ID: 1136448339

View in Genome Browser
Species Human (GRCh38)
Location 16:30337573-30337595
Sequence CCTGAGACCCAGAAAGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136448339_1136448345 9 Left 1136448339 16:30337573-30337595 CCTTCCTCTTTCTGGGTCTCAGG No data
Right 1136448345 16:30337605-30337627 CGTAGAATGAGAGGCTGCTTTGG No data
1136448339_1136448342 0 Left 1136448339 16:30337573-30337595 CCTTCCTCTTTCTGGGTCTCAGG No data
Right 1136448342 16:30337596-30337618 TGCTTCCTCCGTAGAATGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136448339 Original CRISPR CCTGAGACCCAGAAAGAGGA AGG (reversed) Intergenic
No off target data available for this crispr