ID: 1136428992

View in Genome Browser
Species Human (GRCh38)
Location 16:30186261-30186283
Sequence GAGGCTTCCATGGGCACAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 121}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136428992_1136429005 0 Left 1136428992 16:30186261-30186283 CCAGTTGTGCCCATGGAAGCCTC 0: 1
1: 0
2: 1
3: 9
4: 121
Right 1136429005 16:30186284-30186306 ACTCGGGGAAGCTGGGGTGGGGG 0: 1
1: 1
2: 5
3: 113
4: 1266
1136428992_1136429007 15 Left 1136428992 16:30186261-30186283 CCAGTTGTGCCCATGGAAGCCTC 0: 1
1: 0
2: 1
3: 9
4: 121
Right 1136429007 16:30186299-30186321 GGTGGGGGTGCCAACCCTAAGGG 0: 1
1: 0
2: 0
3: 7
4: 69
1136428992_1136429002 -3 Left 1136428992 16:30186261-30186283 CCAGTTGTGCCCATGGAAGCCTC 0: 1
1: 0
2: 1
3: 9
4: 121
Right 1136429002 16:30186281-30186303 CTCACTCGGGGAAGCTGGGGTGG 0: 1
1: 0
2: 1
3: 26
4: 609
1136428992_1136429004 -1 Left 1136428992 16:30186261-30186283 CCAGTTGTGCCCATGGAAGCCTC 0: 1
1: 0
2: 1
3: 9
4: 121
Right 1136429004 16:30186283-30186305 CACTCGGGGAAGCTGGGGTGGGG 0: 1
1: 0
2: 6
3: 105
4: 1032
1136428992_1136428998 -8 Left 1136428992 16:30186261-30186283 CCAGTTGTGCCCATGGAAGCCTC 0: 1
1: 0
2: 1
3: 9
4: 121
Right 1136428998 16:30186276-30186298 GAAGCCTCACTCGGGGAAGCTGG 0: 1
1: 0
2: 0
3: 9
4: 97
1136428992_1136429000 -6 Left 1136428992 16:30186261-30186283 CCAGTTGTGCCCATGGAAGCCTC 0: 1
1: 0
2: 1
3: 9
4: 121
Right 1136429000 16:30186278-30186300 AGCCTCACTCGGGGAAGCTGGGG 0: 1
1: 0
2: 2
3: 14
4: 206
1136428992_1136429006 14 Left 1136428992 16:30186261-30186283 CCAGTTGTGCCCATGGAAGCCTC 0: 1
1: 0
2: 1
3: 9
4: 121
Right 1136429006 16:30186298-30186320 GGGTGGGGGTGCCAACCCTAAGG 0: 1
1: 0
2: 0
3: 6
4: 127
1136428992_1136428999 -7 Left 1136428992 16:30186261-30186283 CCAGTTGTGCCCATGGAAGCCTC 0: 1
1: 0
2: 1
3: 9
4: 121
Right 1136428999 16:30186277-30186299 AAGCCTCACTCGGGGAAGCTGGG 0: 1
1: 0
2: 0
3: 7
4: 84
1136428992_1136429003 -2 Left 1136428992 16:30186261-30186283 CCAGTTGTGCCCATGGAAGCCTC 0: 1
1: 0
2: 1
3: 9
4: 121
Right 1136429003 16:30186282-30186304 TCACTCGGGGAAGCTGGGGTGGG 0: 1
1: 0
2: 6
3: 222
4: 4787

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136428992 Original CRISPR GAGGCTTCCATGGGCACAAC TGG (reversed) Intronic
900603232 1:3512079-3512101 GAGGCAGCCATGGGCACACTGGG + Exonic
905861923 1:41357739-41357761 GAGGCCTCCAGGGGCAGAAAGGG - Intergenic
907137422 1:52153021-52153043 GAGGCCTGCATGGGCAGAAATGG + Intronic
909145416 1:71923996-71924018 GAGGATTGCTTGGGCACAAAAGG - Intronic
910546697 1:88426238-88426260 GAAGCATCCCTGGGCCCAACTGG + Intergenic
911039783 1:93582625-93582647 GTGGCTTCCCTGGGCACATGAGG + Exonic
913200867 1:116494436-116494458 GGCGCCTTCATGGGCACAACGGG + Intergenic
913449765 1:118985259-118985281 GACGCTGCCCTGGGCACAATAGG + Intronic
914457724 1:147852009-147852031 GAGGCTTCCAATGGCCAAACTGG + Intergenic
914943985 1:152047690-152047712 GAGAGTTCCATGGGCTCAGCTGG - Intronic
915111649 1:153567732-153567754 GAGCCTTCCCAGGGCCCAACCGG + Intronic
920716032 1:208341240-208341262 GAGGCTTCCATGGGCCACATGGG - Intergenic
1063197847 10:3759775-3759797 GAAGGTTCTCTGGGCACAACTGG - Intergenic
1065130134 10:22612371-22612393 GAGGCTTCCCTGGGCAGCAATGG + Intronic
1075271203 10:121053260-121053282 GAGGCTTAAAGGGGCATAACAGG - Intergenic
1075978383 10:126716540-126716562 GTGTCATCCATGGGCTCAACTGG - Intergenic
1076010086 10:126980741-126980763 GAAGCTTCCATTCCCACAACAGG + Intronic
1076757943 10:132583991-132584013 GAGGATTCCTTGGGCACAGGAGG + Intronic
1080109255 11:28546982-28547004 GAGTCTTCCATGGGCCAAGCTGG - Intergenic
1081771779 11:45654563-45654585 AAGGCTTCCTTGGGAACAACAGG - Intronic
1082996478 11:59259809-59259831 GAGTCTTCTATGGACAGAACAGG - Intergenic
1085199502 11:74693208-74693230 GAGGCTCCAATGGCCACAGCAGG - Intergenic
1085827744 11:79865496-79865518 GAAGCTTCCAGAGGCAGAACAGG + Intergenic
1086233181 11:84594813-84594835 CAGGTTTCCATGGATACAACTGG + Intronic
1088250881 11:107859833-107859855 GAGGCTTCCACGGGCTAAAGAGG + Intronic
1089392944 11:118114444-118114466 GTGGCTTCCATGGGCAGGTCTGG + Intronic
1091025295 11:132136103-132136125 GAGGCTTCTGTGGGCTCTACAGG + Intronic
1091962741 12:4712308-4712330 TAGTCATCTATGGGCACAACTGG + Intronic
1101543682 12:105689213-105689235 GTGGCCTCCATTGACACAACAGG + Intergenic
1111503563 13:89157576-89157598 GAGACTACCATGGGCAAAATAGG + Intergenic
1112417061 13:99211887-99211909 GAGGCTGCCATGGTCCCAAGGGG - Intronic
1112489397 13:99848278-99848300 GGGGCTTTCATCGCCACAACTGG + Intronic
1118461912 14:65995158-65995180 GAGGAGTCCATGGGCCCGACTGG - Intronic
1118767025 14:68916704-68916726 GAGGGTTCCAAGGCCACAACTGG + Intronic
1120145798 14:80977003-80977025 GAGCCTACCAAAGGCACAACCGG - Intronic
1121835927 14:97092319-97092341 CAAGCTTCCATGGGCAGAGCTGG + Intergenic
1123447074 15:20339205-20339227 GTGGCATCCATGGGCAGAGCTGG + Intergenic
1126480323 15:49111300-49111322 CAGCCTTCCATGGCCACCACTGG + Intronic
1134766851 16:16766811-16766833 GATGCTTCCATGAGTACATCAGG - Intergenic
1136428992 16:30186261-30186283 GAGGCTTCCATGGGCACAACTGG - Intronic
1137591679 16:49697639-49697661 GGGGCTCCCTGGGGCACAACAGG + Intronic
1138310481 16:56019393-56019415 GAGGCCTCCAGGGGAACATCTGG - Intergenic
1139171154 16:64631000-64631022 GAGGATTCCAACGGAACAACTGG + Intergenic
1140326078 16:74005049-74005071 CAGGCTTCCAGGGGCACATGTGG + Intergenic
1140760564 16:78105139-78105161 GGGGCTGCCTTGGGCACCACTGG - Intronic
1141834268 16:86528414-86528436 GAGGCTCCTTTGGGCACAGCAGG - Intergenic
1142215040 16:88825910-88825932 GAGGATTCCAAAGGCTCAACGGG - Intronic
1143539301 17:7559782-7559804 GAGGCTGCCAACAGCACAACGGG + Intronic
1149545389 17:57499749-57499771 GTGGCTGCCACTGGCACAACAGG + Intronic
1152188704 17:78875202-78875224 GAGTCTATCAGGGGCACAACAGG + Intronic
1152706454 17:81846081-81846103 GTGGCTGCCCTGGGCACACCAGG + Intronic
1153362224 18:4210106-4210128 GAGCATTCCATGGGAACAAATGG - Intronic
1153508341 18:5826828-5826850 CAGGCCTCCATGGACACTACAGG + Intergenic
1155176535 18:23306113-23306135 GAGGCTGTCCTGGGCACACCTGG + Intronic
1157197637 18:45632364-45632386 CAGGACTCCATGGGTACAACGGG + Exonic
1157618847 18:49003628-49003650 GAAGCTGCCATGAGCCCAACTGG - Intergenic
1160385051 18:78491811-78491833 GAGGCTGCCATGGGGAAAATTGG + Intergenic
1160616706 18:80136348-80136370 GAGGCTTCCAGGGGCACCCTGGG - Exonic
1162411793 19:10510532-10510554 GAGCCTTTTATGGGCACAAACGG + Intergenic
1162573543 19:11485912-11485934 GAGATTCCCAGGGGCACAACTGG + Intronic
1163138088 19:15327848-15327870 GTGGCTTCCAGGGGCAAAAGTGG + Intronic
1165740417 19:38202000-38202022 GAGGTTTCCCTGGGAACACCCGG + Intronic
925624775 2:5831912-5831934 CAGGCTTCCCTAGGCACAAACGG - Intergenic
926722892 2:15975292-15975314 GTGGCTTCCCTGGGCACATTGGG - Intergenic
929468040 2:42163613-42163635 GAGGCTTCCATCTGGACATCTGG + Intergenic
935798909 2:106672565-106672587 GACCCTTGCATGGGCACCACAGG - Intergenic
936076435 2:109404590-109404612 GAGGCTGCCACGGGCACACAGGG + Intronic
937293583 2:120796596-120796618 GAGGGTTGCAGGGGCACAGCGGG - Intronic
939961083 2:148566679-148566701 GAGGGTTCCATCAGCACACCAGG - Intergenic
942141067 2:172978087-172978109 GAGGCTTCCATGGGGACTCCTGG - Intronic
942163903 2:173222433-173222455 GAGGCTTCCATGGCCAGCAGTGG - Intronic
945671685 2:212809720-212809742 TAGACTTCCATGGGCACAGGTGG + Intergenic
947702214 2:232243893-232243915 GAGGGTTCCATGGGGCCAAAAGG - Intronic
1169496685 20:6122711-6122733 GAGGCTTTCATGGGCACCAGTGG - Intronic
1171216499 20:23356340-23356362 GCGGCCTCCAAGGGCACAGCGGG + Intergenic
1173224052 20:41151578-41151600 GAGGTTTCCCTGAGCACATCTGG - Intronic
1175227959 20:57455969-57455991 GAGGCGTCCAGTGGCCCAACTGG - Intergenic
1175293879 20:57895676-57895698 GAGGCTTCCAAGTTCACAGCTGG - Intergenic
1179257396 21:39728552-39728574 GAGGCTGCCATGACCACCACTGG - Intergenic
1179289079 21:40003049-40003071 GTGGCTTCCATCTGTACAACAGG + Intergenic
1179681248 21:43022579-43022601 GCCGCTTCCATGGGCATAAAAGG + Intronic
1180204155 21:46247008-46247030 CAGGCCTCCAAGGGCACAGCTGG + Intronic
1180252552 21:46598658-46598680 GCGGCTTCCGAGGGCACTACCGG - Intergenic
1181350827 22:22256717-22256739 GTGGCATCCATGGGCAGAGCTGG - Intergenic
1184658135 22:45952395-45952417 GGGTCTCCCATGGGCACAATGGG + Intronic
954426968 3:50448465-50448487 GGTGCTTCCATGGGCACCTCAGG + Intronic
957500319 3:81048166-81048188 GAGAATTCCATCTGCACAACAGG - Intergenic
958547045 3:95567341-95567363 GGGGCCTCCATGGCCAGAACTGG + Intergenic
960038353 3:113124314-113124336 GAGACTTACAAGCGCACAACAGG + Intergenic
961322515 3:126085453-126085475 GAGGCTTCAATGGGCCCCACTGG - Intronic
962344362 3:134608648-134608670 GAGACTTCCATGATCAGAACAGG - Exonic
965496954 3:169410710-169410732 TAGGCGTCAATGGGCACGACTGG - Intronic
967075312 3:185996570-185996592 GAGGCATCAAAAGGCACAACAGG + Intergenic
968501379 4:951746-951768 GAGGCTTTGCTGGGCACCACTGG + Intronic
969584115 4:8082185-8082207 GAGGTTTCCTTGGGCACGAGGGG - Intronic
970606449 4:17686352-17686374 CAGGCTTACATGGGGGCAACAGG + Intronic
974463800 4:62226402-62226424 GAGGCTGCCTTGGGTGCAACTGG + Intergenic
976555118 4:86441809-86441831 GAGGCTTCCATGGGGACAATAGG - Intronic
977444167 4:97107795-97107817 GAGGTTTCTTTGGGCACACCAGG + Intergenic
980078357 4:128318118-128318140 GAGGCTTCAATGGCCAAAGCTGG - Intergenic
985717998 5:1473440-1473462 GAGGCATCCACGGTCACACCAGG - Intronic
986567446 5:9128854-9128876 GGGGCTGCCATGTGCATAACAGG + Intronic
987368083 5:17167830-17167852 GAGGCTATCATGGGCAAAAAAGG + Intronic
991996179 5:72389439-72389461 GAGGCTGCCATGTGGGCAACAGG + Intergenic
996207503 5:120759501-120759523 GTGGCTTCCATGGGCTCAGGAGG + Intergenic
1003132260 6:3404908-3404930 GAGGTTCAGATGGGCACAACAGG - Intronic
1006763591 6:36485405-36485427 GAGCCTTCCATGGGGACCACAGG - Intronic
1016099668 6:140083175-140083197 CAGACTTCCATCTGCACAACGGG - Intergenic
1019449246 7:1088286-1088308 GAGGCTTCCAGGAGCACAGAAGG + Exonic
1023064592 7:36364893-36364915 GAGGCTTGCATGGTCTCAAATGG + Intronic
1024060830 7:45697331-45697353 GAGGCTGCAGTGGGCACAGCTGG - Intronic
1028075851 7:86514583-86514605 CAGGCATGCATGGGCACAGCTGG + Intergenic
1034492078 7:151398868-151398890 GAGGCTGCAATGGGCTCAGCGGG - Intronic
1035319257 7:158017906-158017928 GAGGCTTCCATTGGAACTCCCGG - Intronic
1036498754 8:9294576-9294598 GAGGCTGCCATGGACTCACCTGG + Intergenic
1038439952 8:27564828-27564850 GAGGCTTCCATGTGCACAGGAGG - Intergenic
1038455105 8:27667818-27667840 GAGGCTTCTGTCGGCACCACAGG + Intronic
1040519251 8:48160705-48160727 GAGGCTCCCAAGGGCACCAAGGG + Intergenic
1049422630 8:142523714-142523736 CAGGTTTCCATGGGCACCACAGG + Intronic
1050250147 9:3735031-3735053 AAGGCTTCCACCGGAACAACAGG - Intergenic
1051596239 9:18826746-18826768 GAGGATTGCAAGGGCAGAACAGG + Intronic
1057470156 9:95349786-95349808 GAGGCTGCGAGGGGCCCAACAGG - Intergenic
1059704238 9:116805548-116805570 GAGGAAGCCATGGGCACAATGGG - Intronic
1059763052 9:117357493-117357515 GGAGTTTCCATGGGCACAGCAGG + Intronic
1062517418 9:136943596-136943618 GTGGGTTCCAGGGGCACCACGGG - Intronic
1190017150 X:46836865-46836887 GAGGCTTTGATTGGCTCAACAGG + Intergenic
1190680076 X:52819047-52819069 GGGGCTTCCATGGCCTCTACGGG - Intergenic
1191724632 X:64266865-64266887 GAGATTTCTATGTGCACAACTGG + Intergenic
1192590034 X:72351945-72351967 GAGGCCTCCTTGGGCAGAACAGG + Intronic
1195104805 X:101593664-101593686 GAGGCTACCAGGGGCAGAAGTGG - Intergenic
1195532328 X:105970535-105970557 GAGGCTGCCATGTTCACCACAGG - Intergenic
1197773518 X:130105764-130105786 GAGACTGCCATGAGCACAAGTGG + Intronic