ID: 1136433054

View in Genome Browser
Species Human (GRCh38)
Location 16:30206729-30206751
Sequence CAGAGCTGCAATTTTAAATT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 493
Summary {0: 2, 1: 2, 2: 3, 3: 52, 4: 434}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136433054_1136433061 20 Left 1136433054 16:30206729-30206751 CCCAATTTAAAATTGCAGCTCTG 0: 2
1: 2
2: 3
3: 52
4: 434
Right 1136433061 16:30206772-30206794 TATGCCTGTAGTCCCAGCTACGG 0: 4
1: 44
2: 235
3: 584
4: 1104
1136433054_1136433059 -5 Left 1136433054 16:30206729-30206751 CCCAATTTAAAATTGCAGCTCTG 0: 2
1: 2
2: 3
3: 52
4: 434
Right 1136433059 16:30206747-30206769 CTCTGAGAAGCCGGGCATGGTGG 0: 4
1: 1
2: 13
3: 144
4: 1048
1136433054_1136433058 -8 Left 1136433054 16:30206729-30206751 CCCAATTTAAAATTGCAGCTCTG 0: 2
1: 2
2: 3
3: 52
4: 434
Right 1136433058 16:30206744-30206766 CAGCTCTGAGAAGCCGGGCATGG 0: 4
1: 0
2: 1
3: 46
4: 326
1136433054_1136433062 21 Left 1136433054 16:30206729-30206751 CCCAATTTAAAATTGCAGCTCTG 0: 2
1: 2
2: 3
3: 52
4: 434
Right 1136433062 16:30206773-30206795 ATGCCTGTAGTCCCAGCTACGGG 0: 514
1: 3512
2: 7344
3: 8068
4: 8166
1136433054_1136433063 22 Left 1136433054 16:30206729-30206751 CCCAATTTAAAATTGCAGCTCTG 0: 2
1: 2
2: 3
3: 52
4: 434
Right 1136433063 16:30206774-30206796 TGCCTGTAGTCCCAGCTACGGGG 0: 245
1: 34361
2: 136486
3: 148407
4: 127177
1136433054_1136433064 23 Left 1136433054 16:30206729-30206751 CCCAATTTAAAATTGCAGCTCTG 0: 2
1: 2
2: 3
3: 52
4: 434
Right 1136433064 16:30206775-30206797 GCCTGTAGTCCCAGCTACGGGGG 0: 26
1: 4167
2: 117994
3: 255556
4: 240736
1136433054_1136433066 26 Left 1136433054 16:30206729-30206751 CCCAATTTAAAATTGCAGCTCTG 0: 2
1: 2
2: 3
3: 52
4: 434
Right 1136433066 16:30206778-30206800 TGTAGTCCCAGCTACGGGGGAGG 0: 28
1: 4950
2: 113550
3: 241681
4: 245706

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136433054 Original CRISPR CAGAGCTGCAATTTTAAATT GGG (reversed) Exonic
901622223 1:10597756-10597778 AACAGCTGCAGTTTTAAATGGGG + Intronic
902774118 1:18663681-18663703 CTGAGCTGGAATTTGAATTTGGG + Intronic
903007129 1:20306171-20306193 GAGGGGTGCAATTTTAAAGTAGG + Intronic
903728363 1:25470042-25470064 CAAATGTGTAATTTTAAATTGGG - Intronic
904112972 1:28141158-28141180 CCTACCTGCAATTTTAAAGTTGG + Intergenic
904132305 1:28283973-28283995 CAAAGCTGGAATTTGAATTTGGG - Intergenic
904132433 1:28284873-28284895 CAAAGCTGGAATTTGAATTTGGG + Intergenic
904405058 1:30283016-30283038 CAGATCTTCAATTTGAAAATAGG + Intergenic
904957529 1:34297466-34297488 CGGTGCTGGAATTTTAATTTTGG - Intergenic
906116719 1:43361867-43361889 CAGAGCCAGAATTTTAACTTGGG - Intronic
906553833 1:46690862-46690884 CAGAATTTCAAGTTTAAATTGGG - Intronic
906792957 1:48674577-48674599 CAGAGCTAGAATTCTAAATCAGG - Intronic
907256516 1:53183246-53183268 CAGGGTTGCAATTTTAGATAAGG + Intergenic
907644289 1:56226209-56226231 CAGACCTACAATTTGAACTTTGG - Intergenic
907826604 1:58023213-58023235 TAGAGCTGTTATTTTATATTTGG - Intronic
908152970 1:61323616-61323638 CAGACCAGAAATTTAAAATTTGG + Intronic
908158038 1:61376669-61376691 TATAGCTGAAGTTTTAAATTTGG - Intronic
908437056 1:64117384-64117406 CATTGCTTCAATTTTCAATTTGG + Intronic
908684462 1:66699871-66699893 GAGGGTTGCAGTTTTAAATTGGG + Intronic
908855506 1:68422512-68422534 CAGAGCTGCAGATATAAATTTGG - Intergenic
909288877 1:73857036-73857058 CAGAGCTGCATTGTTCAATAGGG - Intergenic
909787332 1:79631057-79631079 CAGACTTACAATATTAAATTAGG + Intergenic
911040581 1:93588117-93588139 TAGAGCTGAAAACTTAAATTAGG - Intronic
911441298 1:97929049-97929071 GTGAGCTGCAATTTTAAATATGG - Intergenic
911659005 1:100478665-100478687 CAGAGCTTCCATTTTGAATGAGG + Intronic
911709165 1:101049619-101049641 CAGAGCTTAAATTTTGAAATCGG - Intergenic
911889430 1:103348477-103348499 CATGGCTGCAATTTTAGATAGGG + Intergenic
912158411 1:106950800-106950822 CAGAGTTACAATTTTAAGCTTGG - Intergenic
915603642 1:156937753-156937775 CAGAGCTGCAGTGTTTCATTTGG + Intronic
917258840 1:173145794-173145816 CAGAGTTGCAATCTTCATTTCGG - Intergenic
917700565 1:177576377-177576399 TAGATTTGCAATTTTAAATAGGG - Intergenic
918095242 1:181328929-181328951 CTGAGCTGGAAGTATAAATTTGG - Intergenic
919108055 1:193179197-193179219 CAAACCTGCAGTTTTTAATTTGG - Exonic
920153562 1:203929558-203929580 CAGGGGTGCAATTTTAGATAGGG + Intergenic
921551865 1:216546780-216546802 CAGAGGTGAAATTTAAATTTAGG - Intronic
922404672 1:225299509-225299531 CAGAGCTGGATATTTAAGTTTGG - Intronic
923559824 1:235030605-235030627 CAGAGCTGGAATTTTAGAGTAGG - Intergenic
923835828 1:237609712-237609734 AAGGGCAGCAATTTTAAATGGGG - Intronic
1063194658 10:3730147-3730169 CAGGGCTGCGATTTTAAGTAGGG + Intergenic
1063784807 10:9369277-9369299 CAGAACAAAAATTTTAAATTTGG + Intergenic
1063943621 10:11156429-11156451 GAGGGCTGCAATATTAAATAAGG - Intronic
1065105938 10:22384727-22384749 CAGAGTAGCAATGTTAAATGTGG - Intronic
1065128555 10:22597778-22597800 CAGATTTGCCCTTTTAAATTAGG - Intronic
1065256192 10:23870971-23870993 AAGAGCTGGAATTTGAACTTAGG + Intronic
1067144817 10:43687460-43687482 GAGAGCTGCAGTCTTAAATAAGG + Intergenic
1068388372 10:56360636-56360658 AAGAGCTGAAATTTTAAATAGGG + Intronic
1068586276 10:58802832-58802854 TAGAGATGGAATTTGAAATTGGG - Intronic
1068784187 10:60952168-60952190 CAAAGCTGGAATTTTAAAGCTGG + Intronic
1069846837 10:71377931-71377953 CAGAGCTGGAATTTGAACTTGGG + Intergenic
1070249795 10:74764018-74764040 AGCAGCTGCAATTTTAAATCTGG + Intergenic
1070384761 10:75914333-75914355 CACAGGTTCATTTTTAAATTTGG - Intronic
1070797578 10:79225785-79225807 CAGAGCTGCACTTCTTAACTAGG - Intronic
1071733692 10:88274220-88274242 CAGAACTGCACATTTAAATGTGG - Intronic
1071777929 10:88809955-88809977 AAGAGCTGCAACTTTGAATAGGG - Intronic
1072038997 10:91590122-91590144 CAGAGATGGAATTCTAACTTGGG + Intergenic
1073035876 10:100563885-100563907 TAGAGCTGCATCTTTAAATGGGG + Intergenic
1073362531 10:102911497-102911519 CAGAGCTGCAATATGGAATCAGG - Intergenic
1073552689 10:104417891-104417913 CAGAGCTGCAATGATAAACCAGG + Intronic
1073909217 10:108321529-108321551 GAAAGTTGCATTTTTAAATTTGG - Intergenic
1074662124 10:115672309-115672331 CAGAGCTGGAATTTCAATTGAGG + Intronic
1075425445 10:122338513-122338535 CAGAGCTTCAGTTTTAAAGGTGG - Intergenic
1077728085 11:4697164-4697186 CAGAGCTGAATTTTTAACTCAGG + Intronic
1079387959 11:19997674-19997696 CAGAGCTTGAATTCTAACTTAGG + Intronic
1079509769 11:21197283-21197305 CAGAGCTGAGATTTTAACTCAGG + Intronic
1079671382 11:23175565-23175587 GAAGGTTGCAATTTTAAATTGGG + Intergenic
1079747648 11:24153508-24153530 TAGAGCAGCAATTTTCAATCAGG - Intergenic
1079825211 11:25182182-25182204 CAGGGCTGCAATTTCATAGTAGG + Intergenic
1080162927 11:29200807-29200829 CAGAGGTGCTATTTTACACTTGG + Intergenic
1080713769 11:34777054-34777076 CATAGGTCCATTTTTAAATTGGG + Intergenic
1080764441 11:35282318-35282340 CAGAGCTGGAATTTGAACTCAGG - Intronic
1080993912 11:37577815-37577837 CAGCTCTGCAATTTTGAATTTGG + Intergenic
1081092595 11:38890979-38891001 CAGAGCTGGGATTTGAACTTAGG + Intergenic
1083184687 11:61010533-61010555 CAGAGCTGGAATTTGTAATCTGG - Intronic
1083426430 11:62589841-62589863 CAGAGCTGGGATTTGAACTTGGG - Intronic
1083710020 11:64542434-64542456 CAGTGATGCCATTTTAAATTCGG - Intergenic
1084561505 11:69908072-69908094 CAGAGCTTCAACTTTAGGTTGGG + Intergenic
1084685128 11:70688894-70688916 CAGCACTTCAATTTTCAATTTGG + Intronic
1085426732 11:76411403-76411425 CTGAGCTAGAAGTTTAAATTGGG - Intronic
1085882180 11:80480551-80480573 TGGAGCTGCAATTTTAACTCAGG - Intergenic
1086211934 11:84331367-84331389 CAAAGCTGCAATTCAAATTTAGG + Intronic
1086222909 11:84471310-84471332 CAGAGCAGCAATTACAAATAAGG - Intronic
1086222948 11:84471590-84471612 CGTAGCAGCAATTTTAAATGAGG + Intronic
1086553591 11:88083189-88083211 GAGGGGTGCAATTTTAAATAGGG - Intergenic
1086859840 11:91912732-91912754 CAGAGATGAAATTTCACATTGGG + Intergenic
1087434996 11:98104192-98104214 CAGATCTGAAATTTTACTTTGGG - Intergenic
1087751430 11:102011495-102011517 CAGAGTTGGCATTTTAAATTTGG - Intergenic
1088560676 11:111112738-111112760 CAGAGCTGGGATTTTAAACCAGG + Intergenic
1088803939 11:113333520-113333542 AAGAGCTGGAATTTGAAATCTGG - Intronic
1089598835 11:119600669-119600691 CATAATTGCAATTGTAAATTGGG + Intergenic
1089611136 11:119669853-119669875 ATGAGCTGCAGTTTTAAATAGGG - Intronic
1089840154 11:121410138-121410160 CAGATCTGAAATTTTGATTTTGG + Intergenic
1090064760 11:123493157-123493179 CAGAGCTGGAATTTAAACTAAGG - Intergenic
1090521904 11:127488744-127488766 GGGAGCTACAATTTGAAATTTGG + Intergenic
1093160452 12:15740708-15740730 CAGAGCTGAAATTTAAACTTGGG - Intronic
1093390418 12:18612321-18612343 CAGTGTTGTAGTTTTAAATTTGG - Intronic
1093865393 12:24221057-24221079 CAGAGCTGAGATTTTAACTCAGG + Intergenic
1094292509 12:28867913-28867935 CAGAGCTGGGATTTGAATTTGGG + Intergenic
1094706431 12:32918864-32918886 CCCGGCTTCAATTTTAAATTGGG - Intergenic
1095201904 12:39394764-39394786 CAGAGCTGTAACTATATATTAGG - Intronic
1096705973 12:53422435-53422457 CAGAGCTGGAATTTGAACTTAGG - Intergenic
1096911159 12:54985322-54985344 CAAAGCTGAACTTTTAAAATCGG + Intergenic
1097034108 12:56111194-56111216 CAGAACTGTAAATTTAAACTGGG - Exonic
1098584438 12:72139241-72139263 CAGTTCTGCCATTTAAAATTTGG - Intronic
1099418970 12:82428698-82428720 CAGAGCTGGAATTTAAACTCAGG - Intronic
1099706879 12:86165975-86165997 CACTGCTTAAATTTTAAATTTGG - Intronic
1099915497 12:88887508-88887530 CAGAGCTGGAATTTTCACTTAGG + Intergenic
1099936136 12:89128181-89128203 CTGAGCTGGAGTTATAAATTTGG - Intergenic
1100642013 12:96491136-96491158 GAGTGTTGCAATTTTAAATGGGG + Intronic
1101733992 12:107449133-107449155 CAGTGCTGCAATTTTACAAGTGG - Intronic
1101820405 12:108179726-108179748 CAGAGCTGGAATTTCAACCTAGG - Intronic
1101995641 12:109523321-109523343 CAGAGCTGCACTTTTATGTGGGG - Intronic
1102789930 12:115636340-115636362 CAGTGTTGCATGTTTAAATTGGG - Intergenic
1103138823 12:118530904-118530926 CAGAGTTGGAAAGTTAAATTTGG - Intergenic
1103599447 12:122044950-122044972 GAGAGTTGCAGTTTTAAATGGGG + Intronic
1104104892 12:125649983-125650005 CAGAGCAGTGATTTTAGATTAGG + Intronic
1104737588 12:131146731-131146753 CAGAGCTGCTTTTTTAAACAGGG + Intergenic
1106802743 13:33272870-33272892 CAGAAATGCAATTATCAATTGGG + Intronic
1107593482 13:41935208-41935230 CTGAGCTGCAAGTTGAACTTTGG - Intronic
1107802542 13:44122612-44122634 CAGAGCTGGTATTTAAAATCTGG + Intergenic
1107892599 13:44927371-44927393 CAGAGCTCCATTTTTACATGTGG + Intergenic
1112208924 13:97353906-97353928 CAGAGCTACCACTTTAAAGTAGG - Intronic
1112421289 13:99251724-99251746 CAGAGCTGGAATCTCAAATCTGG - Intronic
1112571791 13:100599964-100599986 CATAGATGTAATTTTAAATTTGG + Intergenic
1112662052 13:101521429-101521451 ATGAGAAGCAATTTTAAATTGGG + Intronic
1112693487 13:101920543-101920565 CATAGCTGTCATTTTCAATTAGG - Intronic
1113002131 13:105652809-105652831 AATAGCTGCAATTACAAATTAGG + Intergenic
1113317007 13:109191505-109191527 CTGAGTTGCAATTGTAAATCAGG + Intronic
1113932936 13:113977873-113977895 CTGAGCTGCAATTTTTAACATGG - Exonic
1114733145 14:25015947-25015969 CAGATCAGCAATTTTAACCTTGG - Intronic
1114777895 14:25505853-25505875 CAAAGCTGGAATTTGAATTTAGG + Intergenic
1115045703 14:28990468-28990490 CAGAGTTGAAATTTAAATTTAGG - Intergenic
1115305322 14:31927877-31927899 CACAGCTGCAGTTTTAAATTAGG - Intergenic
1115346814 14:32351948-32351970 CAGAGCTGTGATTTGAACTTGGG + Intronic
1115411687 14:33082699-33082721 CAGAGCTGAGATTCTAAACTTGG - Intronic
1117593218 14:57298384-57298406 CAGAGCTGGGATTTGAAATCAGG - Exonic
1117869482 14:60185454-60185476 CAGAGCTGCAATTTGAATGCAGG - Intergenic
1118099549 14:62581192-62581214 CAGAGATCCAACTTTAAAGTGGG - Intergenic
1118365474 14:65091737-65091759 AAGAGTTGCAATTTTAATTATGG - Intronic
1118659813 14:67996075-67996097 GAGAGTTGCAATTTTAAAAATGG + Intronic
1119220613 14:72903822-72903844 AAGAGATTCAATTTTCAATTTGG + Intergenic
1119912276 14:78360511-78360533 CAGAGCTGGAATTCCAATTTAGG - Intronic
1120438346 14:84505416-84505438 CATAGCAGCAATTTTAAATTGGG - Intergenic
1120548634 14:85841894-85841916 CAGAGTCATAATTTTAAATTTGG + Intergenic
1121366805 14:93320224-93320246 GAAAGCTGCAATTTTCAACTGGG + Intronic
1121642239 14:95493426-95493448 CAGAGCTGGAATTTGAACCTAGG + Intergenic
1202831669 14_GL000009v2_random:41310-41332 CAGAGCTGGAAATGTAGATTAGG + Intergenic
1124172006 15:27382959-27382981 CAGAGGTCCAAATATAAATTTGG + Intronic
1124813160 15:32961981-32962003 GAGGTCTGCAATTTTAAATGGGG - Intronic
1124942741 15:34233336-34233358 CACTGCTGTAATTTTATATTAGG - Exonic
1125430606 15:39589543-39589565 CAGAGCAGCATTTTTAAATATGG - Intronic
1127121411 15:55775245-55775267 GAGAACTGCAATTGTAAATCTGG + Intergenic
1127187755 15:56497327-56497349 CTGAGCCGCCATTTTTAATTTGG + Intergenic
1127646155 15:60961548-60961570 CTCAGCTGCTACTTTAAATTTGG + Intronic
1130336893 15:82964180-82964202 CAGAGCTGAAATTTAACCTTGGG + Intronic
1130421907 15:83756541-83756563 GGGAGCTGCAATTTGAGATTTGG + Intronic
1131503994 15:92999462-92999484 CTGAACTGAAATTATAAATTGGG - Intronic
1132487827 16:205092-205114 CAGAGGTGCAGTATTAAATCAGG - Intronic
1133656769 16:7872396-7872418 TGGAGCTGCAAGTTTAAATAGGG + Intergenic
1133707584 16:8369819-8369841 CAGAGTTGCATTTTGACATTTGG - Intergenic
1135516259 16:23138083-23138105 CAGAGCTTCAACTTGAACTTAGG - Intronic
1135603260 16:23801382-23801404 CAGAGCTGGAATTTGAACTCAGG + Intergenic
1135738613 16:24954421-24954443 CAGGGTTGCAATTTAAAATATGG + Intronic
1136188156 16:28600346-28600368 CAGAGCTGCAATTTTAAATCGGG + Intergenic
1136190628 16:28613340-28613362 CAGAGCTGCAATTTTAAATCGGG + Intronic
1136318479 16:29467380-29467402 CAGAGCTGCAATTTTAAATTGGG - Exonic
1136433054 16:30206729-30206751 CAGAGCTGCAATTTTAAATTGGG - Exonic
1136453308 16:30366808-30366830 CAGAACTGAAATTTGAACTTAGG - Intronic
1137468052 16:48729161-48729183 AAGGGCTGCATTTTTAAATAGGG - Intergenic
1137697124 16:50468817-50468839 CAGAGCCACAGTTTTAAATAGGG + Intergenic
1138314831 16:56060957-56060979 TAGAGTTGCAATTTTAGACTTGG + Intergenic
1138796175 16:59972067-59972089 CAGAACTGGAATAATAAATTAGG + Intergenic
1140071415 16:71653607-71653629 CAGAGCTGAGATTTGAAACTAGG - Intronic
1141162086 16:81636042-81636064 CTTAGGTGCAGTTTTAAATTGGG + Intronic
1141314007 16:82943019-82943041 CAGAGCTGTCATATTAAAATGGG - Intronic
1141875098 16:86818807-86818829 CAAAGCTGCATATCTAAATTGGG - Intergenic
1142858059 17:2743770-2743792 AAAAGCTTCTATTTTAAATTGGG - Intergenic
1144427678 17:15159233-15159255 CAGAGCTGGTATTTTAAAAAAGG - Intergenic
1144478460 17:15609528-15609550 CAGAGCTGGAATTTAAACTCAGG - Intronic
1144919831 17:18754183-18754205 CAGAGCTGGAATTTAAACTCAGG + Intronic
1145355320 17:22140628-22140650 AAGGGCTTCAATTTTAAATAGGG + Intergenic
1146095685 17:29928890-29928912 CAGAACTGTAATTTTAAAAACGG - Intronic
1146339968 17:32010078-32010100 CAGAGCATAAGTTTTAAATTTGG + Intronic
1146535852 17:33651415-33651437 CAGTGTTGGAATTTTACATTTGG - Intronic
1147492580 17:40884052-40884074 CATATCTGAAATTTTCAATTAGG + Intronic
1147760085 17:42792083-42792105 CAGAGCTGAAGTTTGAACTTAGG - Intronic
1148194276 17:45702025-45702047 CAGAGCTGGAATTAGTAATTCGG - Intergenic
1153544751 18:6194116-6194138 AAAAACTGCAATTTTAACTTTGG + Intronic
1153613667 18:6913051-6913073 CAGTTCTGCATTTTTAAATTGGG - Exonic
1153697493 18:7659078-7659100 TATACCTGCAATTTTAAATATGG - Intronic
1154421326 18:14231290-14231312 CAGAGCTGGAAATGTAGATTAGG + Intergenic
1155045517 18:22099956-22099978 AGGGGCTGCAATTTTAAATATGG + Intergenic
1155107823 18:22685333-22685355 CACATATGCATTTTTAAATTTGG + Intergenic
1156082068 18:33348413-33348435 TAGAACTGCAATTTTCAATATGG + Intronic
1158487724 18:57882614-57882636 CAGAGCTGCACGTTTAAAAGGGG - Intergenic
1159150179 18:64512591-64512613 CAGAGCTGAAATTTAAATTTAGG + Intergenic
1159174078 18:64811875-64811897 CAGAGCTGCAATTTGAAACCAGG - Intergenic
1159599322 18:70413668-70413690 CAGAGCTGCAATCATTAGTTGGG + Intergenic
1159608083 18:70495687-70495709 CAGACATGAAATTTTAAATTTGG + Intergenic
1160031671 18:75267183-75267205 CAGAGCTGCAATGTAAAATGAGG - Intronic
1162080724 19:8216076-8216098 CAGGGCTACAATTTTAAAGAGGG - Intronic
1162854192 19:13455695-13455717 CAGGGCTGCAATTTCAAATATGG + Intronic
1165844897 19:38812121-38812143 CAGAGCTGGGATTTTAACTCGGG + Intronic
1166073791 19:40402048-40402070 TACAGCTGCATTTTTAAATGGGG - Intronic
1166439553 19:42800196-42800218 CAGAGCTGCAATTTCATAGCAGG + Intronic
1166457591 19:42955737-42955759 CAGAGCTGCAATTTCATAGCAGG + Intronic
1166488506 19:43236041-43236063 CAGAGCTGCAATTTCATAGCAGG + Intronic
1166495183 19:43296515-43296537 CAGAGCTGCAATTTCATAGCAGG + Intergenic
1166760834 19:45223641-45223663 CAGAGCTTCTGTTTTAAATGGGG + Intronic
1166889159 19:45979784-45979806 CTGGCCTGCAATTTTAAATAGGG + Intergenic
1167034280 19:46984636-46984658 CAGGGTTGCTATTTTAAAATGGG + Intronic
1167444722 19:49530795-49530817 TGGAGCTGCAATTTTAAACAGGG + Intronic
1167704448 19:51070848-51070870 GAGAGTTGCAATTTTATGTTGGG - Intergenic
1167916499 19:52744166-52744188 CACAGCTGCAATGTCAAATGCGG + Intergenic
1168079753 19:54000965-54000987 CAGAGGTGGGATTTTAAACTCGG + Intronic
1202641027 1_KI270706v1_random:86444-86466 CAGAGCTGGAAATGTAGATTAGG - Intergenic
925798031 2:7567994-7568016 GACAGCTGCAATTCTAAGTTGGG - Intergenic
926357423 2:12054102-12054124 GAGAGCTACAATTTGAGATTTGG + Intergenic
926419323 2:12681530-12681552 CAGAGCTGCAATTTTAATGGAGG + Intergenic
926800216 2:16653427-16653449 AAGAGTTGCTATTTTAAATAGGG - Intronic
927819760 2:26253548-26253570 CAGAGCTGGAATTTGAACCTAGG - Intronic
928659816 2:33490749-33490771 CTGAGATGCAATTTACAATTGGG - Intronic
929562729 2:42965958-42965980 TAGAGCTGGAATTTTAACTTGGG + Intergenic
930049166 2:47200813-47200835 CAGAGATGCAAGTTAAAATTAGG - Intergenic
930099876 2:47595256-47595278 CAGAGCTGGAATTTGAACTCAGG + Intergenic
930540472 2:52699767-52699789 CAGAGCTGGGATTTGAAATCAGG - Intergenic
930697127 2:54423268-54423290 CAGAGCTGGAGTTCCAAATTGGG - Intergenic
930857066 2:56030215-56030237 CAGCACTGCAATTTTAAAAGTGG - Intergenic
931878351 2:66539504-66539526 TAGAGCTGGAATTTGAAACTTGG - Intronic
934942048 2:98509858-98509880 CTGAGCTGCAGTTGTAAACTGGG + Intronic
935790918 2:106589471-106589493 TGGGGCTGCAATTTTAAATAAGG + Intergenic
935814077 2:106830131-106830153 CAGAGCTGCCATATAAATTTAGG + Exonic
935966061 2:108477488-108477510 CAGAGCTGAAATTTTAATTCAGG + Intronic
936779073 2:116010112-116010134 TTGAGCTACAATTTTAAATTTGG - Intergenic
936983522 2:118286825-118286847 TAGAGGTGCAATTGTAAGTTGGG - Intergenic
937275374 2:120680648-120680670 CAGAGCTGGGATTTGAAATCAGG - Intergenic
937945233 2:127328525-127328547 GAGAGCTGGAATTTGAATTTGGG + Intronic
938877136 2:135543964-135543986 CAGAGCTGTGAATTTCAATTAGG - Intronic
939430210 2:142094848-142094870 CAGGGCTACAATTTTATAATTGG + Intronic
939700408 2:145384698-145384720 CAGAGCTGCTGATTTAAATAGGG - Intergenic
940042311 2:149373333-149373355 CTGAGCTGAAGTTATAAATTTGG + Intronic
940204403 2:151186848-151186870 CAGAGCTGGAATTTGAAACCAGG - Intergenic
941347557 2:164389045-164389067 CAGAGATGTAATTCTAAACTGGG - Intergenic
943006271 2:182391218-182391240 CAGAGCTGCAACGTTAAATGCGG - Intronic
943308405 2:186296455-186296477 CAGAGCTGAAATTAGAAACTAGG - Intergenic
943744484 2:191447481-191447503 CTGAGCTGCAAATATAAAGTTGG - Intergenic
943785797 2:191877329-191877351 GAGAGCTGGAATTTGAAACTAGG + Intergenic
943871057 2:192999721-192999743 CAATCCTGCACTTTTAAATTAGG + Intergenic
944054781 2:195512236-195512258 CAGAGCTGCAGTTCTCAACTGGG - Intergenic
945827822 2:214746083-214746105 CATTTCTTCAATTTTAAATTGGG + Intronic
946536632 2:220636701-220636723 CAGAGCTGCCTTTCTAAAATTGG - Intergenic
946682206 2:222229421-222229443 CAGAGCTGGTGTTTTAAAGTTGG - Intronic
1169635034 20:7680453-7680475 CAGAGCTGGAATTTTAACCTAGG - Intergenic
1169896109 20:10507070-10507092 TGAAGCTGCAATTTTAAATCAGG + Intronic
1170107856 20:12771443-12771465 CAGACCTGGAAATTTAAATTTGG + Intergenic
1170328022 20:15177443-15177465 CAGAGTTGTATTTTTCAATTTGG - Intronic
1171888138 20:30676658-30676680 CAGAGCTGGAAATATAGATTAGG - Intergenic
1172224742 20:33297820-33297842 CAGAGCTGGGATTTGAACTTGGG - Intronic
1172822831 20:37753535-37753557 CATAGCTGAAATATGAAATTAGG + Intronic
1173510737 20:43626196-43626218 CTGAGCTGCACATTTAATTTGGG + Intronic
1173701490 20:45075727-45075749 CAGGGCTGCATTTAAAAATTAGG + Exonic
1173818523 20:46005772-46005794 CAGAGCTGAGATTTGAACTTAGG + Intergenic
1174608598 20:51780228-51780250 CCCAGCTGCATTTTTATATTAGG + Intergenic
1176610857 21:8886143-8886165 CAGAGCTGGAAATGTAGATTAGG + Intergenic
1177019325 21:15833938-15833960 AAGAGTAGTAATTTTAAATTTGG + Intronic
1179978446 21:44884145-44884167 CACAGTTACAATTTTAAAGTAGG + Intergenic
1180360928 22:11895428-11895450 CAGAGCTGGAAATGTAGATTAGG + Intergenic
1182084992 22:27555379-27555401 CAAAGCTGACATTTTAAATGGGG - Intergenic
1183824975 22:40379025-40379047 AGGAGCTGCTATTCTAAATTAGG - Intronic
950936082 3:16840792-16840814 CAGTGCTACAATTTTTAATGGGG + Intronic
951216600 3:20031194-20031216 CAGACAACCAATTTTAAATTGGG + Intergenic
951320081 3:21233927-21233949 AAGAGCTGACATTTTAGATTGGG - Intergenic
951843604 3:27061709-27061731 CAAAGCTGCAATTCTAAAGAAGG - Intergenic
952086322 3:29825766-29825788 CAGAGCTGGGATTTGAATTTTGG - Intronic
952756459 3:36872598-36872620 CATTGCTGCATTTTTTAATTTGG - Intronic
952991719 3:38836382-38836404 AAGAGCTGCCATTTTGGATTCGG + Intergenic
954458694 3:50613610-50613632 CAGAGTTACAATTTTGAACTTGG + Intronic
956235564 3:67067131-67067153 CAGAGCAGAAATTTTTATTTTGG - Intergenic
956313776 3:67911869-67911891 CAGAGCTGCAATTTGAAACCAGG - Intergenic
956437746 3:69250757-69250779 CAGAGCTCCAATTTTTCTTTGGG - Intronic
956517875 3:70069792-70069814 CAGAGCAGCAATTTGAATATAGG + Intergenic
956538819 3:70310665-70310687 CATAGGTGTATTTTTAAATTAGG + Intergenic
956874465 3:73448176-73448198 CTGAGCTGGGATTTGAAATTAGG - Intronic
957034320 3:75279696-75279718 CAGAGCTGAAATTTGAATATGGG + Intergenic
958875313 3:99609567-99609589 CAGGGATGTAGTTTTAAATTAGG + Intergenic
961137178 3:124522070-124522092 TAGAGATGCATTTTTAAATAGGG + Intronic
962103481 3:132366728-132366750 CAGAGCTGGAGATTTATATTTGG + Intronic
962237134 3:133716215-133716237 CAGAACTAGAATGTTAAATTTGG - Intergenic
962274333 3:134000708-134000730 CTGGGTTGCCATTTTAAATTGGG - Intronic
963179292 3:142337246-142337268 CAGGGGTGCTCTTTTAAATTGGG - Intronic
963215273 3:142739359-142739381 CAGACCTGGAATTTGAACTTAGG + Intronic
964380428 3:156093622-156093644 CAGAGTTGCTTTGTTAAATTTGG + Intronic
964450678 3:156809761-156809783 CAGAACTGTAAATTTAAACTGGG + Intergenic
964535705 3:157718635-157718657 CAGAGCTTGAATTTGAATTTGGG + Intergenic
964588253 3:158331138-158331160 GAGAGCTACAATTTGAGATTTGG + Intronic
964679714 3:159324135-159324157 CAGAGCTGCATTTTTATATATGG + Intronic
964913698 3:161813662-161813684 CAGAGCGGGAAATATAAATTTGG - Intergenic
964915231 3:161832771-161832793 TGGAGCTGCTATTTTAAATTGGG + Intergenic
967599068 3:191362848-191362870 CAGAGCTGCAAGTAAAAATTAGG + Intronic
968351307 3:198055627-198055649 CAGAGCTGGAAATGTAGATTAGG - Intergenic
1202737538 3_GL000221v1_random:20946-20968 CAGAGCTGGAAATGTAGATTAGG + Intergenic
970024156 4:11604020-11604042 TAGGGCTGCAATTTCAAACTGGG - Intergenic
970322320 4:14886809-14886831 GCAAGTTGCAATTTTAAATTAGG - Intergenic
970497242 4:16638883-16638905 CAGAGATGCAATCTCCAATTTGG + Intronic
970763132 4:19515885-19515907 GAGAGCTACAAGATTAAATTTGG - Intergenic
970818003 4:20179958-20179980 CAGGTATGCAATTTTTAATTTGG + Intergenic
970981693 4:22106406-22106428 CAGAGCCTAAGTTTTAAATTAGG - Intergenic
970986392 4:22163824-22163846 GAGGGCTGCACTTTTAAATATGG - Intergenic
971070574 4:23086847-23086869 CAGAGATGGAATTTTAACTCAGG + Intergenic
971101291 4:23468611-23468633 CTAAGCTGCAACATTAAATTCGG + Intergenic
971401000 4:26275294-26275316 CAGAGCTGCGATTTGAATCTGGG - Intronic
971828979 4:31665562-31665584 CAGAGCTACAATTTGTATTTAGG - Intergenic
972111604 4:35568053-35568075 CAAAGATGCAATTTTACACTTGG + Intergenic
972134895 4:35879847-35879869 CAGAGCTGTAATTGTAATTATGG - Intergenic
972731711 4:41801355-41801377 GAGAGTTTCAATTTTAAATATGG - Intergenic
973384542 4:49496974-49496996 CAGAGCTGGAAATGTAGATTAGG - Intergenic
974939906 4:68454233-68454255 CTGAGCTGCAGTTATAGATTTGG + Intronic
975051233 4:69867306-69867328 TTGAGCTGCAATATTAAATGTGG - Intergenic
976148987 4:82074092-82074114 CAGAGCTGGAGTTTGAACTTAGG - Intergenic
976383035 4:84421905-84421927 CAGAGATGCAATTTGAACTCAGG + Intergenic
977175852 4:93818436-93818458 CAGAGCTGTATTTCTAAATATGG - Intergenic
977801055 4:101232151-101232173 CAGAGCAGTAAGATTAAATTAGG - Intronic
977937229 4:102820664-102820686 CAGAGCTTCAAATCTAAATTTGG - Intronic
978003386 4:103585091-103585113 AAGATATGCAATTTTAAATAAGG + Intergenic
978624892 4:110674159-110674181 CATGGCTGCAATTTTGAGTTAGG - Intergenic
978672084 4:111261416-111261438 CAGAGCTGGAGTTTTTAACTAGG + Intergenic
979211804 4:118113715-118113737 CAGAGCTGCCATTGAAAATATGG + Intronic
980145345 4:128976583-128976605 TTGAGCTGAAAGTTTAAATTGGG - Intronic
980145469 4:128978296-128978318 TAGGGCTGAAAGTTTAAATTGGG + Intronic
980569454 4:134595023-134595045 CAAAGCTTCATTTTTAAAGTTGG + Intergenic
980967113 4:139532752-139532774 CAGTCCAGCAATTTTTAATTTGG - Intronic
981273192 4:142868093-142868115 CAAAGCTGCAAGTTCAAACTGGG + Intergenic
981906655 4:149928853-149928875 CAGAGCTGCACATTTAATTATGG - Intergenic
982318573 4:154057071-154057093 CATCTCTCCAATTTTAAATTGGG + Intergenic
982357003 4:154481809-154481831 CAGAGCTGAAATTTAAACTTGGG + Intronic
983599683 4:169512589-169512611 CAGAGCCAAATTTTTAAATTTGG + Intronic
983980308 4:173987486-173987508 AAGAGCTGCAGTTTTAAATAGGG - Intergenic
1202768394 4_GL000008v2_random:172295-172317 CAGAGCTGGAAATGTAGATTAGG - Intergenic
988104340 5:26724570-26724592 CTGAACTTCACTTTTAAATTAGG - Intergenic
989328053 5:40222836-40222858 CAAAGCAGCAATATTTAATTAGG - Intergenic
990713842 5:58614178-58614200 CATAGCTGAAATTTGAAAATAGG - Intronic
990978964 5:61584647-61584669 CACAGCTTCAATTTTGGATTAGG + Intergenic
992946804 5:81819189-81819211 CTGTGCTGCAGTTTTAAATGCGG + Intergenic
993239162 5:85357994-85358016 CAGAGTCATAATTTTAAATTTGG - Intergenic
993433523 5:87862195-87862217 CAGAGCTGCAATTGGCAATATGG - Intergenic
994018720 5:94999331-94999353 GAGAGATGCACTTTTAAAATGGG + Intronic
995247524 5:109951339-109951361 CAGAGCTGGAATTTAAATTCTGG + Intergenic
995768192 5:115641117-115641139 CAGATGAGGAATTTTAAATTGGG + Intergenic
996846732 5:127907343-127907365 CAAATCTGAAGTTTTAAATTAGG - Intergenic
999068086 5:148713616-148713638 CAAAGCAGCAACTTTAAATAGGG - Intergenic
999152631 5:149436511-149436533 CAAAGGAGCTATTTTAAATTGGG + Intergenic
999491247 5:152053553-152053575 CTGGGCTGCAAATATAAATTTGG + Intergenic
999992682 5:157063749-157063771 CTGAGTTGCAATTTTAAACAAGG + Intergenic
1000252457 5:159508532-159508554 CAGGGCTGCAATTTTGCCTTTGG + Intergenic
1000773408 5:165385986-165386008 CAGAACTGAATTTTTATATTGGG - Intergenic
1000996616 5:167965824-167965846 CAGAGCTGAAATTTGAACCTGGG + Intronic
1001345557 5:170894172-170894194 CAGAGTTGCATTTGTAAGTTTGG + Intronic
1001349565 5:170946101-170946123 CAGCTCTGCACTTTTAAATAGGG + Intronic
1003182361 6:3802910-3802932 TAGAGCTGCACCTTTAAAATAGG + Intergenic
1003708161 6:8558902-8558924 CAGTACTGCAGTTTTAAAATAGG + Intergenic
1003728148 6:8790092-8790114 CAGAGCCACAATTTTAATTTGGG + Intergenic
1003788566 6:9516155-9516177 CAGAGCTGTATTTTTAAGTAGGG - Intergenic
1004590807 6:17050003-17050025 CATAGCTGTCACTTTAAATTTGG - Intergenic
1006562888 6:34928798-34928820 CAGAGCTGCCATTTTCAAGGTGG + Intronic
1006872155 6:37261476-37261498 CAGAGCTGGGATTTTAACCTAGG - Intronic
1007152968 6:39713018-39713040 CGGAGGTGCAATTTTAAATAAGG + Intronic
1007153847 6:39723435-39723457 CAGAGCTGTAATTTTAATTAAGG - Intronic
1007839393 6:44703197-44703219 CTAAGGTGGAATTTTAAATTTGG + Intergenic
1008010626 6:46463685-46463707 CAGAGTTTAAATCTTAAATTTGG + Intronic
1008319391 6:50089223-50089245 CAGAGCTAAAATTTGAAATCGGG + Intergenic
1008383116 6:50856114-50856136 CAGAACTGCAAATATAACTTTGG + Intergenic
1009415299 6:63409549-63409571 CAGAGCTGAAATTTAAAATAAGG - Intergenic
1010056824 6:71576068-71576090 CAGAGCTGTAATTAGAAGTTGGG - Intergenic
1011146595 6:84224493-84224515 CAGAACTGCACATTTAAAATGGG + Intronic
1011822164 6:91265416-91265438 CTGAGCTGCAATATTATATTTGG + Intergenic
1012227562 6:96722150-96722172 AAGGGTTGCAATTTTAAATAGGG + Intergenic
1012643469 6:101651580-101651602 GAGGGCTACAATTTTAAATAGGG + Intronic
1013688919 6:112616910-112616932 CAGAACTGTAAATTTAAACTGGG + Intergenic
1015210924 6:130697351-130697373 CAGGGTTGCAACTTAAAATTTGG + Intergenic
1015437911 6:133211242-133211264 CAGTGCTGTAATTTTAACTTTGG - Intergenic
1015464177 6:133529567-133529589 GAGAGCTTGACTTTTAAATTTGG - Exonic
1015715816 6:136191298-136191320 CAGAGCTGGAAATTTTTATTAGG + Intronic
1015912657 6:138184099-138184121 CATAGCTTCTATTTAAAATTTGG + Intronic
1016173661 6:141051497-141051519 CAGAGCTCAAATTTTCAACTTGG + Intergenic
1018351473 6:162964172-162964194 CAGAGCTGAAATGTGAAATCAGG - Intronic
1018445510 6:163854561-163854583 CAGATCTGCAATTTCAGTTTTGG + Intergenic
1020478860 7:8632746-8632768 TAGAGCTGTAATTGTAAAGTAGG + Intronic
1020761469 7:12271825-12271847 GAGATCTTCAGTTTTAAATTTGG - Intergenic
1021459319 7:20867783-20867805 AAAAACTGCAATTTTATATTTGG - Intergenic
1021761034 7:23903466-23903488 GAGAGCTGCCATTTTGGATTTGG - Intergenic
1022301819 7:29108952-29108974 CAGAACTGGAATATAAAATTAGG - Intronic
1022419566 7:30207662-30207684 CAGAGCTGGAATTTGAACCTGGG - Intergenic
1022937964 7:35200007-35200029 CAGACCTAAAATTCTAAATTGGG - Intergenic
1023225556 7:37965342-37965364 CACAGCTGCAATTTAGGATTTGG + Intronic
1026430312 7:70339998-70340020 AAGAGCTGCAATTTTAACCCTGG - Intronic
1027135671 7:75622296-75622318 CTGAGCTACATTTATAAATTTGG + Intronic
1027372383 7:77519743-77519765 CAGAGGTACAATTTTAAATTGGG + Intergenic
1027679371 7:81200611-81200633 CAGAGCTGCTATTATATATCTGG - Intergenic
1028718487 7:94002297-94002319 TTGACCTGAAATTTTAAATTTGG - Intronic
1028766190 7:94562701-94562723 CAGAGCAGCAATTTCAAAAGAGG - Intergenic
1028940456 7:96516247-96516269 CAGAGAAGAAATTTTTAATTTGG - Intronic
1028958818 7:96725344-96725366 CCTAGCTTCATTTTTAAATTGGG + Intergenic
1030483663 7:110137870-110137892 CAGAGATGCCAATTTAATTTAGG - Intergenic
1033797207 7:144860521-144860543 CAGATTTGCAAGTTTTAATTGGG + Intergenic
1034001533 7:147418536-147418558 CACATTTGCAATTTTACATTAGG - Intronic
1034934521 7:155190224-155190246 TAGAGCTTCAACTATAAATTTGG - Intergenic
1036923845 8:12884396-12884418 CAGAACTGGGATTTTAATTTGGG + Intergenic
1037110713 8:15161311-15161333 GAAAGCTGAAATTTTAAATATGG - Intronic
1038507530 8:28097933-28097955 CAGAGCTGGGATTTGGAATTAGG + Intronic
1038996654 8:32930533-32930555 GACAGTTGCAATTTTAAATAGGG - Intergenic
1039406821 8:37320026-37320048 CCGAGTTGCAATTTCAAGTTTGG - Intergenic
1039757705 8:40540976-40540998 CAGAACTGGAATTTGAAGTTGGG - Intronic
1039935781 8:42043787-42043809 CAGAGCTGGGATTTGAATTTGGG - Intronic
1041184324 8:55283336-55283358 CGGAGCTGGTATTTAAAATTGGG - Intronic
1041694045 8:60716586-60716608 AGGAGGTGCAATTTTAAATTGGG - Intronic
1041985545 8:63918262-63918284 CTGGGCTGCAATTTTAGATAAGG - Intergenic
1042147573 8:65746311-65746333 TAGAGCTGGGATCTTAAATTAGG + Intronic
1043190881 8:77221588-77221610 CAGAGCAAAAATTTTAAAATGGG + Intergenic
1044163829 8:88955383-88955405 CATAGCAGCAGTTGTAAATTGGG + Intergenic
1044298390 8:90555067-90555089 AAGAGCAACAATTTCAAATTGGG - Intergenic
1044634060 8:94304879-94304901 CAGATCTTCATTTTTAAATAAGG + Intergenic
1044980747 8:97714315-97714337 CAGAGTTGAAATTTTAAGCTGGG + Intronic
1045814862 8:106268004-106268026 CAGGGATGCAATTCTAACTTAGG - Intergenic
1045832080 8:106474453-106474475 GATAGCTGCAATTCTAAATCTGG + Intronic
1045961347 8:107972508-107972530 CAGAGCTACATTTTCAAATTAGG + Intronic
1046105587 8:109662158-109662180 CTGAGCAGAAATTTTAATTTAGG - Intronic
1046522135 8:115338995-115339017 TAGATCTCCAACTTTAAATTTGG - Intergenic
1047447447 8:124932060-124932082 CAGACCTGGAATTTGAACTTGGG + Intergenic
1050631828 9:7567727-7567749 TAGAGCTGGATTTTTAAAATTGG + Intergenic
1051024579 9:12592490-12592512 TAGAGCTGCAATCTGAGATTAGG + Intergenic
1051679324 9:19591170-19591192 CAGAGCTGTAGATGTAAATTTGG - Intronic
1052875195 9:33554437-33554459 CAGAGCTGGAAATTTATATTAGG + Intronic
1053027734 9:34744365-34744387 TAGAGCTGTAAGTTCAAATTTGG + Intergenic
1053168991 9:35864994-35865016 CAGAGTTTGAACTTTAAATTGGG - Intergenic
1053212355 9:36241774-36241796 CAAAGCTGCAATGTTATATATGG + Intronic
1053500826 9:38589893-38589915 CAGAGCTGGAAATTTATATTAGG - Intergenic
1053660322 9:40270583-40270605 CAGAGCTGGAAATGTAGATTAGG + Intronic
1053910695 9:42899937-42899959 CAGAGCTGGAAATGTAGATTAGG + Intergenic
1054361310 9:64123305-64123327 CAGAGCTGGAAATGTAGATTAGG + Intergenic
1054372450 9:64416877-64416899 CAGAGCTGGAAATGTAGATTAGG + Intergenic
1054524278 9:66105641-66105663 CAGAGCTGGAAATGTAGATTAGG - Intergenic
1054680070 9:67906577-67906599 CAGAGCTGGAAATGTAGATTAGG + Intergenic
1055308846 9:74957379-74957401 GTGAGTTGCAATTTTAAATAAGG - Intergenic
1055461566 9:76524566-76524588 CACAGCTGGAATTTTGTATTAGG + Intergenic
1055692570 9:78848272-78848294 CTCAGCTGCAATTATTAATTAGG + Intergenic
1056388200 9:86116747-86116769 CAGGGATGCAGTTTGAAATTTGG + Intergenic
1056766982 9:89450508-89450530 CAGAACTGTAAATTTAAACTGGG - Intronic
1057618163 9:96611979-96612001 CTTAGCTGCAATTTAATATTAGG + Intronic
1057680233 9:97174386-97174408 CAGAGCTGGAAATTTATATTAGG - Intergenic
1058067693 9:100567343-100567365 GAGGGTTGCAATTTTAAATAAGG - Intronic
1058299378 9:103351687-103351709 CAGATATGCAATTTGTAATTTGG - Intergenic
1059203338 9:112439807-112439829 CAGAGCTGCAATATGAAGCTGGG - Intronic
1059436043 9:114276989-114277011 CAAAGCTGGAATTTGAACTTAGG + Intronic
1060058143 9:120433766-120433788 CAGAGCTGGGATTTTAAATCAGG - Intronic
1060291421 9:122306626-122306648 CAGAGCTGGAATTGGAAATCAGG + Intronic
1060394520 9:123306105-123306127 CAGAGCTGGGACTTCAAATTAGG + Intergenic
1060671313 9:125472092-125472114 CAAAGCTGCAATTTGAACTCAGG + Intronic
1060780138 9:126405658-126405680 CAGAGTTTCAATTATTAATTGGG + Intronic
1061469952 9:130816481-130816503 GGGAGCTGCAATTTTAAATAAGG - Intronic
1203693289 Un_GL000214v1:66150-66172 CAGAGCTGGAAATGTAGATTTGG - Intergenic
1203706262 Un_KI270742v1:51389-51411 CAGAGCTGGAAATGTAGATTAGG + Intergenic
1203557739 Un_KI270744v1:14516-14538 CAGAGCTGGAAATGTAGATTTGG - Intergenic
1203642984 Un_KI270751v1:37913-37935 CAGAGCTGGAAATGTAGATTTGG + Intergenic
1185552345 X:993185-993207 GGGAGCTGCAATTTGAGATTTGG - Intergenic
1186766347 X:12774167-12774189 CAGAGCTGGGATTTGAACTTAGG - Intergenic
1187192839 X:17052941-17052963 CACAGCTGCAAGTCTGAATTAGG - Intronic
1187586698 X:20670557-20670579 CAAAACTGAAATTTTAAAATAGG + Intergenic
1187715997 X:22103072-22103094 CAGAGCTGAGATTCTAAATGGGG + Intronic
1190008723 X:46763535-46763557 AATAGCTGGAATTTTAAAATTGG + Intergenic
1190156866 X:48000729-48000751 CAGAGCAAGAATTTTTAATTTGG - Intronic
1190186760 X:48241850-48241872 CAGAGCACAAGTTTTAAATTGGG - Intronic
1190443725 X:50501996-50502018 CAGAGCTTCAAATGTTAATTTGG + Intergenic
1190788207 X:53674112-53674134 CAGAAATGCAAATTTAAATAAGG - Intronic
1193349496 X:80443770-80443792 CAGATCTTGAATTTTACATTTGG - Exonic
1193369305 X:80675094-80675116 CAAATCTGTAATATTAAATTTGG + Exonic
1193861799 X:86677184-86677206 CAGAGTTGCCATTTTCATTTAGG + Intronic
1193992907 X:88330746-88330768 AAAAGTTGCAATTTTAAATATGG - Intergenic
1194273989 X:91857325-91857347 GGGAGCTGCAATTTGAAATTTGG + Intronic
1194584731 X:95718341-95718363 CTGAGCTGCAAGTGTCAATTTGG - Intergenic
1194733046 X:97478487-97478509 AAGAACTGCAATTTCAAATTAGG - Intronic
1195408610 X:104544527-104544549 AAGATTTGCAATTTTAAATATGG - Intergenic
1195623981 X:106988876-106988898 CAGAGAGGTAAATTTAAATTGGG + Intronic
1196119264 X:112031022-112031044 CAGAGCTGGGATTTGAAATCAGG + Intronic
1196257059 X:113532800-113532822 CAGAAATGCAATTTTAATTCGGG + Intergenic
1196375266 X:115026262-115026284 CAGAGCTGTAAATATAAATTTGG + Intergenic
1197387089 X:125814866-125814888 CTGAGCTGCAACATTGAATTCGG + Intergenic
1198969034 X:142259764-142259786 TAAAGCTGAAATTTTAATTTAGG - Intergenic
1199538687 X:148933053-148933075 TAGAGCTGTAGTTTTAAATGGGG + Intronic
1200237526 X:154475429-154475451 TTGAGATGCAATTTTAAATAGGG + Intergenic
1200591226 Y:5078742-5078764 GGGAGCTGCAATTTGAAATTTGG + Intronic
1201400257 Y:13597186-13597208 CTGAGCTGCAATATTAAATGTGG + Intergenic
1202269842 Y:23060956-23060978 CAGAGATGAGAATTTAAATTTGG + Intergenic
1202422836 Y:24694702-24694724 CAGAGATGAGAATTTAAATTTGG + Intergenic
1202447953 Y:24975384-24975406 CAGAGATGAGAATTTAAATTTGG - Intergenic