ID: 1136446687

View in Genome Browser
Species Human (GRCh38)
Location 16:30326263-30326285
Sequence CACGTGAATCCGGGAGACGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136446687_1136446692 8 Left 1136446687 16:30326263-30326285 CCTCCGTCTCCCGGATTCACGTG No data
Right 1136446692 16:30326294-30326316 GCCTCAGCCTCCCAAGTAGCTGG 0: 81212
1: 190903
2: 234468
3: 228974
4: 272812
1136446687_1136446696 17 Left 1136446687 16:30326263-30326285 CCTCCGTCTCCCGGATTCACGTG No data
Right 1136446696 16:30326303-30326325 TCCCAAGTAGCTGGGATTACAGG 0: 48553
1: 142115
2: 242012
3: 520212
4: 384467
1136446687_1136446694 9 Left 1136446687 16:30326263-30326285 CCTCCGTCTCCCGGATTCACGTG No data
Right 1136446694 16:30326295-30326317 CCTCAGCCTCCCAAGTAGCTGGG 0: 92836
1: 203589
2: 246027
3: 262461
4: 302975

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136446687 Original CRISPR CACGTGAATCCGGGAGACGG AGG (reversed) Intergenic
No off target data available for this crispr