ID: 1136430348

View in Genome Browser
Species Human (GRCh38)
Location 16:30193395-30193417
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 3, 1: 0, 2: 0, 3: 10, 4: 105}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136430348_1136430354 -1 Left 1136430348 16:30193395-30193417 CCGACACCACCAGGACTCGGAAG 0: 3
1: 0
2: 0
3: 10
4: 105
Right 1136430354 16:30193417-30193439 GCTACAGGAGCAACGGTTGAGGG 0: 2
1: 0
2: 1
3: 6
4: 86
1136430348_1136430352 -8 Left 1136430348 16:30193395-30193417 CCGACACCACCAGGACTCGGAAG 0: 3
1: 0
2: 0
3: 10
4: 105
Right 1136430352 16:30193410-30193432 CTCGGAAGCTACAGGAGCAACGG 0: 2
1: 0
2: 0
3: 6
4: 125
1136430348_1136430355 26 Left 1136430348 16:30193395-30193417 CCGACACCACCAGGACTCGGAAG 0: 3
1: 0
2: 0
3: 10
4: 105
Right 1136430355 16:30193444-30193466 GTCCTCCACCTCCTACCGAGCGG 0: 2
1: 0
2: 0
3: 8
4: 106
1136430348_1136430353 -2 Left 1136430348 16:30193395-30193417 CCGACACCACCAGGACTCGGAAG 0: 3
1: 0
2: 0
3: 10
4: 105
Right 1136430353 16:30193416-30193438 AGCTACAGGAGCAACGGTTGAGG 0: 2
1: 0
2: 1
3: 2
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136430348 Original CRISPR CTTCCGAGTCCTGGTGGTGT CGG (reversed) Exonic
900090981 1:920453-920475 CTGTCCAGTCCTGGTGCTGTTGG - Intergenic
900622187 1:3592544-3592566 CTGCCGAGTCCTGGGGGTTCGGG - Intronic
900906465 1:5563022-5563044 CATCACAGTCCTGGAGGTGTGGG - Intergenic
901883426 1:12207105-12207127 CCTCAGAGTCCTAGTGGTGGGGG - Exonic
903538311 1:24082054-24082076 CTTCCGAGTCATGCTGGTCCAGG + Exonic
911596232 1:99801462-99801484 CCTTCTAGGCCTGGTGGTGTTGG + Intergenic
915603796 1:156938519-156938541 CTTCCTGGTGGTGGTGGTGTCGG - Intronic
916026554 1:160838277-160838299 CTTCCTAGTTCTGGTGATGGAGG - Intronic
916931777 1:169586344-169586366 CCTCTGGGTCCTGGTGGTCTTGG - Exonic
920040280 1:203090996-203091018 CTTCAGAGGCCTGGTGGAGGGGG - Intronic
922617122 1:226967428-226967450 CTTCGGAGTCTTTGTGGGGTGGG + Intronic
924460183 1:244252233-244252255 GTTTCGAGGCCTGGTGGTCTGGG - Intergenic
1063099094 10:2934381-2934403 CTTCTGTGTCCTGGCAGTGTGGG - Intergenic
1064950873 10:20848722-20848744 CTGGCGAGTGGTGGTGGTGTTGG - Intronic
1072404363 10:95136214-95136236 ATCCAGGGTCCTGGTGGTGTAGG - Intergenic
1076130462 10:128010421-128010443 CTTCCCTGACCTGGTGGTGATGG - Intronic
1076685365 10:132196226-132196248 GTTCCGAGTCCTGGGGGAGGTGG + Intronic
1077494281 11:2878796-2878818 GTTCAGTGTCCTGCTGGTGTTGG - Intergenic
1077675802 11:4192152-4192174 CTGCAGAGGCTTGGTGGTGTGGG + Intergenic
1080710016 11:34737854-34737876 ATCCAGGGTCCTGGTGGTGTAGG - Intergenic
1081924896 11:46817440-46817462 CTTCTGATTCCCGGTAGTGTAGG - Intronic
1083289855 11:61683748-61683770 CTTCCCAGTCCTGGGGTTTTGGG + Intronic
1095101077 12:38184395-38184417 CTCCCGTGGGCTGGTGGTGTTGG + Intergenic
1096104223 12:48987058-48987080 CTTCGGAGCCCTGGTGGGGTAGG + Intergenic
1102491490 12:113291936-113291958 CTTCCGAGTCCTGGTTCTTGCGG - Exonic
1103587113 12:121964022-121964044 CTTCCTTCTCCTGGTGGTGGTGG - Intronic
1103738053 12:123072951-123072973 CTTCCGAGGCCTGGTGTTTAGGG + Intronic
1104619821 12:130302497-130302519 CTTCCCGGTCCTGGTGGCCTCGG - Intergenic
1104641861 12:130472103-130472125 CAGCCAAGTCCTGGTGATGTCGG + Intronic
1104959471 12:132481524-132481546 CTTCCTGTTCCTGGTGGTGTTGG + Intergenic
1113722006 13:112565249-112565271 CTTGCGAGTTATGGTGTTGTAGG - Intronic
1117321469 14:54628047-54628069 TTTCTGAGTCTTGGTGGTCTCGG + Intronic
1120201268 14:81540545-81540567 CTCCAGGGCCCTGGTGGTGTAGG - Intergenic
1121583154 14:95045570-95045592 ATTCGGAGTCCTGATGATGTGGG + Intergenic
1122953733 14:105060404-105060426 CTTCTGAGCCCCGGGGGTGTGGG + Intronic
1123031622 14:105454496-105454518 CCACCCACTCCTGGTGGTGTTGG + Intronic
1124642899 15:31408324-31408346 CTTCCTGTTCCTGGTGGTATAGG + Intronic
1127248638 15:57206669-57206691 CTTCCGAGTACAGGAGGTGGAGG - Intronic
1129702077 15:77773945-77773967 CTTTGGAGCCCTGGTGGTGTGGG - Intronic
1132493749 16:249696-249718 TTTCAGATTCCTGGTGGTGGCGG + Intronic
1132738661 16:1399771-1399793 CCTCCCAGCCCTGGTGGTCTCGG - Intronic
1136315771 16:29454053-29454075 CTTCCGAGTCCTGGTGGTGTCGG - Exonic
1136430348 16:30193395-30193417 CTTCCGAGTCCTGGTGGTGTCGG - Exonic
1142232014 16:88904459-88904481 CTGCCGAGTCCTGGCCCTGTGGG - Intronic
1147919104 17:43905701-43905723 CTGCTGAGTCCTGGGGGTGGGGG + Intronic
1157132316 18:45018058-45018080 CTTCCCAGTCCTGATAGTCTGGG + Intronic
1158230510 18:55249411-55249433 CTTCAGAGTCCTGCAGGTGGGGG - Intronic
1158641331 18:59206587-59206609 TTCCCGAGTCCTGGTGACGTTGG - Intergenic
1161221188 19:3119023-3119045 CGACCAAGTCCTGGTGGAGTCGG + Exonic
1161819925 19:6523803-6523825 CTTCAGAGTTCTGGCTGTGTGGG - Intergenic
1162470327 19:10869279-10869301 CTTCCGGGTCCTGGAGTTGCTGG - Exonic
1165453955 19:35900235-35900257 CTTCTGGGTCCTGGGGGTGCAGG - Intronic
1166295807 19:41888739-41888761 CTTCTGAGTTCTGGGGGTGCAGG - Exonic
1166299681 19:41906690-41906712 CCTCCAACTCCTGGTGGGGTGGG - Exonic
1167250466 19:48396249-48396271 CTTCAGAGTCCTGGAGGACTGGG + Intronic
934093317 2:88574262-88574284 CTTCAGAGCCCTGGAGGTATTGG + Intronic
939099457 2:137879781-137879803 CTTCCCAGTCGGGGTGGTCTCGG + Intergenic
940770729 2:157836840-157836862 CTTCAGAATGCTGGTGTTGTGGG - Intronic
945207182 2:207344486-207344508 ATCCCGGGTCCTGGTGGTGTAGG - Intergenic
946413633 2:219528199-219528221 TTCCTGGGTCCTGGTGGTGTGGG - Intronic
1171806349 20:29683721-29683743 CTTTCTAGTCCAGGTGTTGTGGG + Intergenic
1172536147 20:35674906-35674928 CTTCCTTGTCCTGGTGCTGCTGG - Intronic
1172690548 20:36786515-36786537 CTTCAGAGTCCAGCTGGGGTGGG - Exonic
1172762385 20:37331831-37331853 CTTCTCATTCCTGGAGGTGTTGG - Intergenic
1173564408 20:44028725-44028747 CCTCCCAGTCCTGGTGCTGTGGG + Intronic
1173903695 20:46610398-46610420 CTTCCAAATCCTGGTGGATTTGG + Intronic
1174721132 20:52813651-52813673 CTTCTGAGCCCTTGTGGTGTAGG - Intergenic
1175754388 20:61520284-61520306 CTGCCCAGTCCTGCTGGTGCTGG + Intronic
1176112538 20:63417143-63417165 GCTCAGAGTCCTGGTGCTGTGGG + Intronic
1176516678 21:7789500-7789522 CTTCAGAGCCCTGGTGGAGTTGG + Intergenic
1178486528 21:33023138-33023160 CCCCCGCGTCCTGGTGCTGTTGG - Intergenic
1178650706 21:34419512-34419534 CTTCAGAGCCCTGGTGGAGTTGG + Exonic
1181314090 22:21960826-21960848 CCTCCGTGTTCTGGTGGAGTGGG - Intronic
1185080470 22:48706996-48707018 CTTCAGAGTCCTTGTGCTGGTGG + Intronic
951595862 3:24317419-24317441 CAAGCGAGTCCTGATGGTGTTGG - Intronic
953049400 3:39327234-39327256 CTTCCGAGTCAGGATGTTGTGGG + Intergenic
953993255 3:47499939-47499961 CTTCCGAGTCCTGGTGGTGTCGG + Intronic
954274184 3:49531833-49531855 CCTGCGAGTCGTGGTGGTGGTGG - Exonic
954368178 3:50156936-50156958 CTTCCTGGTCCTTGAGGTGTTGG + Intronic
954371526 3:50171653-50171675 CTTCCCAGCCCTGGGGGTGGGGG + Intronic
960142244 3:114162406-114162428 CTTCCTGCTCCTGTTGGTGTTGG - Intronic
961307763 3:125970838-125970860 TTTCCGAGCCATGCTGGTGTTGG + Intronic
967887253 3:194341685-194341707 CTTCAGAGACCTGGAGGAGTTGG - Exonic
972801685 4:42482461-42482483 CTCTGGAGTCCTGGTGGTTTTGG - Intronic
977885913 4:102251436-102251458 TTTCCCAGGCCTGGTGGTCTGGG + Intronic
980151708 4:129055913-129055935 ATTCAAAGTCCTGGTGGTGTAGG + Intronic
980944001 4:139301645-139301667 CACCCGAGGCCTGGTGGTGGCGG + Exonic
980999460 4:139814671-139814693 CTACCAAGTCTTGGTGGTGGGGG - Intronic
984053079 4:174891512-174891534 CTTCGGACTCCTGGTGCTCTTGG + Intronic
985761650 5:1752049-1752071 CTTCCCAGTCCTGGTGAGGCGGG + Intergenic
986002609 5:3642161-3642183 GTTCCCAGTACTGGTGGTGAGGG - Intergenic
1000247436 5:159460334-159460356 CCTCCCAGCCCTGGTGGTGAGGG - Intergenic
1003552029 6:7108501-7108523 CATCCGAGTCCCGGCGGTGCTGG - Intronic
1005709465 6:28489815-28489837 CTTCCACGTCCCGGTGGTGGGGG + Intergenic
1006316137 6:33293048-33293070 CATCCGAGTCCAGATGGAGTTGG - Exonic
1013837897 6:114354443-114354465 CTTCAGAATTCTGGTGGGGTGGG + Intergenic
1018019659 6:159748584-159748606 CTTCAGAGGCCTGATGGCGTCGG + Intronic
1022426761 7:30276661-30276683 CTCCTGAGCCCTGGTAGTGTAGG - Intergenic
1022491961 7:30827551-30827573 CTGTAGAATCCTGGTGGTGTTGG + Intronic
1022615585 7:31926822-31926844 ATCCAGGGTCCTGGTGGTGTAGG - Intronic
1025992347 7:66505509-66505531 CGACCAAGTCCTGGTGGAGTCGG - Intergenic
1026956161 7:74377514-74377536 CTTCCTGGCCCTGGTGGAGTGGG - Intronic
1033148745 7:138894434-138894456 CATCCCAGTGCTGGTGGTGATGG - Exonic
1034637331 7:152577556-152577578 CTCCCAAGTCCAGGTGGGGTGGG + Intergenic
1037895593 8:22651641-22651663 CTTCCCAGTACTGCTGCTGTGGG + Intronic
1038522388 8:28244385-28244407 CTGCTGAGTCCTGGGGGTGGGGG - Intergenic
1042067918 8:64899405-64899427 CTTCCCACACCTAGTGGTGTTGG + Intergenic
1042370955 8:67990296-67990318 CTTAAGAGTCCTGGTGTTGCTGG + Intronic
1043479002 8:80633781-80633803 CATCAGAGTCCTGATGGTGTTGG - Exonic
1048874577 8:138827042-138827064 CATCAGAGTCATGGTGGTGGTGG - Intronic
1049773224 8:144393284-144393306 GTTCCGTGTGCTGGTGGTGACGG + Exonic
1057486119 9:95485722-95485744 GTGCCGAGTCCAGGTGTTGTAGG + Exonic
1192934000 X:75839375-75839397 ATTCAGGGCCCTGGTGGTGTAGG + Intergenic
1197819878 X:130531675-130531697 CTGCCTAGTCCTGAGGGTGTCGG - Intergenic
1199781959 X:151069831-151069853 TTTCCGACTCCTTGGGGTGTAGG + Intergenic
1201690043 Y:16753140-16753162 ATTCAGGTTCCTGGTGGTGTAGG + Intergenic
1201762240 Y:17553325-17553347 CTTCAGAGGCCTGGTGTGGTGGG + Intergenic
1201839312 Y:18352663-18352685 CTTCAGAGGCCTGGTGTGGTGGG - Intergenic