ID: 1136448342

View in Genome Browser
Species Human (GRCh38)
Location 16:30337596-30337618
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136448339_1136448342 0 Left 1136448339 16:30337573-30337595 CCTTCCTCTTTCTGGGTCTCAGG No data
Right 1136448342 16:30337596-30337618 TGCTTCCTCCGTAGAATGAGAGG No data
1136448341_1136448342 -4 Left 1136448341 16:30337577-30337599 CCTCTTTCTGGGTCTCAGGTGCT No data
Right 1136448342 16:30337596-30337618 TGCTTCCTCCGTAGAATGAGAGG No data
1136448334_1136448342 21 Left 1136448334 16:30337552-30337574 CCTTGTGACCTTGGACGAGGCCC No data
Right 1136448342 16:30337596-30337618 TGCTTCCTCCGTAGAATGAGAGG No data
1136448335_1136448342 13 Left 1136448335 16:30337560-30337582 CCTTGGACGAGGCCCTTCCTCTT No data
Right 1136448342 16:30337596-30337618 TGCTTCCTCCGTAGAATGAGAGG No data
1136448338_1136448342 1 Left 1136448338 16:30337572-30337594 CCCTTCCTCTTTCTGGGTCTCAG No data
Right 1136448342 16:30337596-30337618 TGCTTCCTCCGTAGAATGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136448342 Original CRISPR TGCTTCCTCCGTAGAATGAG AGG Intergenic
No off target data available for this crispr