ID: 1136448334

View in Genome Browser
Species Human (GRCh38)
Location 16:30337552-30337574
Sequence GGGCCTCGTCCAAGGTCACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136448334_1136448337 -9 Left 1136448334 16:30337552-30337574 CCTTGTGACCTTGGACGAGGCCC No data
Right 1136448337 16:30337566-30337588 ACGAGGCCCTTCCTCTTTCTGGG No data
1136448334_1136448336 -10 Left 1136448334 16:30337552-30337574 CCTTGTGACCTTGGACGAGGCCC No data
Right 1136448336 16:30337565-30337587 GACGAGGCCCTTCCTCTTTCTGG No data
1136448334_1136448342 21 Left 1136448334 16:30337552-30337574 CCTTGTGACCTTGGACGAGGCCC No data
Right 1136448342 16:30337596-30337618 TGCTTCCTCCGTAGAATGAGAGG No data
1136448334_1136448345 30 Left 1136448334 16:30337552-30337574 CCTTGTGACCTTGGACGAGGCCC No data
Right 1136448345 16:30337605-30337627 CGTAGAATGAGAGGCTGCTTTGG No data
1136448334_1136448340 -2 Left 1136448334 16:30337552-30337574 CCTTGTGACCTTGGACGAGGCCC No data
Right 1136448340 16:30337573-30337595 CCTTCCTCTTTCTGGGTCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136448334 Original CRISPR GGGCCTCGTCCAAGGTCACA AGG (reversed) Intergenic
No off target data available for this crispr