ID: 1136428208

View in Genome Browser
Species Human (GRCh38)
Location 16:30183229-30183251
Sequence GGCCCCGCAGACGCGAGCGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 89}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136428208_1136428229 29 Left 1136428208 16:30183229-30183251 CCTGCGCTCGCGTCTGCGGGGCC 0: 1
1: 0
2: 0
3: 9
4: 89
Right 1136428229 16:30183281-30183303 GGCGGGCACCGAGGCCTGGCGGG 0: 1
1: 0
2: 1
3: 35
4: 347
1136428208_1136428217 1 Left 1136428208 16:30183229-30183251 CCTGCGCTCGCGTCTGCGGGGCC 0: 1
1: 0
2: 0
3: 9
4: 89
Right 1136428217 16:30183253-30183275 GGAGGAAGGGGCGGCGCAGCCGG 0: 1
1: 1
2: 3
3: 74
4: 730
1136428208_1136428227 25 Left 1136428208 16:30183229-30183251 CCTGCGCTCGCGTCTGCGGGGCC 0: 1
1: 0
2: 0
3: 9
4: 89
Right 1136428227 16:30183277-30183299 CCGGGGCGGGCACCGAGGCCTGG 0: 1
1: 0
2: 7
3: 56
4: 509
1136428208_1136428223 12 Left 1136428208 16:30183229-30183251 CCTGCGCTCGCGTCTGCGGGGCC 0: 1
1: 0
2: 0
3: 9
4: 89
Right 1136428223 16:30183264-30183286 CGGCGCAGCCGGGCCGGGGCGGG 0: 1
1: 0
2: 11
3: 92
4: 775
1136428208_1136428218 2 Left 1136428208 16:30183229-30183251 CCTGCGCTCGCGTCTGCGGGGCC 0: 1
1: 0
2: 0
3: 9
4: 89
Right 1136428218 16:30183254-30183276 GAGGAAGGGGCGGCGCAGCCGGG 0: 1
1: 0
2: 3
3: 52
4: 493
1136428208_1136428228 28 Left 1136428208 16:30183229-30183251 CCTGCGCTCGCGTCTGCGGGGCC 0: 1
1: 0
2: 0
3: 9
4: 89
Right 1136428228 16:30183280-30183302 GGGCGGGCACCGAGGCCTGGCGG 0: 1
1: 1
2: 1
3: 34
4: 383
1136428208_1136428219 6 Left 1136428208 16:30183229-30183251 CCTGCGCTCGCGTCTGCGGGGCC 0: 1
1: 0
2: 0
3: 9
4: 89
Right 1136428219 16:30183258-30183280 AAGGGGCGGCGCAGCCGGGCCGG 0: 1
1: 1
2: 1
3: 29
4: 284
1136428208_1136428222 11 Left 1136428208 16:30183229-30183251 CCTGCGCTCGCGTCTGCGGGGCC 0: 1
1: 0
2: 0
3: 9
4: 89
Right 1136428222 16:30183263-30183285 GCGGCGCAGCCGGGCCGGGGCGG 0: 1
1: 1
2: 11
3: 75
4: 608
1136428208_1136428221 8 Left 1136428208 16:30183229-30183251 CCTGCGCTCGCGTCTGCGGGGCC 0: 1
1: 0
2: 0
3: 9
4: 89
Right 1136428221 16:30183260-30183282 GGGGCGGCGCAGCCGGGCCGGGG 0: 1
1: 0
2: 9
3: 78
4: 665
1136428208_1136428220 7 Left 1136428208 16:30183229-30183251 CCTGCGCTCGCGTCTGCGGGGCC 0: 1
1: 0
2: 0
3: 9
4: 89
Right 1136428220 16:30183259-30183281 AGGGGCGGCGCAGCCGGGCCGGG 0: 1
1: 0
2: 4
3: 52
4: 509
1136428208_1136428225 20 Left 1136428208 16:30183229-30183251 CCTGCGCTCGCGTCTGCGGGGCC 0: 1
1: 0
2: 0
3: 9
4: 89
Right 1136428225 16:30183272-30183294 CCGGGCCGGGGCGGGCACCGAGG 0: 1
1: 0
2: 8
3: 118
4: 805
1136428208_1136428215 -8 Left 1136428208 16:30183229-30183251 CCTGCGCTCGCGTCTGCGGGGCC 0: 1
1: 0
2: 0
3: 9
4: 89
Right 1136428215 16:30183244-30183266 GCGGGGCCGGGAGGAAGGGGCGG 0: 1
1: 0
2: 22
3: 225
4: 1797

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136428208 Original CRISPR GGCCCCGCAGACGCGAGCGC AGG (reversed) Intronic