ID: 1136428208

View in Genome Browser
Species Human (GRCh38)
Location 16:30183229-30183251
Sequence GGCCCCGCAGACGCGAGCGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 89}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136428208_1136428225 20 Left 1136428208 16:30183229-30183251 CCTGCGCTCGCGTCTGCGGGGCC 0: 1
1: 0
2: 0
3: 9
4: 89
Right 1136428225 16:30183272-30183294 CCGGGCCGGGGCGGGCACCGAGG 0: 1
1: 0
2: 8
3: 118
4: 805
1136428208_1136428222 11 Left 1136428208 16:30183229-30183251 CCTGCGCTCGCGTCTGCGGGGCC 0: 1
1: 0
2: 0
3: 9
4: 89
Right 1136428222 16:30183263-30183285 GCGGCGCAGCCGGGCCGGGGCGG 0: 1
1: 1
2: 11
3: 75
4: 608
1136428208_1136428218 2 Left 1136428208 16:30183229-30183251 CCTGCGCTCGCGTCTGCGGGGCC 0: 1
1: 0
2: 0
3: 9
4: 89
Right 1136428218 16:30183254-30183276 GAGGAAGGGGCGGCGCAGCCGGG 0: 1
1: 0
2: 3
3: 52
4: 493
1136428208_1136428220 7 Left 1136428208 16:30183229-30183251 CCTGCGCTCGCGTCTGCGGGGCC 0: 1
1: 0
2: 0
3: 9
4: 89
Right 1136428220 16:30183259-30183281 AGGGGCGGCGCAGCCGGGCCGGG 0: 1
1: 0
2: 4
3: 52
4: 509
1136428208_1136428228 28 Left 1136428208 16:30183229-30183251 CCTGCGCTCGCGTCTGCGGGGCC 0: 1
1: 0
2: 0
3: 9
4: 89
Right 1136428228 16:30183280-30183302 GGGCGGGCACCGAGGCCTGGCGG 0: 1
1: 1
2: 1
3: 34
4: 383
1136428208_1136428221 8 Left 1136428208 16:30183229-30183251 CCTGCGCTCGCGTCTGCGGGGCC 0: 1
1: 0
2: 0
3: 9
4: 89
Right 1136428221 16:30183260-30183282 GGGGCGGCGCAGCCGGGCCGGGG 0: 1
1: 0
2: 9
3: 78
4: 665
1136428208_1136428229 29 Left 1136428208 16:30183229-30183251 CCTGCGCTCGCGTCTGCGGGGCC 0: 1
1: 0
2: 0
3: 9
4: 89
Right 1136428229 16:30183281-30183303 GGCGGGCACCGAGGCCTGGCGGG 0: 1
1: 0
2: 1
3: 35
4: 347
1136428208_1136428217 1 Left 1136428208 16:30183229-30183251 CCTGCGCTCGCGTCTGCGGGGCC 0: 1
1: 0
2: 0
3: 9
4: 89
Right 1136428217 16:30183253-30183275 GGAGGAAGGGGCGGCGCAGCCGG 0: 1
1: 1
2: 3
3: 74
4: 730
1136428208_1136428215 -8 Left 1136428208 16:30183229-30183251 CCTGCGCTCGCGTCTGCGGGGCC 0: 1
1: 0
2: 0
3: 9
4: 89
Right 1136428215 16:30183244-30183266 GCGGGGCCGGGAGGAAGGGGCGG 0: 1
1: 0
2: 22
3: 225
4: 1797
1136428208_1136428219 6 Left 1136428208 16:30183229-30183251 CCTGCGCTCGCGTCTGCGGGGCC 0: 1
1: 0
2: 0
3: 9
4: 89
Right 1136428219 16:30183258-30183280 AAGGGGCGGCGCAGCCGGGCCGG 0: 1
1: 1
2: 1
3: 29
4: 284
1136428208_1136428227 25 Left 1136428208 16:30183229-30183251 CCTGCGCTCGCGTCTGCGGGGCC 0: 1
1: 0
2: 0
3: 9
4: 89
Right 1136428227 16:30183277-30183299 CCGGGGCGGGCACCGAGGCCTGG 0: 1
1: 0
2: 7
3: 56
4: 509
1136428208_1136428223 12 Left 1136428208 16:30183229-30183251 CCTGCGCTCGCGTCTGCGGGGCC 0: 1
1: 0
2: 0
3: 9
4: 89
Right 1136428223 16:30183264-30183286 CGGCGCAGCCGGGCCGGGGCGGG 0: 1
1: 0
2: 11
3: 92
4: 775

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136428208 Original CRISPR GGCCCCGCAGACGCGAGCGC AGG (reversed) Intronic
900104522 1:976670-976692 GGCCCCGCACACGCCCGCCCCGG + Intronic
900148675 1:1168960-1168982 GGCCCCGCAGACACCAGCCCAGG + Intergenic
901506690 1:9689734-9689756 GACCCCGCAGACGCCCGCACAGG - Intronic
905137104 1:35808279-35808301 CGCCGCGGAGACGCGGGCGCTGG - Exonic
905670882 1:39789170-39789192 CGCCCCGCCGTCGCGTGCGCGGG + Intergenic
906636974 1:47416373-47416395 GGCCCCGACGGCGCGACCGCTGG - Exonic
906637074 1:47416832-47416854 GGCGCCGCGGCCGCGTGCGCGGG - Exonic
911115031 1:94237667-94237689 GGCCCCGCCCCCGGGAGCGCGGG - Intronic
914519776 1:148404975-148404997 GGGCCAGCAGACGCGCGCGTGGG - Intergenic
920225362 1:204434564-204434586 GGCCACGCAGCAGCCAGCGCAGG + Exonic
920886896 1:209938206-209938228 GGGGCAGCAGACGCGAGGGCTGG - Intronic
1066402619 10:35090370-35090392 GGCCCCGGAGACGCGGGGGGTGG + Intronic
1077183916 11:1228182-1228204 GGCCCCGCAGCCGGCAGCCCTGG + Intronic
1077285642 11:1764099-1764121 GACCCCGCGGGCGCGAGCGGCGG - Intergenic
1090662347 11:128891175-128891197 GGCCGCGGGGACGCGAGCGGAGG + Intergenic
1096021478 12:48329329-48329351 GGCCCCGCAGAGGCGGGAGTGGG + Exonic
1103562749 12:121800728-121800750 CGCCCGGCTGAGGCGAGCGCGGG + Intronic
1104685276 12:130780757-130780779 GGCCCCGCAGAGACGTGCCCAGG - Intergenic
1105525720 13:21176390-21176412 GGCCCGGCTGCAGCGAGCGCTGG - Exonic
1110925763 13:81149537-81149559 TGCCCCCCAGACCCCAGCGCAGG - Intergenic
1113653950 13:112056828-112056850 AGCCCCGTAGCCGCGGGCGCCGG - Intergenic
1119709680 14:76812706-76812728 AGCCCCGCAGAGGCGAGCCCTGG + Intronic
1121690825 14:95876322-95876344 GGCTCCGCAGACGCGGGGCCGGG + Intergenic
1122723656 14:103736311-103736333 GGCCCCACAGAGGCCAGCGAGGG + Intronic
1122768179 14:104085574-104085596 GGCCCCGCGGAGGCGGGCGGGGG - Intergenic
1122863288 14:104592002-104592024 GGCCCCGCAGAAGCAAGTGGAGG - Intronic
1125709699 15:41774784-41774806 GTCCCCGCCGGCGCTAGCGCAGG + Intronic
1130296096 15:82647822-82647844 GGCCCCGCCCAGGCGAGCGGCGG + Intronic
1132419292 15:101652046-101652068 GGCTCCGCAGCCGCGATGGCGGG + Intronic
1132693199 16:1190804-1190826 GGCCCTGCAGACCCAAGAGCTGG + Intronic
1132875472 16:2135228-2135250 GGCTCTGCAGACGCCAGCGGGGG - Intronic
1133035049 16:3029748-3029770 GGTCCCGCAGACGGAAGCGCGGG + Intronic
1133652764 16:7828574-7828596 GGCACAGCAGTCGCCAGCGCAGG - Intergenic
1133784224 16:8962967-8962989 GGCCCGGCGGACGCGAGGTCGGG + Intronic
1136428208 16:30183229-30183251 GGCCCCGCAGACGCGAGCGCAGG - Intronic
1140025803 16:71289357-71289379 GGCCCCGCAGCCGCGAATGCCGG + Exonic
1142069928 16:88086496-88086518 GTCCACGCAGAGGGGAGCGCGGG - Intronic
1143116663 17:4585085-4585107 AACCCCGCAGACGCGAGCAGAGG - Intronic
1150764605 17:67993464-67993486 GGACCGGCAGGCGCGCGCGCAGG + Exonic
1151314222 17:73311897-73311919 GTCCCCGGAGACCCGAGCTCTGG + Exonic
1151558730 17:74859994-74860016 GGCCCCGGAGCCGCGGACGCCGG - Intronic
1160919508 19:1513171-1513193 TGCCCGGCGGACGCGAGCGCAGG + Exonic
1161265159 19:3360344-3360366 GGCCCCGCTGCCGCGCGCGCGGG + Intronic
1161864269 19:6822146-6822168 GTCCCCGCAGACCCCAGCGCAGG - Intronic
1162572861 19:11482701-11482723 GGGACCGCAGCCGCGAGCTCAGG - Intronic
1162731403 19:12721166-12721188 GGCCGCGCAGTCGCGGGCTCGGG + Intronic
1164625456 19:29724572-29724594 AGCCCTGCAGACGCGAGCAGTGG + Intergenic
1165104642 19:33461785-33461807 GACCACGCAGACGCAAGTGCTGG + Intronic
1166014646 19:39970991-39971013 GTACCCGCAGGCGCGAGGGCGGG - Exonic
1167797521 19:51719517-51719539 GGACGCGCAGCCGCGCGCGCGGG + Exonic
1168271221 19:55250827-55250849 GGCCCCCCACACTCGACCGCAGG + Intronic
933600057 2:84319841-84319863 GGCTCCGTAGACGCGAGAGGAGG - Intergenic
937221213 2:120344269-120344291 GGCCCAGCAGACGCAGCCGCTGG + Intergenic
938374651 2:130797665-130797687 GAACCCGCAGCCGGGAGCGCAGG + Intergenic
938408251 2:131044585-131044607 GGCCAGGCAGGCGGGAGCGCCGG - Intronic
938649475 2:133367319-133367341 GACCCAGCAGACGGGAGCTCTGG + Intronic
941112122 2:161427186-161427208 GGCCCCGCGGCCTCGAGCCCCGG - Intronic
947418482 2:229921706-229921728 GGCCCCGCCGCCGCCGGCGCCGG + Intronic
949004502 2:241637528-241637550 GGCCGGGCCGACGCGAGCCCCGG - Intronic
1175847522 20:62066272-62066294 GGCGGCGCTGACGGGAGCGCCGG + Intergenic
1178488539 21:33033563-33033585 GGCCCTGCAGACACGCGAGCGGG + Intergenic
1183370216 22:37427788-37427810 GGCCCCACGGACCCGAGCCCCGG + Intergenic
1185067452 22:48639274-48639296 GGCCCCGCAGGCCTGAGGGCAGG - Intronic
950282446 3:11719600-11719622 GGGCCGGCGGACGGGAGCGCGGG + Intronic
950728296 3:14933968-14933990 GGCCCCCCAGACGTCACCGCAGG + Exonic
951907945 3:27722074-27722096 GAGCCCGCAGCCGCCAGCGCAGG - Exonic
953925395 3:46980008-46980030 GGCCGCGTAGCCGCGCGCGCGGG + Intronic
954778944 3:53045567-53045589 GGCCCCGCGGTCCCGCGCGCCGG - Intronic
956979023 3:74614781-74614803 GGCGCCGCAGACGCGAGGCTCGG - Intergenic
968230636 3:197003007-197003029 GGCCTCGCGGACGGGGGCGCGGG + Exonic
969396854 4:6927307-6927329 GGCACCGCAGCCGAGAGTGCTGG + Intronic
969704871 4:8786198-8786220 GGCCCAGCAGACGCCACTGCCGG + Intergenic
973982097 4:56315423-56315445 GGCCCCGGCGACGCGAGGGCGGG + Exonic
975779055 4:77819917-77819939 GGCCCCGCGGCCGCGGCCGCCGG + Intergenic
987050362 5:14143414-14143436 GGACGCGCAGTCGCGAGGGCGGG - Intergenic
1001581257 5:172800112-172800134 GGCCCCTGAGAAGCGAGCCCTGG - Intergenic
1002432924 5:179213513-179213535 GGCCCAGCAGAGGCGAGCTGGGG + Intronic
1002887890 6:1312265-1312287 TGCCCCGAAGACGCCCGCGCGGG + Intergenic
1002926695 6:1609453-1609475 AGCCCCGCCGACGCCAGCGCTGG - Intergenic
1012887295 6:104859984-104860006 GGCCACGCCAACGCGGGCGCAGG + Intergenic
1020212081 7:6165091-6165113 GGCCCCTCAGACAGGACCGCAGG + Intronic
1020270272 7:6590503-6590525 GGCCCCGCAGGCGGGCGGGCGGG + Intronic
1025175978 7:56802673-56802695 GGCCCCTCAGAGGCAAGAGCAGG + Intergenic
1025216529 7:57060928-57060950 GGCCCCGCAGAAGCCATCGAAGG - Intergenic
1025654851 7:63509802-63509824 GGCCCCGCAGAAGCCATCGAAGG + Intergenic
1025695816 7:63773749-63773771 GGCCCCTCAGAGGCAAGAGCAGG - Intergenic
1026894616 7:74002990-74003012 GGCCCCGCAGACATGAGGTCAGG + Intergenic
1033186456 7:139231429-139231451 CGCGCCGTAGAAGCGAGCGCCGG + Intronic
1033299949 7:140176704-140176726 AGCCCCGCAGCCGCCACCGCCGG - Intronic
1049796875 8:144501008-144501030 GGCCCCGCGGACGTCAGCCCCGG + Intronic
1050744257 9:8858140-8858162 GACCCCCCAGCCGCGAGCGGCGG - Intronic
1059388737 9:113985508-113985530 GGCCCCCCAGAGGGGAGCACGGG - Intronic
1059414396 9:114154280-114154302 GTCCCCGCAGCCGTGGGCGCGGG - Intergenic
1060759171 9:126234085-126234107 GGCCCCGCAGTGGCGTGTGCTGG + Intergenic
1060770251 9:126327051-126327073 GGCCCTGCAGCCGGGAGGGCGGG + Intronic
1061449922 9:130662392-130662414 GCCCCCTCAGACTCGAGCTCTGG + Intergenic
1062056994 9:134473948-134473970 GGCCCCCCAGGCGCCAGCCCAGG - Intergenic
1062634908 9:137485701-137485723 GACCCCGGAGACGCGAGTGAGGG + Intronic
1199595858 X:149505271-149505293 GGGCCCGCAGGCCCGGGCGCTGG + Intronic