGAGGTGAGGGGG - Intergenic
996189244 5:120518399-120518421 CTTTGTATAAGAAGGAGACTAGG + Intronic
999770801 5:154774175-154774197 CTGAGGATGAGCAGCTGACTTGG + Intronic
999845543 5:155475535-155475557 GTGTGGAGAAAGAGATGACTAGG - Intergenic
1001880450 5:175239344-175239366 CTGTGGTTAGGGAAGTGCCTGGG - Intergenic
1003765676 6:9233696-9233718 CTCTGGATCAGGAGGTCATTAGG + Intergenic
1005332614 6:24764410-24764432 CTGTGGAGAAGGAGGTAAGAGGG - Intergenic
1008232605 6:49002005-49002027 CAGAGGAGAAGGAGGTGACCTGG - Intergenic
1010011420 6:71051832-71051854 CTCGGGATAAAGAGGTGCCTTGG - Intergenic
1011519923 6:88194258-88194280 CTCTGGATAAGGAGGTCGGTGGG + Intergenic
1012375574 6:98558004-98558026 CTAGGAAGAAGGAGGTGACTGGG - Intergenic
1012612015 6:101229146-101229168 TTTTGGATAAGGGGGTGACTGGG + Intergenic
1014089092 6:117382952-117382974 CTTTGAATCAGGTGGTGACTAGG - Intronic
1015404415 6:132821059-132821081 GCGTGGTTAAGGAGGTGACCTGG + Intergenic
1016494863 6:144649436-144649458 ATGTGGCTAATGATGTGACTGGG - Intronic
1016617906 6:146074312-146074334 CTGTGGAAAAGCAGGTGACTAGG - Intronic
1019519934 7:1456038-1456060 CTCTGGATGAGGTGGTGGCTGGG - Intronic
1020090910 7:5340319-5340341 CTGTGGATGAGGATTTGGCTTGG - Intronic
1020255843 7:6502873-6502895 CTGTGGACAAGAAGGTGGGTAGG + Intronic
1021537773 7:21724696-21724718 CTGTGGATATGGGAGTAACTGGG + Intronic
1021867158 7:24969869-24969891 CAGTGAACAAGGAGGTGACACGG - Intronic
1022640229 7:32175120-32175142 CTGTGGTTGAAGAGATGACTAGG + Intronic
1022804163 7:33805164-33805186 CTGTGGATTGGGAGGTGCCTAGG - Intergenic
1023708199 7:42964465-42964487 CTGTAGATAATGAGGTAACAGGG + Intergenic
1024393655 7:48842843-48842865 CTGTGGCTCAGATGGTGACTGGG + Intergenic
1024613267 7:51085179-51085201 CTGAGGATAAGGAGGAGAACAGG - Exonic
1027875532 7:83763269-83763291 CAATGAAGAAGGAGGTGACTAGG + Intergenic
1029440049 7:100582460-100582482 CTGGGGAAAAGGAGGTGTCGGGG + Intronic
1029839644 7:103348264-103348286 CTGTGGAGAAGTTGGTGGCTGGG - Intronic
1033407958 7:141089057-141089079 CTGTGGATAAAAAGGTGAGTAGG + Intronic
1036239511 8:7070275-7070297 TTTTGGATAAGGGGGTGACCGGG - Intergenic
1036599853 8:10250568-10250590 CTGTTGATAAGGAAATGTCTGGG - Intronic
1036664056 8:10727408-10727430 CTGTGGCTAAGCAGGTGCCCTGG - Intronic
1036816939 8:11909341-11909363 TTTTGGATAAGGGGGCGACTGGG + Intergenic
1036833660 8:12040842-12040864 TTTTGGATAAGGGGGTGACCGGG + Intergenic
1036855506 8:12287407-12287429 TTTTGGATAAGGGGGTGACCGGG + Intergenic
1036903828 8:12691250-12691272 TTTTGGATAAGGGGGTGACCGGG + Intergenic
1037087878 8:14875463-14875485 CTTTGGATAAGGAAGGGACAAGG + Intronic
1037575370 8:20197600-20197622 CGCTGGCTAAGCAGGTGACTGGG - Intronic
1037678277 8:21071266-21071288 CTGTGGGTGGGAAGGTGACTTGG + Intergenic
1038693940 8:29788399-29788421 CTGTGGAGAAGGAGGCGCCTAGG - Intergenic
1038798796 8:30731326-30731348 TTTTGGATAAGGGGGCGACTGGG - Intergenic
1039831694 8:41220585-41220607 ATGTGGATAAGAAGGTTACAAGG + Intergenic
1040809236 8:51432190-51432212 CTGTGGATAATGAGTTGCCCAGG + Intronic
1042792803 8:72627258-72627280 CTTTAGAGAAGGAGGTCACTAGG + Intronic
1043827818 8:84950012-84950034 GTGTGGATGGGGAGATGACTAGG - Intergenic
1043982341 8:86657283-86657305 CTAAGGATAATGGGGTGACTGGG + Intronic
1045010175 8:97951895-97951917 CTGCGGGAAAGGAGGAGACTAGG + Intronic
1045631409 8:104128191-104128213 CTGTGGATCAGATAGTGACTGGG - Intronic
1046956876 8:120071119-120071141 CTGTGGATGAGAAGTTGACTGGG - Intronic
1048957664 8:139550091-139550113 TTTTGGATAAGGGGGTGACCGGG + Intergenic
1049499217 8:142952555-142952577 CTGTGGCTGAGGGGGTGGCTGGG + Intergenic
1053150285 9:35738904-35738926 CTGTGGGAGAGGAGGGGACTTGG + Intronic
1057469161 9:95342409-95342431 CTGGGGGGAAGGAGGTAACTAGG + Intergenic
1058762556 9:108149271-108149293 CTGGGGAGGAGGAGGAGACTTGG - Intergenic
1058826914 9:108783303-108783325 CTGTGGATCAGGCTGTGTCTAGG - Intergenic
1059463262 9:114448861-114448883 CTGTGGGTGAGGAAGTGACAAGG - Intronic
1186307104 X:8273605-8273627 CTGTAGATATGGGGCTGACTAGG - Intergenic
1189824975 X:44908748-44908770 CTGCAGATAAGGATGTGACATGG + Intronic
1189862300 X:45286111-45286133 CTGGGGATAAGGAGATTACAGGG - Intergenic
1190314911 X:49144484-49144506 TTTTGGATAAGGGGGCGACTGGG - Intergenic
1190426155 X:50335990-50336012 CCTTGGATAAGGGGGTGACCAGG + Intronic
1190733246 X:53238307-53238329 CTGTGGAGAAAGGGGAGACTGGG + Intronic
1196507461 X:116463994-116464016 ATGTGTATAAGGAGGAGAATGGG - Intergenic
1197249367 X:124198935-124198957 TTGTGGATAATGAGATGAATGGG + Intronic
1198610164 X:138390170-138390192 CTGAGGATAGGGAGATGACTAGG + Intergenic
1200394393 X:155974963-155974985 TCTTGGATAAGGGGGTGACTGGG + Intergenic
1202036975 Y:20645923-20645945 TTTTGGATAAGGGGGTGACTGGG - Intergenic
1202085769 Y:21135199-21135221 CTGGGGATAAGTGGGTGACAGGG - Intergenic
1202300271 Y:23406200-23406222 TTCTGGATACGGAGGTGACATGG + Intergenic
1202570540 Y:26264398-26264420 TTCTGGATACGGAGGTGACATGG - Intergenic