ID: 1136448338

View in Genome Browser
Species Human (GRCh38)
Location 16:30337572-30337594
Sequence CTGAGACCCAGAAAGAGGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136448338_1136448342 1 Left 1136448338 16:30337572-30337594 CCCTTCCTCTTTCTGGGTCTCAG No data
Right 1136448342 16:30337596-30337618 TGCTTCCTCCGTAGAATGAGAGG No data
1136448338_1136448345 10 Left 1136448338 16:30337572-30337594 CCCTTCCTCTTTCTGGGTCTCAG No data
Right 1136448345 16:30337605-30337627 CGTAGAATGAGAGGCTGCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136448338 Original CRISPR CTGAGACCCAGAAAGAGGAA GGG (reversed) Intergenic
No off target data available for this crispr