ID: 1136448340

View in Genome Browser
Species Human (GRCh38)
Location 16:30337573-30337595
Sequence CCTTCCTCTTTCTGGGTCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136448328_1136448340 22 Left 1136448328 16:30337528-30337550 CCCCTCCTGGCTTCACGGTCAGT No data
Right 1136448340 16:30337573-30337595 CCTTCCTCTTTCTGGGTCTCAGG No data
1136448330_1136448340 20 Left 1136448330 16:30337530-30337552 CCTCCTGGCTTCACGGTCAGTGC No data
Right 1136448340 16:30337573-30337595 CCTTCCTCTTTCTGGGTCTCAGG No data
1136448327_1136448340 26 Left 1136448327 16:30337524-30337546 CCAGCCCCTCCTGGCTTCACGGT No data
Right 1136448340 16:30337573-30337595 CCTTCCTCTTTCTGGGTCTCAGG No data
1136448329_1136448340 21 Left 1136448329 16:30337529-30337551 CCCTCCTGGCTTCACGGTCAGTG No data
Right 1136448340 16:30337573-30337595 CCTTCCTCTTTCTGGGTCTCAGG No data
1136448334_1136448340 -2 Left 1136448334 16:30337552-30337574 CCTTGTGACCTTGGACGAGGCCC No data
Right 1136448340 16:30337573-30337595 CCTTCCTCTTTCTGGGTCTCAGG No data
1136448335_1136448340 -10 Left 1136448335 16:30337560-30337582 CCTTGGACGAGGCCCTTCCTCTT No data
Right 1136448340 16:30337573-30337595 CCTTCCTCTTTCTGGGTCTCAGG No data
1136448331_1136448340 17 Left 1136448331 16:30337533-30337555 CCTGGCTTCACGGTCAGTGCCTT No data
Right 1136448340 16:30337573-30337595 CCTTCCTCTTTCTGGGTCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136448340 Original CRISPR CCTTCCTCTTTCTGGGTCTC AGG Intergenic
No off target data available for this crispr