ID: 1136439467

View in Genome Browser
Species Human (GRCh38)
Location 16:30254882-30254904
Sequence CTCCATCTTAAATAGGAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136439463_1136439467 22 Left 1136439463 16:30254837-30254859 CCGCAGTGGGCAATGATCATGTC No data
Right 1136439467 16:30254882-30254904 CTCCATCTTAAATAGGAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136439467 Original CRISPR CTCCATCTTAAATAGGAGCC AGG Intergenic
No off target data available for this crispr