ID: 1136448111

View in Genome Browser
Species Human (GRCh38)
Location 16:30336197-30336219
Sequence CAGGGACTAGTGGCCTCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136448111_1136448126 25 Left 1136448111 16:30336197-30336219 CCAGCAGAGGCCACTAGTCCCTG No data
Right 1136448126 16:30336245-30336267 TGGGTTGAACTTTAACCATTAGG No data
1136448111_1136448114 -6 Left 1136448111 16:30336197-30336219 CCAGCAGAGGCCACTAGTCCCTG No data
Right 1136448114 16:30336214-30336236 TCCCTGTGGACCCACCCCATTGG No data
1136448111_1136448118 0 Left 1136448111 16:30336197-30336219 CCAGCAGAGGCCACTAGTCCCTG No data
Right 1136448118 16:30336220-30336242 TGGACCCACCCCATTGGGAAAGG No data
1136448111_1136448122 6 Left 1136448111 16:30336197-30336219 CCAGCAGAGGCCACTAGTCCCTG No data
Right 1136448122 16:30336226-30336248 CACCCCATTGGGAAAGGCATGGG No data
1136448111_1136448121 5 Left 1136448111 16:30336197-30336219 CCAGCAGAGGCCACTAGTCCCTG No data
Right 1136448121 16:30336225-30336247 CCACCCCATTGGGAAAGGCATGG No data
1136448111_1136448116 -5 Left 1136448111 16:30336197-30336219 CCAGCAGAGGCCACTAGTCCCTG No data
Right 1136448116 16:30336215-30336237 CCCTGTGGACCCACCCCATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136448111 Original CRISPR CAGGGACTAGTGGCCTCTGC TGG (reversed) Intergenic
No off target data available for this crispr