ID: 1136430832

View in Genome Browser
Species Human (GRCh38)
Location 16:30195373-30195395
Sequence AGCAAAGCAGGCCCTGCTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 300
Summary {0: 2, 1: 0, 2: 0, 3: 32, 4: 266}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136430824_1136430832 22 Left 1136430824 16:30195328-30195350 CCCATCTCTAAGATGCTGATGCT 0: 2
1: 0
2: 2
3: 7
4: 184
Right 1136430832 16:30195373-30195395 AGCAAAGCAGGCCCTGCTCAGGG 0: 2
1: 0
2: 0
3: 32
4: 266
1136430822_1136430832 28 Left 1136430822 16:30195322-30195344 CCTATCCCCATCTCTAAGATGCT 0: 2
1: 1
2: 0
3: 22
4: 221
Right 1136430832 16:30195373-30195395 AGCAAAGCAGGCCCTGCTCAGGG 0: 2
1: 0
2: 0
3: 32
4: 266
1136430823_1136430832 23 Left 1136430823 16:30195327-30195349 CCCCATCTCTAAGATGCTGATGC 0: 2
1: 1
2: 1
3: 34
4: 368
Right 1136430832 16:30195373-30195395 AGCAAAGCAGGCCCTGCTCAGGG 0: 2
1: 0
2: 0
3: 32
4: 266
1136430821_1136430832 29 Left 1136430821 16:30195321-30195343 CCCTATCCCCATCTCTAAGATGC 0: 2
1: 0
2: 2
3: 39
4: 355
Right 1136430832 16:30195373-30195395 AGCAAAGCAGGCCCTGCTCAGGG 0: 2
1: 0
2: 0
3: 32
4: 266
1136430825_1136430832 21 Left 1136430825 16:30195329-30195351 CCATCTCTAAGATGCTGATGCTA 0: 2
1: 0
2: 3
3: 21
4: 179
Right 1136430832 16:30195373-30195395 AGCAAAGCAGGCCCTGCTCAGGG 0: 2
1: 0
2: 0
3: 32
4: 266

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136430832 Original CRISPR AGCAAAGCAGGCCCTGCTCA GGG Intronic
901393579 1:8964181-8964203 AGGAAAGGAGGCCCTGAGCATGG - Intronic
901981300 1:13036367-13036389 AGAAAAACAGCCCATGCTCACGG + Intronic
902000785 1:13192562-13192584 AGAAAAACAGCCCATGCTCACGG - Intergenic
902300563 1:15499775-15499797 AGAAAAGCAGACTGTGCTCATGG + Intronic
903175061 1:21575767-21575789 AGCCAAGCAGGCCCTGCATGAGG + Exonic
903662185 1:24984914-24984936 ACCAAAGCAGGCCCTGGGCCAGG + Intergenic
904391609 1:30189698-30189720 TGCATGCCAGGCCCTGCTCAGGG - Intergenic
904971104 1:34420079-34420101 ACCACAGCAAGCCCTGCTCCAGG + Intergenic
907158748 1:52356474-52356496 ACCAAGGCAGGTCCTGCTCTGGG - Intronic
907238713 1:53068928-53068950 AGCACATCAGGCCCTGGTGAGGG + Intronic
908039553 1:60094122-60094144 AGCATAGCAGAGACTGCTCAAGG + Intergenic
909057503 1:70839124-70839146 AGGAAAGCAGGCACTGCTTTAGG - Intergenic
910166253 1:84330385-84330407 AGCTAAGCAGGCCATACCCATGG - Intronic
912437067 1:109669188-109669210 AGGAGACCAGGGCCTGCTCATGG - Intronic
912443077 1:109713382-109713404 AGGAGACCAGGGCCTGCTCATGG - Intronic
913032404 1:114922473-114922495 AGCAAAGGAGGCACTTCACATGG + Intronic
914425461 1:147571729-147571751 AGAAAAGCTGGACCTGCTGAGGG + Intronic
915674865 1:157520469-157520491 AGCATAGCAGGCCTTGCTGCGGG - Exonic
915904515 1:159868024-159868046 AGAACAGCAGGCCCAGCCCAAGG + Intronic
916081162 1:161233282-161233304 AGCAAAGCAGGCCCAGCGGCGGG - Exonic
916574647 1:166056686-166056708 AGCAAAGCAGAATCTGGTCAAGG + Intergenic
916768049 1:167880801-167880823 AGCAAAACAAGCCCTTCTCAAGG - Intronic
917193336 1:172442068-172442090 AGCAAAGATGGCCATGTTCAAGG + Exonic
918822028 1:189268326-189268348 ATCAAAGCAAGCCTTGCTTAAGG - Intergenic
918972129 1:191433204-191433226 GGCATAGCAAGCCCTGCCCAAGG + Intergenic
920941714 1:210489576-210489598 ACCAAAAGAGGCCCTGGTCAAGG - Intronic
921236764 1:213139968-213139990 AGAAAAGCATTCCATGCTCATGG - Intronic
922595532 1:226810080-226810102 TGCAACCCAGGCCCAGCTCAGGG + Intergenic
924628889 1:245718515-245718537 GGCCTAGCAGGCCCAGCTCAAGG - Intergenic
1064319104 10:14285471-14285493 AGCAAAACAGCTCCTGCCCATGG + Intronic
1064558530 10:16572420-16572442 AGCAAAGTAGGCCAGGCACAGGG + Intergenic
1067549128 10:47221149-47221171 ATTAGAGCAGGCCCTGCTCTTGG + Intergenic
1067581316 10:47447794-47447816 AGCTGAGGAGGCCCTGCTGAGGG + Intergenic
1067597264 10:47567090-47567112 TGCAAGGCAGCACCTGCTCATGG - Intergenic
1068300565 10:55133196-55133218 AGAAAAGCTGGCTCTGATCAAGG + Intronic
1069032674 10:63614374-63614396 GGCAAAGCAGTTCTTGCTCAGGG + Intronic
1070656772 10:78276982-78277004 ACCCAAGCAAGACCTGCTCATGG - Intergenic
1071184640 10:83027506-83027528 GGAAAAGCATGCCATGCTCATGG + Intergenic
1071302427 10:84266002-84266024 AGCAAACCACACCCTGCTCCTGG + Intergenic
1071410418 10:85386693-85386715 GGAAAAGCATCCCCTGCTCATGG + Intergenic
1073129535 10:101178272-101178294 GACAAGCCAGGCCCTGCTCAAGG - Intergenic
1074254319 10:111785057-111785079 AGCAAAGGAGGCTCTCCACAAGG + Intergenic
1074890948 10:117736213-117736235 TACAAAGCAGGCACTGATCAAGG - Intergenic
1076206493 10:128608669-128608691 AGAGAAGCAGGCCCTCCTCGTGG - Intergenic
1076686289 10:132199860-132199882 AGCAGGCCAGGCCCTTCTCAGGG + Intronic
1077898544 11:6472881-6472903 AGCAAATCATCCCCTGCTTAGGG + Intronic
1078577442 11:12513964-12513986 AGCAAAGCAGGCCCTAAGCTGGG - Intronic
1079428340 11:20364351-20364373 TGGAAAACAGGCCCTGCTCCAGG - Exonic
1079563483 11:21851633-21851655 AGAAAAACAGTCCATGCTCATGG + Intergenic
1080522026 11:33075901-33075923 AGCAAAGATGGCCATGTTCAAGG + Intronic
1081316301 11:41635080-41635102 AGAAAAGCATTCCATGCTCATGG - Intergenic
1081560226 11:44207347-44207369 AACAAAGCAGACCCTGTTGATGG + Intronic
1081726677 11:45334647-45334669 AGCACAGCCGGGCCTGCTCCTGG + Intergenic
1081788779 11:45767938-45767960 AGGAAAGCAGGGCCTGCCTAAGG - Intergenic
1082203678 11:49405132-49405154 AGAAAAGCAGCCACTCCTCATGG - Intergenic
1082255121 11:50025946-50025968 AGAAAAACATGCCATGCTCATGG - Intergenic
1082895032 11:58181005-58181027 AGCAAAGCTGACCCTACTCAAGG + Exonic
1083366058 11:62142083-62142105 AGCCAGGCAGGCCCTGAGCAAGG + Intronic
1083423112 11:62567346-62567368 AGCAAACCAGACCCTGATCCTGG + Intronic
1083628904 11:64085881-64085903 AGGAAAGGGGGCCCTTCTCAGGG + Intronic
1083736784 11:64686022-64686044 AGCAACGCAGGCACTGGTCCTGG + Intronic
1084366958 11:68707994-68708016 GGCACAGCAGGCCCTGCGAAGGG - Exonic
1085287871 11:75375779-75375801 ACCAAGCCAGGTCCTGCTCAGGG - Intergenic
1085792022 11:79504513-79504535 AGAAAAGCAGGCCAGGCTGAGGG - Intergenic
1086297626 11:85388287-85388309 AACAAAGCAAGCCCTGCTTAAGG + Intronic
1086651409 11:89295303-89295325 AGAAAAGCAGCCACTCCTCATGG + Exonic
1088416607 11:109596390-109596412 AGCAAAGCTGGACCTGCAGATGG - Intergenic
1088966762 11:114730527-114730549 AGAAAAACAGTCCATGCTCATGG - Intergenic
1089762614 11:120739356-120739378 AGCAAAGCAGGCAGAGCCCATGG - Intronic
1090606717 11:128429292-128429314 AGAATGGCAGGCCCTGCACAGGG + Intergenic
1090724396 11:129510535-129510557 AGCAAAACATTCCATGCTCATGG - Intergenic
1091306829 11:134541653-134541675 CCCAATGCAGCCCCTGCTCAGGG - Intergenic
1092643245 12:10539838-10539860 AGAAAAGCATCCCATGCTCATGG + Intergenic
1093195840 12:16128868-16128890 AGCAAAGCAGTGCCTGGACATGG + Intergenic
1097600712 12:61689043-61689065 AACAAAACAGTCCATGCTCATGG + Intergenic
1098719711 12:73881399-73881421 AGCAAAGCAGCACCTTCACAAGG + Intergenic
1101544433 12:105698149-105698171 AGCACAGCAAGCCCTACCCAAGG - Intergenic
1101556232 12:105812488-105812510 AGCAAAGCAGGACTTGTTCAAGG + Intergenic
1101677478 12:106931610-106931632 ATCACAGCAGGACCTGGTCAGGG - Intergenic
1106431138 13:29681670-29681692 AGAAAAGCAGGCTCTGCTGAAGG - Intergenic
1107967170 13:45607800-45607822 ACCAAAGCAGCCCTTGCTTACGG + Intronic
1107978706 13:45714117-45714139 GGCGCTGCAGGCCCTGCTCAAGG + Exonic
1110241608 13:73273408-73273430 TGCAAAGCAGGTTCTGGTCATGG + Intergenic
1111255311 13:85660169-85660191 AGCAAAGCAGGGCCAGATGAAGG - Intergenic
1114448231 14:22806467-22806489 CCCAAAGAAGGCGCTGCTCATGG + Intronic
1114609006 14:24024122-24024144 AGAAAAACAGTCCATGCTCATGG + Intergenic
1116187971 14:41623295-41623317 AGCAAAGCAGCCGCTTCACAAGG - Intronic
1116563298 14:46411920-46411942 AGCAAATGAGTCCCAGCTCAAGG - Intergenic
1117715964 14:58581515-58581537 AGCAAAACATTCCATGCTCATGG - Intergenic
1118834483 14:69467206-69467228 AGCAAGGCAGTCACTCCTCAGGG + Intergenic
1118846017 14:69548288-69548310 AGCACAGCTGGACCTGCGCAGGG - Intergenic
1119629563 14:76216061-76216083 GGTAAAGCAGGGCCTGCTCAAGG + Intronic
1120070723 14:80099393-80099415 AGCATGGCAGGCTCAGCTCATGG + Intergenic
1120605438 14:86570556-86570578 GCCAAAGCAAGCCCTGCCCAAGG - Intergenic
1120846916 14:89134227-89134249 AGCAAATCAGGGCTTGCTCCTGG - Intronic
1122642578 14:103168924-103168946 ACTAAAGCAAGCCCTGCTTAAGG + Intergenic
1123203746 14:106692262-106692284 GGAGAAGCAGGCCGTGCTCAGGG - Intergenic
1123448458 15:20345732-20345754 TGCAGGGCAGGCCCTGCCCAAGG - Intergenic
1124050127 15:26189455-26189477 AACAAAGCAGGCACAGCTCTGGG + Intergenic
1124473973 15:30015053-30015075 AGAAAAACATGCCATGCTCAAGG - Intergenic
1125247106 15:37653140-37653162 GCCATAGCAAGCCCTGCTCAAGG + Intergenic
1126270035 15:46805092-46805114 AGAAAAGCATTCCATGCTCATGG + Intergenic
1126303028 15:47221276-47221298 TGCAGAGCAGGCCCTCCCCATGG + Intronic
1126410855 15:48371650-48371672 AGCCAAGCAGGACCTCTTCAGGG - Intergenic
1127694595 15:61433034-61433056 AGCACAGCAAGCCCTACCCAAGG - Intergenic
1128365106 15:66994131-66994153 AGGAAGGCAGGCCCAGTTCAGGG - Intergenic
1132349820 15:101132835-101132857 AGCAGAGCAGGCCTTGCCCCTGG - Intergenic
1133251741 16:4486817-4486839 AGCAAACTAGGCCAAGCTCAAGG + Intronic
1134252316 16:12582983-12583005 AGCAAAGCTGGCCGGGCTGAAGG - Intergenic
1134624360 16:15713459-15713481 CACAGAGCAGGCCTTGCTCAGGG - Intronic
1134812743 16:17181229-17181251 GGCAAAGAAGGCTCAGCTCAAGG + Intronic
1136316255 16:29456031-29456053 AGCAAAGCAGGCCCTGCTCAGGG + Intronic
1136430832 16:30195373-30195395 AGCAAAGCAGGCCCTGCTCAGGG + Intronic
1137066833 16:35855581-35855603 ATGCAAGCAGGGCCTGCTCATGG + Intergenic
1137759089 16:50926135-50926157 AGAAAAACAGGCCCTGATCAAGG - Intergenic
1137817058 16:51408450-51408472 AACAAAACAGCCCCTGATCAAGG + Intergenic
1138614764 16:58156676-58156698 AGGAAAGCAGGCCCCTTTCAGGG - Intergenic
1138772248 16:59679818-59679840 AGGAAAGCAGGTCATGTTCATGG - Intergenic
1140437785 16:74962411-74962433 AGCAAAACATTCCATGCTCATGG - Intronic
1141622294 16:85242696-85242718 AGAAATGCTGGCCCTGCTCCTGG + Intergenic
1142060876 16:88028312-88028334 AGGAGAGCTGGCCCTGCCCACGG - Intronic
1142375777 16:89706480-89706502 GGTAAACCAGCCCCTGCTCAGGG + Intergenic
1143541277 17:7570848-7570870 AAGAAAGCAGGCCCTTCACATGG - Intronic
1144328801 17:14206423-14206445 AGCAAAGAAGCCCCTACACACGG - Intronic
1146762591 17:35491446-35491468 AGCAAAGCAGGGCTTTCCCAAGG - Intronic
1147678004 17:42220506-42220528 AGCACAGCAATCCCTCCTCAGGG + Intronic
1147688046 17:42299066-42299088 AGCACAGCAGTCCCTCCTCAGGG - Intronic
1148749414 17:49935890-49935912 AACCAAGCAGGCCCTGCTTCTGG + Intergenic
1149569638 17:57663257-57663279 AACAAATGAGGCCCTGCTCGCGG - Intronic
1150288245 17:63966150-63966172 AGCCAAGAAGGCCCAGCTGAAGG + Exonic
1151098906 17:71532884-71532906 GGCAAAGAAAGCTCTGCTCATGG + Intergenic
1151434585 17:74087033-74087055 AGCACAGCACGGCCAGCTCATGG + Intergenic
1152340331 17:79720847-79720869 CGCAGGGCAGGCCCTGCCCAAGG + Intergenic
1152360081 17:79828799-79828821 AGCAGAGCAGGCCCTGGTAAAGG + Intergenic
1153097780 18:1427805-1427827 TGCAAAGCTGGCCCTGCACAGGG - Intergenic
1156555403 18:38062483-38062505 TGCATAGAAGGCCCTGCTCATGG - Intergenic
1160157832 18:76446958-76446980 AGCAAAGCTGCCTCTGCCCAGGG + Intronic
1161407589 19:4099137-4099159 GGCACAGCAGGCCCCGCGCAGGG + Intronic
1161580512 19:5078102-5078124 AGCAGAGCAGGCTGTGCTCAGGG + Intronic
1163727193 19:18929426-18929448 AGAAAACCAGCCCCGGCTCAGGG + Exonic
1163904018 19:20135380-20135402 AGAGAAGCAGGCACAGCTCAGGG + Intergenic
1164799227 19:31062308-31062330 ATGAAAGCAGACCATGCTCAAGG + Intergenic
1165004268 19:32791788-32791810 AGGCAAGCAGGCCCTGTTCATGG - Intronic
1165356144 19:35305295-35305317 AAGACAGAAGGCCCTGCTCAAGG - Intronic
1168647819 19:58072225-58072247 AGCCACACAGGCTCTGCTCAGGG + Intronic
925649357 2:6072931-6072953 TGTAAATCAGGCCCTGCTCTTGG - Intergenic
926274136 2:11390818-11390840 AGGAAAGCAGGCCCAGCTGGTGG + Intergenic
927138007 2:20111502-20111524 AGCCTAGCAAGCCCTGCTAAAGG + Intergenic
927558192 2:24050257-24050279 TGGAAAGCAGGACCTGCTCTCGG + Intronic
929557135 2:42932428-42932450 TGCAGGGCAGGCCCAGCTCAGGG - Intergenic
931804387 2:65790167-65790189 AGCAAGGCAGGCCCTGCCAGGGG + Intergenic
934105895 2:88694135-88694157 TGCCAAGCAGGCCCTGCTAGAGG - Intronic
934263565 2:91497626-91497648 TGCAATGCAGGCCCTGCTTTCGG - Intergenic
935174726 2:100639955-100639977 AGCACAGCAGCCCCAGCCCATGG + Intergenic
941855941 2:170231076-170231098 AACACAGCTGACCCTGCTCAAGG + Intronic
941902476 2:170691622-170691644 AGCAAACCAGGACTTTCTCAGGG + Intergenic
941905439 2:170714111-170714133 AGCAAAGCACGCCCCGCGCCTGG + Exonic
944670929 2:201993897-201993919 ACCACTGCAGGCCCTACTCAGGG + Intergenic
945461614 2:210116181-210116203 AGCAGAGCAGTCCCTTCCCATGG - Intronic
946193007 2:218017308-218017330 AGCAGAGCAGGCCCAGCCCCAGG + Intergenic
947294135 2:228612338-228612360 AGGAAAGGAGGCCCTGCCCCCGG + Intergenic
948754114 2:240149329-240149351 AGAAGCTCAGGCCCTGCTCAGGG - Intergenic
1168859557 20:1036356-1036378 AGCAAAGCTCCCCCTGGTCATGG - Intergenic
1169269194 20:4186497-4186519 ACCAAAGCAGGCCTTGCTCGGGG - Intronic
1169762628 20:9112941-9112963 ACAAAAGCAGGCCTTGCTGAAGG + Intronic
1170070843 20:12365014-12365036 AGAAAAGCATTCCATGCTCATGG + Intergenic
1171171090 20:23015865-23015887 AGCAAAGCAGTTCCTGCAAATGG + Intergenic
1172387408 20:34543823-34543845 TGAAACGCCGGCCCTGCTCACGG - Intergenic
1173023728 20:39288731-39288753 AGCAAAGGAGGCCCTGGGTAGGG - Intergenic
1175069898 20:56324482-56324504 TGCCAAGCAGGCCCTGCTCGTGG + Intergenic
1178728635 21:35078693-35078715 AGGAAAGAAGGCCCTGCCCAAGG - Intronic
1180595016 22:16967433-16967455 AGCATCTCAGGCCCTGATCAAGG + Intronic
1182716277 22:32358284-32358306 AGCAAAGCAGATCCTCCCCATGG - Exonic
1182872340 22:33659039-33659061 AGCAAAGCAGGCCCTATGCTTGG - Intronic
1183573663 22:38673078-38673100 AGCAAGGCCGGCCCTACACACGG - Intronic
1183649674 22:39146629-39146651 AGCAAATGAGGCCTTGCCCAGGG - Intronic
1185210704 22:49569124-49569146 AGCACAGAAGGCTGTGCTCACGG - Intronic
949114492 3:303369-303391 AGAAAAGCATTCCATGCTCATGG - Intronic
949940760 3:9152481-9152503 AGCCACGCAGGCCCAGCTGACGG + Intronic
950524533 3:13516337-13516359 AGCACCGCAGGCCCTGTTCCGGG - Intergenic
950679215 3:14573529-14573551 AGCAGAGCATGGCCTCCTCATGG + Intergenic
950758069 3:15194103-15194125 AGAAAAACAGTCCATGCTCATGG + Intergenic
952913804 3:38214946-38214968 AGAAAAGCAAGGCCTGCTCATGG - Intronic
953387806 3:42516503-42516525 AGGAAACCAGGCCCTGCCCTTGG - Intronic
956519582 3:70089001-70089023 AGCAGACCAGGGTCTGCTCAGGG + Intergenic
961737547 3:129011600-129011622 AGAAAAGCAAGCCCTGTCCAGGG + Intronic
962474005 3:135739978-135740000 AGCTAAGCAGGCCAGGCTCTCGG - Intergenic
962528361 3:136255783-136255805 AGCAAAGCAAGGGCTGTTCATGG - Intronic
963521422 3:146363066-146363088 AGAAAAGCAGGACTTGCTAAGGG - Intergenic
964340599 3:155705002-155705024 AACAAAGGAGGCCTTGTTCAGGG - Intronic
964541658 3:157786467-157786489 ATCAAAGCAGGGCTTTCTCAAGG - Intergenic
964686813 3:159404529-159404551 AGCAAAGGAGTCACTCCTCATGG - Intronic
968703685 4:2068717-2068739 GGGGAAGCAGGTCCTGCTCACGG + Exonic
971050407 4:22855496-22855518 GCCACAGCAAGCCCTGCTCAAGG - Intergenic
971249446 4:24961324-24961346 AGAAAAGCATGCTCCGCTCATGG + Intronic
974931890 4:68369345-68369367 TACAAAGCAGGCACTGCCCAAGG + Intergenic
976668016 4:87621127-87621149 AGCACAGCAGTCCCTGGCCAGGG - Intergenic
979723942 4:123937788-123937810 AGCCTAGCAGACCCTGCGCATGG - Intergenic
980240354 4:130165432-130165454 AGCATAGCAGGCTCTGCGCAGGG - Intergenic
981654903 4:147102032-147102054 AGCAAGGCAGGCCCTGGACAAGG + Intergenic
985287729 4:188354172-188354194 ACCCAAGAAGACCCTGCTCATGG - Intergenic
985581626 5:699026-699048 AGAAAAGCATCCCATGCTCATGG + Intergenic
985596249 5:790348-790370 AGAAAAGCACCCCATGCTCATGG + Intergenic
985903973 5:2818807-2818829 AGCAAAGGAGGCACAGCTGATGG - Intergenic
986119328 5:4817117-4817139 AGCAAAGCAGGGTCTGCACTAGG - Intergenic
987270052 5:16298198-16298220 AGAAAAGCATTCCATGCTCATGG + Intergenic
992352403 5:75943749-75943771 AGAAAAGGAGGCCCTGAGCATGG - Intergenic
996197806 5:120631668-120631690 GCCAAAGCAAGCCCTGCCCAAGG + Intronic
997362762 5:133305640-133305662 ACCACAGCAGGCCCTGCCCATGG - Intronic
997879276 5:137574900-137574922 AGGAAAGAAAGCCCTGCTCAAGG - Intronic
998043452 5:138968155-138968177 AGCATAGCAGGCCCTGCCCTGGG + Intronic
998136969 5:139679010-139679032 AGTAGAGCAGGCCCTGCCCCGGG + Intronic
998441924 5:142169813-142169835 AGCAGAGCGGGCCCTTCTCAGGG - Intergenic
998762701 5:145449877-145449899 AGCACGGCAGGCCCTGTTCTAGG - Intergenic
999772309 5:154784939-154784961 AGGAAAACAGGCCAGGCTCAAGG - Intronic
1001741182 5:174054030-174054052 AGTTAACCAGGCCCTTCTCAGGG - Intronic
1002333619 5:178462969-178462991 AGCAAAGCAGAACCAGCTGAAGG + Intronic
1002340722 5:178515211-178515233 AGCAGAGGAGGCCCTGGGCAGGG - Intronic
1004198761 6:13529133-13529155 GGCAATGCAGGGCCTGCTTATGG + Intergenic
1004934071 6:20490636-20490658 AGCAAAGCAGGGCTTTCCCAAGG - Exonic
1005810168 6:29509319-29509341 AGCCAAGCAGGCCCACCCCAGGG + Intergenic
1006054240 6:31369326-31369348 AGCCACACAGGCCTTGCTCATGG + Intergenic
1006436551 6:34028773-34028795 ACCACAGCTGGCCCTTCTCAGGG + Intronic
1007313575 6:40966105-40966127 AGAAAAGCAGGCTCTATTCATGG + Intergenic
1007451062 6:41940813-41940835 AGCCAAGGAGCCCTTGCTCACGG + Intronic
1008315496 6:50034718-50034740 AGAAAAGCATTCCATGCTCATGG + Intergenic
1011531567 6:88327989-88328011 AGTAAAACAGGCCATGCTAATGG - Intergenic
1011955519 6:93020323-93020345 AGAAAAGCATTCCATGCTCAAGG + Intergenic
1014587657 6:123219843-123219865 AGTAAAGCCGGCCCTGCACAAGG + Intronic
1014961320 6:127688940-127688962 AGAAAAGCATCCCATGCTCATGG - Intergenic
1014980225 6:127937393-127937415 GGCAAAGGAAGCCCTGCTTAAGG + Intergenic
1017719518 6:157235174-157235196 ACCAAAGCAGGCCAGGCTGATGG + Intergenic
1018079057 6:160243270-160243292 GGTAAAGCAGGCCCAGGTCAAGG - Intronic
1018981846 6:168607325-168607347 GGCAAAGCAGGCCTTGGTCAAGG + Intronic
1019466665 7:1193459-1193481 CTCAACGCAGGCCCTGCTCCAGG - Intergenic
1019601653 7:1886713-1886735 AGCAGAGCAGGGCCTGCCCAGGG - Intronic
1019647974 7:2141184-2141206 GGCAAGGCTGGCCCTGCTCTAGG - Intronic
1020255092 7:6498366-6498388 AGGGAACCAGGCCCTGTTCAGGG + Intronic
1020436143 7:8164429-8164451 GGCAAAGCAGGCCCTGGTGAGGG + Intronic
1021535143 7:21695108-21695130 AGAAAAGCATTCCATGCTCATGG + Intronic
1021992464 7:26151993-26152015 AGCAAGGATGGCCCAGCTCACGG + Intergenic
1022019346 7:26383469-26383491 AGGTAAGCAAGCCCTGCTCCAGG + Intergenic
1023553153 7:41390267-41390289 AGCAAAGCGGGGGATGCTCAGGG + Intergenic
1023900021 7:44468659-44468681 AACACAGCAGGCCCAGCTCTTGG + Intronic
1028641268 7:93044289-93044311 ATCAAACCAGGCCCTGCTGGAGG + Intergenic
1030403778 7:109085160-109085182 AGCAAAACATTCCATGCTCATGG + Intergenic
1030712441 7:112766095-112766117 ATTAAAGCAGGCACTGATCAGGG - Exonic
1031359664 7:120833793-120833815 AGGAAAGCAGTGCCAGCTCAGGG - Intronic
1032233251 7:130095685-130095707 AGCAAACTAGACCCTGCTAATGG + Intronic
1035018057 7:155783521-155783543 AGCATGCCAGGCACTGCTCAGGG - Intergenic
1036823439 8:11957670-11957692 AGGAAAGCAGCCCCTGCTGTGGG - Intergenic
1039905566 8:41783771-41783793 ACCATACCTGGCCCTGCTCAGGG - Intronic
1040617384 8:49050830-49050852 GGAAAAGCAGTCCATGCTCATGG - Intergenic
1041314133 8:56544130-56544152 AGCAGTGCAGCCCGTGCTCATGG - Intergenic
1041608720 8:59818032-59818054 AGAAAAGCATTCCATGCTCATGG + Intergenic
1042131429 8:65590300-65590322 AACAAAGTAAGCCCTGGTCATGG - Intergenic
1043025334 8:75060307-75060329 AGAAAAGCATTCCATGCTCATGG + Intergenic
1043479886 8:80642086-80642108 AGTACAGCAGTCCCTGCTAAGGG + Intronic
1044185035 8:89240542-89240564 AGCAAAGAAGCACCTGCTCAGGG + Intergenic
1044943602 8:97369253-97369275 GGGAAAGCAAGCCGTGCTCAGGG + Intergenic
1045017871 8:98014442-98014464 AGAAAAGCAAGTCATGCTCAGGG + Intronic
1045322026 8:101089405-101089427 GGCAGAACTGGCCCTGCTCAAGG + Intergenic
1045499245 8:102732266-102732288 AGCAAGGCAGACCCTGCTGAGGG - Intergenic
1049260573 8:141636856-141636878 ACCAATGCAGGGCCTGCTCATGG - Intergenic
1049419293 8:142509954-142509976 AGGAAGGCAGGCCCGGCTCCAGG + Intronic
1049426662 8:142540885-142540907 AGCTCAGCAGGCCATGCTCCCGG - Intronic
1050113697 9:2241965-2241987 AGAAAAGCAGGCGCTGCTCCCGG - Intergenic
1051549139 9:18309698-18309720 AGAAAAGCATTCCATGCTCATGG + Intergenic
1052560755 9:30079762-30079784 TGCAAGCCAGGCCCTGCTCTGGG + Intergenic
1055742790 9:79408085-79408107 AGCAAATCTGGGCCTACTCAGGG + Intergenic
1056330481 9:85517157-85517179 AGCAATGCAGGACATGCTGAGGG - Intergenic
1056797747 9:89670280-89670302 GGCCAAGCAGCCCATGCTCAGGG + Intergenic
1058723977 9:107784588-107784610 AGCAGGGCTGGCCCTGGTCAGGG + Intergenic
1059159677 9:112022148-112022170 AGGAGAGCAGGCCCAGCTGAGGG - Intergenic
1059224301 9:112657715-112657737 GGCAAACCAGCCCTTGCTCATGG - Intronic
1060660931 9:125404949-125404971 AGCAGCGAAGGCCTTGCTCAGGG + Intergenic
1061011124 9:127955238-127955260 AGCAAACCTGGCGATGCTCAGGG - Intronic
1061385638 9:130287849-130287871 AACAAAGCAGGACTGGCTCAAGG - Intronic
1061510547 9:131058435-131058457 AGCAGACCTGGCCTTGCTCAAGG + Intronic
1185534610 X:850875-850897 TGCAATGCAGGCCCTGCTTTTGG + Intergenic
1186257666 X:7740208-7740230 AGAAAAGCAGTAGCTGCTCATGG - Intergenic
1186508954 X:10116204-10116226 AGAGTAGCAGGCACTGCTCAGGG + Intronic
1187900477 X:24023194-24023216 AGCCAAGCCTGCCCTGATCAAGG + Intronic
1188813123 X:34677654-34677676 AGCAAATAATGCTCTGCTCAAGG + Intergenic
1191614631 X:63155876-63155898 AGAAAAGCATTCCATGCTCATGG + Intergenic
1191621665 X:63223050-63223072 AGAAAAGCATTCCATGCTCATGG - Intergenic
1191901292 X:66043096-66043118 ATCCACACAGGCCCTGCTCAAGG + Intergenic
1193028421 X:76871487-76871509 AGAAAAGCATTCCGTGCTCATGG + Intergenic
1193452942 X:81693089-81693111 GGAAAAACAGGCCATGCTCATGG - Intergenic
1194468195 X:94257988-94258010 ACCAAAGCAAGCCCTGCACAAGG + Intergenic
1194489080 X:94525017-94525039 AGCAAGGCAGCCTCTCCTCAGGG - Intergenic
1195082557 X:101385327-101385349 AGAAAAGCAAGCCATGCACATGG + Intronic
1195932118 X:110088789-110088811 ATAAAAGCAGTCCCTGCTCTAGG - Intronic
1196244692 X:113387031-113387053 GGAAAAGCATGCCATGCTCATGG - Intergenic
1197279218 X:124515709-124515731 AGAAAAGCATTCCATGCTCATGG + Intronic
1200691240 Y:6307461-6307483 AGCAAAGCAGGACTTCATCATGG - Intergenic
1201044032 Y:9867255-9867277 AGCAAAGCAGGACTTCATCATGG + Intergenic
1201298718 Y:12487871-12487893 AGAAAAGCAGGTCCTGGTCCAGG + Intergenic
1202053477 Y:20804965-20804987 TGCAAATCAGGCACTGATCAGGG - Intergenic
1202081477 Y:21088543-21088565 TGCAAATCAGGCACTGATCAGGG + Intergenic