ID: 1136448337

View in Genome Browser
Species Human (GRCh38)
Location 16:30337566-30337588
Sequence ACGAGGCCCTTCCTCTTTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136448334_1136448337 -9 Left 1136448334 16:30337552-30337574 CCTTGTGACCTTGGACGAGGCCC No data
Right 1136448337 16:30337566-30337588 ACGAGGCCCTTCCTCTTTCTGGG No data
1136448331_1136448337 10 Left 1136448331 16:30337533-30337555 CCTGGCTTCACGGTCAGTGCCTT No data
Right 1136448337 16:30337566-30337588 ACGAGGCCCTTCCTCTTTCTGGG No data
1136448330_1136448337 13 Left 1136448330 16:30337530-30337552 CCTCCTGGCTTCACGGTCAGTGC No data
Right 1136448337 16:30337566-30337588 ACGAGGCCCTTCCTCTTTCTGGG No data
1136448329_1136448337 14 Left 1136448329 16:30337529-30337551 CCCTCCTGGCTTCACGGTCAGTG No data
Right 1136448337 16:30337566-30337588 ACGAGGCCCTTCCTCTTTCTGGG No data
1136448327_1136448337 19 Left 1136448327 16:30337524-30337546 CCAGCCCCTCCTGGCTTCACGGT No data
Right 1136448337 16:30337566-30337588 ACGAGGCCCTTCCTCTTTCTGGG No data
1136448323_1136448337 26 Left 1136448323 16:30337517-30337539 CCCCATGCCAGCCCCTCCTGGCT No data
Right 1136448337 16:30337566-30337588 ACGAGGCCCTTCCTCTTTCTGGG No data
1136448325_1136448337 24 Left 1136448325 16:30337519-30337541 CCATGCCAGCCCCTCCTGGCTTC No data
Right 1136448337 16:30337566-30337588 ACGAGGCCCTTCCTCTTTCTGGG No data
1136448328_1136448337 15 Left 1136448328 16:30337528-30337550 CCCCTCCTGGCTTCACGGTCAGT No data
Right 1136448337 16:30337566-30337588 ACGAGGCCCTTCCTCTTTCTGGG No data
1136448324_1136448337 25 Left 1136448324 16:30337518-30337540 CCCATGCCAGCCCCTCCTGGCTT No data
Right 1136448337 16:30337566-30337588 ACGAGGCCCTTCCTCTTTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136448337 Original CRISPR ACGAGGCCCTTCCTCTTTCT GGG Intergenic
No off target data available for this crispr