ID: 1136431515

View in Genome Browser
Species Human (GRCh38)
Location 16:30199364-30199386
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 3, 1: 1, 2: 0, 3: 16, 4: 143}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136431515_1136431521 22 Left 1136431515 16:30199364-30199386 CCCTGCTCAGCTTGTGGCTCCAA 0: 3
1: 1
2: 0
3: 16
4: 143
Right 1136431521 16:30199409-30199431 GCCATCCCTGCCCTTTCCCATGG 0: 2
1: 0
2: 3
3: 47
4: 385
1136431515_1136431517 -6 Left 1136431515 16:30199364-30199386 CCCTGCTCAGCTTGTGGCTCCAA 0: 3
1: 1
2: 0
3: 16
4: 143
Right 1136431517 16:30199381-30199403 CTCCAACATTCTAGAAGCCGAGG 0: 2
1: 1
2: 0
3: 9
4: 80

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136431515 Original CRISPR TTGGAGCCACAAGCTGAGCA GGG (reversed) Intronic
901634526 1:10664399-10664421 ATGGAGACACCAGCAGAGCAGGG + Intronic
901878755 1:12181721-12181743 ATGGGGGCAGAAGCTGAGCATGG + Intronic
906061805 1:42953758-42953780 TTGAAGTCACAAGCTGATTACGG + Intronic
906799145 1:48721015-48721037 TTAGAGCCCCAGACTGAGCAGGG + Intronic
907846639 1:58214405-58214427 TTGGAGCTAAAAGCTGACAAAGG + Intronic
907856867 1:58312157-58312179 TTAGAGCCACACACCGAGCAGGG - Intronic
908470113 1:64436057-64436079 TTGGAGCCGCAAGCTCAGAGTGG + Intergenic
909801316 1:79811939-79811961 TTAAAGCCACAAGCTCAGCTTGG + Intergenic
910221864 1:84895966-84895988 TTGAAGCCCCAAGGTGAGCTGGG - Intergenic
910641797 1:89472182-89472204 CAGGAGACACAAGCTAAGCAAGG + Intergenic
911644474 1:100323622-100323644 GTGGAGCCAAAGGCTGACCATGG - Intergenic
916717454 1:167457205-167457227 ATGGAGCCACAAGCTGCTCTGGG + Intronic
920919020 1:210282698-210282720 GTGAAGCCACATGCTGAGAATGG + Intergenic
921980071 1:221247305-221247327 TTGGAGACAAATGCTGAACAGGG + Intergenic
924462800 1:244274420-244274442 TTGGAGACAGAAGGTGAGTATGG - Intergenic
1063108350 10:3013305-3013327 TTGGAGCCATGAGGTGACCATGG + Intergenic
1065727467 10:28679508-28679530 TTGGAGCCACATTTTAAGCAAGG - Intronic
1069089659 10:64184496-64184518 GTGAAGCCAGAAGCTGAGAAAGG + Intergenic
1071240414 10:83698886-83698908 TTGGTGCCACAAGCTTCCCAAGG - Intergenic
1077273989 11:1694820-1694842 TCAGAGCCTCACGCTGAGCAGGG - Intergenic
1078264709 11:9746165-9746187 GTGGAGGCACAAGCTGGGCTTGG - Intronic
1080654484 11:34248009-34248031 GTGGATCCATAAGCTGAGCAAGG - Intronic
1082093420 11:48107790-48107812 TTGGAGAAAAAAGCTGGGCATGG + Intronic
1083237971 11:61364226-61364248 TTGGAGCAAAAAGATAAGCAAGG - Intronic
1083263221 11:61534213-61534235 TGGGAGCCACACGCTGAGGGTGG + Intronic
1083488963 11:63000877-63000899 ATGAGGCCACAGGCTGAGCATGG - Intronic
1084001661 11:66298579-66298601 TTGTAGCCACAGGCTGGGCGCGG + Intergenic
1085531719 11:77195649-77195671 TTGGAGCCCACAGCTGAGCTGGG + Intronic
1087353219 11:97060111-97060133 TTGCAGTCACAAACTGAGCAAGG + Intergenic
1087528478 11:99349208-99349230 TTACAGTCACAAGCTGAACAAGG + Intronic
1092148431 12:6230716-6230738 TTGAGGCCACAAGCTGGGCTTGG - Intronic
1093828080 12:23719687-23719709 TTGCAGCCTCAAACTGGGCAGGG - Intronic
1094512862 12:31106589-31106611 TGGGAGCCAGAAGGTGACCAGGG - Intergenic
1094716753 12:33021534-33021556 TTCTAGCCACATACTGAGCAAGG - Intergenic
1095691118 12:45089914-45089936 TGGGACCCACATGCTGTGCATGG + Intergenic
1096521426 12:52186851-52186873 GGGGAGCCCCAAGCTGAGCTGGG - Intronic
1097937085 12:65264813-65264835 TTGAAACCACAATCTGAACAAGG - Intergenic
1104149675 12:126070635-126070657 TTGGGGACACAAGCTGAGTTTGG + Intergenic
1104973912 12:132543625-132543647 TTAGAGCCACAAGCTGGGTAGGG - Intronic
1108375140 13:49807286-49807308 TTAGAGCCAGAATCTGAGCTTGG + Intergenic
1109592596 13:64505814-64505836 ATGTAGCCACTAGCTGGGCAAGG + Intergenic
1110075817 13:71241070-71241092 TTTGAGACATAGGCTGAGCATGG + Intergenic
1113471385 13:110549208-110549230 TTGGAGCTACAAGCTTAGCTTGG + Intronic
1113728408 13:112622730-112622752 AAGGAGCCACAAGCTGGGCCAGG + Intergenic
1119347815 14:73940879-73940901 TTGGGGCCAGAATCAGAGCATGG + Intronic
1123798419 15:23797228-23797250 TTGGATCCAGAAGCCAAGCAAGG - Intergenic
1124255020 15:28133387-28133409 TTGAAACCACAAGCTGGGAAAGG - Intronic
1125713422 15:41805205-41805227 TAGGAGCTCCAGGCTGAGCATGG + Intronic
1126749149 15:51858879-51858901 TTCGTGCATCAAGCTGAGCATGG + Intronic
1128393417 15:67198736-67198758 TTGGTGCCAGAATCTGAGCTAGG - Intergenic
1129702013 15:77773634-77773656 CTGGAGACAGAAGCTGACCAAGG + Intronic
1130943075 15:88527623-88527645 TTGTTGCTAGAAGCTGAGCAGGG + Exonic
1132250719 15:100333668-100333690 GTGGCCCCAAAAGCTGAGCAGGG + Intronic
1132332945 15:101025197-101025219 TTGGATCCAAAAGCAGAGCAGGG + Intronic
1134613072 16:15626443-15626465 ATAGAGCCAGAAGGTGAGCAGGG + Intronic
1136187529 16:28596938-28596960 TTGGAGCCACAAGCTGAGCAGGG + Intronic
1136190002 16:28609872-28609894 TTAGAGCCACAAGCTGAGCAGGG + Intronic
1136316940 16:29460022-29460044 TTGGAGCCACAAGCTGAGCAGGG - Intronic
1136318926 16:29469938-29469960 TTGGCTCCAAAAGCTGAGCAGGG - Intergenic
1136431515 16:30199364-30199386 TTGGAGCCACAAGCTGAGCAGGG - Intronic
1136433497 16:30209282-30209304 TTGGCTCCAAAAGCTGAGCAGGG - Intergenic
1137597401 16:49734060-49734082 TTGGAGCCCCAAGCTCTCCAAGG + Intronic
1139594902 16:67951772-67951794 TTGAGCCCACAGGCTGAGCAGGG - Intronic
1141155214 16:81592585-81592607 TGGGAGCCCCAGGATGAGCAGGG - Intronic
1142053060 16:87972999-87973021 TGGAAGCCACAAGGTCAGCATGG - Intronic
1142279404 16:89139953-89139975 GAGGAGCCACCAGCTGAGGACGG + Intronic
1142284821 16:89167416-89167438 TTGGAGCCCCAACCCGGGCAGGG - Intergenic
1142636668 17:1261872-1261894 TGGGGGCCACAAGCTGAAGACGG - Intergenic
1145037667 17:19552652-19552674 TAGGAGCCACGAGCTGAGAGGGG + Intronic
1147402572 17:40189798-40189820 TGGGAGGCACTAGCTGGGCATGG + Intronic
1147479945 17:40751023-40751045 TCGGAGCCACAACCTCAGCCCGG - Exonic
1148750043 17:49940409-49940431 TCAGAGCCACCAGCTGAGCCTGG - Intergenic
1150048729 17:61938152-61938174 TTGAAGACCCAAGCTGAGCTGGG + Intergenic
1151188623 17:72381821-72381843 TGCAAGCCACCAGCTGAGCAAGG + Intergenic
1151759655 17:76093369-76093391 TTGGAGAAACAGGCAGAGCAGGG - Intronic
1155221335 18:23689054-23689076 CTGCAGCCACAGGCTGAGCCAGG - Intergenic
1156098696 18:33566758-33566780 GTGGAGCCACAAGCTGAGAGAGG - Intergenic
1156536712 18:37871401-37871423 TTGGACTCACAAGCAGAGAAGGG - Intergenic
1156635858 18:39028827-39028849 ATGGAGCTTTAAGCTGAGCATGG - Intergenic
1157201384 18:45662807-45662829 CTGGAGCTCCAAGCAGAGCAAGG + Intronic
1157611571 18:48959945-48959967 TTGGAGCCTCACGCTGAGTCTGG - Intergenic
1160727824 19:625334-625356 CTGTAGCCACCAGCTCAGCAGGG + Intronic
1165144619 19:33723525-33723547 TTCTAGGCACCAGCTGAGCAGGG - Intronic
926928326 2:18010846-18010868 TTGGTGCTACAAGCTGAAAATGG + Intronic
937885690 2:126898685-126898707 TTGGAGTCACATGCTCAGCAGGG - Intergenic
940694061 2:156956827-156956849 ATGAATCCACCAGCTGAGCATGG - Intergenic
942726983 2:179020511-179020533 TTCCTGGCACAAGCTGAGCATGG - Intronic
942765699 2:179453800-179453822 TTAGTGGCACAAGCTGAGGAAGG + Intronic
943841971 2:192594910-192594932 GAGGAGCCCCAAGCTTAGCAAGG - Intergenic
944343737 2:198635552-198635574 TTGGACCCACCAGCTGAGTTTGG + Intergenic
947583161 2:231334382-231334404 TTGCAGCCACAAGCCAAGCATGG - Intronic
1172680118 20:36707388-36707410 TTGGAGACCAAAGCTGAGAAAGG + Intronic
1173302268 20:41814720-41814742 TGGGAGCAGCAAGCTGAGCTGGG - Intergenic
1173500100 20:43546991-43547013 TTTGAGCCAGAATCTGAACAAGG + Intronic
1174388285 20:50199943-50199965 TGGAAGCCACATGCTGAGGATGG + Intergenic
1176059348 20:63165514-63165536 TGGGGGCCACAAGCTGAGTGTGG - Intergenic
1179256898 21:39724769-39724791 CTGCAGCCACCAGCTGGGCAGGG + Intergenic
1179461648 21:41539498-41539520 TTGCAGCCACCAGCTGAAGAAGG + Intergenic
1180149307 21:45939661-45939683 TGGCAGCCAGCAGCTGAGCAGGG - Intronic
1182780767 22:32865754-32865776 TTGGAGCAACAAGCTGAATATGG + Intronic
1183641483 22:39095501-39095523 ATGGAGGGACAAGCTGGGCAAGG + Intergenic
1184232573 22:43166573-43166595 CTGGAGCCACAGGCTCAGCCTGG - Intergenic
1184466062 22:44669314-44669336 TGGGGGCCACAGGCTGAGCCAGG - Intronic
1185358017 22:50386629-50386651 TGGAAGCCACAAGCTGAGGAAGG - Intronic
949118266 3:355434-355456 TTGGAGCTCTATGCTGAGCATGG - Intronic
950008650 3:9706772-9706794 TTGGAGCAACAACCTGAGGGAGG + Intronic
952380937 3:32804712-32804734 ATAGAACCACAAGCTGGGCATGG + Intergenic
953352894 3:42229526-42229548 TTGGAGCCCCAAACTCATCAGGG - Intergenic
955788228 3:62562170-62562192 ATTGAGCCAAAATCTGAGCATGG + Intronic
960291968 3:115896932-115896954 TTGGAAACACATTCTGAGCAAGG + Intronic
961450988 3:127002215-127002237 GTGGAGCCCAAAGCTGGGCAGGG - Intronic
963383363 3:144559242-144559264 TTGTAGCCACAGGCATAGCAAGG - Intergenic
964543969 3:157812263-157812285 ACTGAGCCATAAGCTGAGCATGG + Intergenic
967979086 3:195054684-195054706 TGGGAGGCACAAGCTGGGAAGGG - Intergenic
968431213 4:560217-560239 GTGGAGCCACTAGCAGAGAAGGG + Intergenic
968624200 4:1619203-1619225 TTGCAGCCACAGGCTGAGGCAGG + Intronic
968938201 4:3624524-3624546 TGGGAGGGAGAAGCTGAGCATGG + Intergenic
969604530 4:8195913-8195935 TTGGGGCCATCATCTGAGCAGGG + Intronic
972926347 4:44013827-44013849 ATGGGGCCACAAACTGAGGATGG + Intergenic
973553637 4:52060036-52060058 GTGGAGCCACAAGATTTGCAAGG - Intronic
973576860 4:52298313-52298335 CTGTAGCCATAAGCAGAGCAGGG + Intergenic
973981776 4:56314037-56314059 TAGGATCCACAACATGAGCAAGG + Exonic
982408668 4:155047812-155047834 TAGGAGCCACAGTCTGAGAATGG + Intergenic
985981982 5:3477661-3477683 TTGGAAACAGAAGCTGAGAAAGG + Intergenic
986168857 5:5299301-5299323 TGAAAGCCACAAGCAGAGCATGG + Intronic
986548766 5:8929153-8929175 TTGGAGCCAAAAACCAAGCAAGG + Intergenic
990013415 5:51027582-51027604 CTGAAGCCAGAAGCTGACCATGG + Intergenic
992475905 5:77101337-77101359 TTGGAGGCACAAGCAGATCTAGG + Intergenic
995017481 5:107327376-107327398 TTGGAGCTGCAGGCTGAGAAGGG + Intergenic
995240529 5:109881200-109881222 TAGGAGCCACAGGCTGAGTCTGG - Intergenic
996287796 5:121815361-121815383 TAGGAGCCACCAGCTGGGCCAGG - Intergenic
1002879688 6:1239985-1240007 TTGGAGCCAGAGACTGCGCAGGG - Intergenic
1013356695 6:109351479-109351501 TGGAAGCCACAAGTTGAGAATGG - Intergenic
1013416191 6:109926784-109926806 TTGGAGCAACAGGATGAGCCTGG + Intergenic
1013438951 6:110141621-110141643 TTGGAGATACAAGTTGAGTAAGG - Intronic
1016863234 6:148742881-148742903 TGGAAGCCACATGCTGAGGATGG + Intergenic
1019079727 6:169422136-169422158 TGGGAGGCACATGCTCAGCATGG - Intergenic
1020562739 7:9750827-9750849 TTGGAGTCAGATGCTGAGAATGG - Intergenic
1023531956 7:41167040-41167062 ATGGAGCCCCAATCTCAGCAGGG - Intergenic
1029203246 7:98853183-98853205 TTGGAGGCAGGAGCTTAGCATGG - Intronic
1033413430 7:141141193-141141215 TTGGAGCAACAAAATAAGCAAGG - Intronic
1042297874 8:67242268-67242290 TTGGAGCTACAAGCTATGCTTGG - Intronic
1042712187 8:71730507-71730529 TTGGGGCAACAAGCTGAGATTGG - Intergenic
1044186088 8:89253867-89253889 ATGGAGCCACAAGCTGATCCTGG - Intergenic
1044320295 8:90793331-90793353 TTGGAGCCACCAGGTGATAAAGG - Intronic
1047601548 8:126430571-126430593 TTGGAGACACAGTCTGATCAAGG - Intergenic
1048547751 8:135403512-135403534 GTGGTAGCACAAGCTGAGCAGGG - Intergenic
1048865992 8:138762284-138762306 CTGCAGCCTCCAGCTGAGCAAGG + Intronic
1048926946 8:139279976-139279998 TGGGAGCTACAAGAGGAGCAGGG - Intergenic
1054452991 9:65413235-65413257 TGGGAGGGAGAAGCTGAGCATGG - Intergenic
1056319505 9:85423105-85423127 TAGGACCCACAAGCTGAGAATGG - Intergenic
1057521343 9:95762889-95762911 TTGGACTCACTAGCTGATCAGGG + Intergenic
1058637399 9:107049779-107049801 TTGGATCCACAGGCTGAGGAGGG + Intergenic
1060247172 9:121956874-121956896 TTGGAGCCTGCAGCTGAGTAAGG - Intronic
1060813264 9:126622066-126622088 TTGGGGCCCCAAGGTCAGCAGGG - Intronic
1061402632 9:130376673-130376695 TGAGAGCCAGAAGCTGCGCAGGG - Intronic
1185709547 X:2292205-2292227 TTGGGGCCAGAACCTGGGCATGG + Intronic
1186384324 X:9093804-9093826 TTGGAGGCACCTGCTGGGCAAGG - Intronic
1188364429 X:29297377-29297399 TGGAAGCCACATGCTGAGAATGG - Intronic
1188592743 X:31859076-31859098 TCAGAGCCACAAGGTCAGCAGGG + Intronic
1192150100 X:68706757-68706779 TTGGGGCCACATGCTGAGGATGG + Intronic
1201855109 Y:18532777-18532799 TAGGAGCCACAAGCTGGGTGTGG - Intergenic
1201878212 Y:18787607-18787629 TAGGAGCCACAAGCTGGGTGTGG + Intronic