ID: 1136452174

View in Genome Browser
Species Human (GRCh38)
Location 16:30359615-30359637
Sequence AAGAACAAGGAGGAGGGGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1399
Summary {0: 1, 1: 2, 2: 11, 3: 147, 4: 1238}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136452165_1136452174 7 Left 1136452165 16:30359585-30359607 CCAGGCACCAAAAGGCTTGCTGA 0: 1
1: 0
2: 32
3: 36
4: 207
Right 1136452174 16:30359615-30359637 AAGAACAAGGAGGAGGGGTGGGG 0: 1
1: 2
2: 11
3: 147
4: 1238
1136452166_1136452174 0 Left 1136452166 16:30359592-30359614 CCAAAAGGCTTGCTGAGAAGAGC 0: 1
1: 0
2: 0
3: 12
4: 177
Right 1136452174 16:30359615-30359637 AAGAACAAGGAGGAGGGGTGGGG 0: 1
1: 2
2: 11
3: 147
4: 1238

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136452174 Original CRISPR AAGAACAAGGAGGAGGGGTG GGG Intronic
900087959 1:907655-907677 AGGGACAAGGAGGAGAGGTGAGG + Intergenic
900171321 1:1270498-1270520 CAGAACAAGAAGCAGGGTTGGGG - Intronic
900508055 1:3039436-3039458 AATAAGAAGGGGGAGGGGGGAGG - Intergenic
901073721 1:6538690-6538712 AAAAACAAGCAGGCTGGGTGTGG + Intronic
901952189 1:12758098-12758120 AGGAACAAGGTGGAGGGGCAGGG - Intronic
902281095 1:15375144-15375166 AAGAAAAAGTAGGCTGGGTGTGG - Intronic
902659422 1:17890915-17890937 AGCATCAAGGAGGATGGGTGAGG - Intergenic
902764686 1:18606437-18606459 TGGAAGAAGCAGGAGGGGTGGGG + Intergenic
902812101 1:18894063-18894085 AAGCAAGAGCAGGAGGGGTGAGG - Intronic
902928445 1:19713392-19713414 AGGAAGAAGGGGAAGGGGTGGGG + Intronic
903296210 1:22344703-22344725 AAAAAGAAGTGGGAGGGGTGTGG + Intergenic
903458031 1:23502082-23502104 AAGAAGAAGGAGGAGACCTGAGG - Intergenic
903649771 1:24915540-24915562 AAGGAAAAGGGGGAGAGGTGAGG + Intronic
903740614 1:25556452-25556474 AAGAGCTGGGAGTAGGGGTGGGG - Intronic
904420278 1:30386689-30386711 CAGAACAAGGAAGATGGGGGAGG + Intergenic
904471450 1:30739074-30739096 AAATACAAGGAGGAGGAATGAGG + Intronic
904560678 1:31395200-31395222 AAGAAGAAGAAGGCGGGGTGGGG - Intergenic
905123385 1:35699832-35699854 AAGGACAATGAGCAGGGGCGAGG - Intergenic
905149659 1:35917844-35917866 AAGAGCTAGGAGGAGGGAAGGGG - Intronic
905158585 1:36010615-36010637 AAGAAAAAGAAGGTCGGGTGCGG + Intronic
905240860 1:36580673-36580695 AAGGACAATGAGGAGGGAGGAGG + Intergenic
905347825 1:37323431-37323453 AAGAACAGGGAGTTGGGGAGGGG - Intergenic
905566770 1:38971805-38971827 AAGAAAAAGGAGGCCGGGCGCGG + Intergenic
905710792 1:40100930-40100952 AAGAAAAAAGAGGCTGGGTGCGG + Intergenic
905847512 1:41244731-41244753 AAGAAGCAGGAGGCTGGGTGTGG - Intergenic
905868013 1:41386797-41386819 AAGGATGAGGTGGAGGGGTGGGG - Intergenic
905968055 1:42116031-42116053 AACAACAGGGAGGCGGGGTGGGG + Intergenic
905980545 1:42221965-42221987 AAGAAGAAGGGGGAGGGGGAGGG + Intronic
906055270 1:42911100-42911122 TAGAAGAAAGAGGAGAGGTGGGG + Intergenic
906245019 1:44267388-44267410 AAGAAGAAGGAGGGGAGGAGAGG - Intronic
906375615 1:45294304-45294326 AGGAGCAAGAAGGCGGGGTGGGG - Intronic
906626781 1:47332135-47332157 AAGAAAAAGGAGAATGGGGGTGG + Intergenic
907126302 1:52054221-52054243 AAAAAAAAGGAAGAGGGGTTGGG + Intronic
907132275 1:52107646-52107668 AAAAAAAAGGAGGAGGGAGGAGG - Intergenic
907621301 1:55983485-55983507 AAGAAAGAGGAGGAGAGGGGAGG + Intergenic
908700217 1:66890691-66890713 AAGAAGAAGAAGGAGAGGAGGGG + Intronic
908792999 1:67801942-67801964 AAAAAGAAGGAAGGGGGGTGAGG + Intronic
909391594 1:75127052-75127074 AAGAACACGGAGGAGACGCGAGG - Intergenic
909427942 1:75549418-75549440 AAGAAGAAGGAAGAGTGGGGCGG - Intronic
909498905 1:76311261-76311283 AAGAAAAAAAAGGCGGGGTGGGG - Intronic
909816985 1:80006807-80006829 AAGAAAAATGAGGAGGGGAAGGG - Intergenic
909864170 1:80645578-80645600 AAAAAAAAAGAGGAGGGGAGGGG + Intergenic
910488457 1:87742071-87742093 ATGAAAAAGGAGAAGGGGAGGGG - Intergenic
910896884 1:92079293-92079315 AAAAAAAAGGAGGCGGGGAGGGG - Intergenic
911008757 1:93255783-93255805 AGGAAGAAGAAGGAGGGGGGAGG + Intronic
911399143 1:97352955-97352977 AAGATCAAGCAAGGGGGGTGGGG + Intronic
911820315 1:102411265-102411287 AAGGAGAAGGAGAAGGGGGGTGG + Intergenic
912166441 1:107047061-107047083 AACAAGTAGGAGGAGGGGTAAGG + Intergenic
912228633 1:107766232-107766254 AAGAAGAAGGAGGAGGGGGAAGG - Intronic
912842620 1:113052211-113052233 AAGAAAAAAGGGGACGGGTGAGG + Intergenic
912933121 1:113981749-113981771 AAGAAAGAGGAGGAGGTTTGAGG + Exonic
913963691 1:143357584-143357606 AAGAAGGAGGAGGAGGGGGAAGG - Intergenic
914049987 1:144123609-144123631 AAGAAAATGGAGGAGAGGAGGGG - Intergenic
914121092 1:144783186-144783208 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
914129195 1:144841842-144841864 AAGAAAATGGAGGAGAGGAGGGG + Intergenic
914462885 1:147900993-147901015 AAGGACAGGAAGGGGGGGTGGGG + Intergenic
914687068 1:149989749-149989771 AAGAAGAAGAAGGTGGGGGGCGG + Intronic
914718761 1:150272145-150272167 AAAAACAAAGAGGTGAGGTGAGG + Intronic
914805050 1:150985513-150985535 AAGAAAAAGAGGTAGGGGTGGGG - Intronic
914918902 1:151834440-151834462 GACAAGAAGGGGGAGGGGTGGGG - Intergenic
915035307 1:152918726-152918748 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
915035308 1:152918729-152918751 AAGAAGGAGGAGGAGGAGGGAGG + Intergenic
915119494 1:153619994-153620016 AAGAAGAAGCAGGAAGGGTGCGG + Intronic
915271374 1:154756065-154756087 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
915287522 1:154862426-154862448 AAGAGCAAGGTGGAGGTGAGGGG + Intronic
915328179 1:155092073-155092095 AAGGACTAGGATGAGGGGGGCGG + Intergenic
915353680 1:155242520-155242542 AAGAACAAAAAGGATGGCTGGGG - Intronic
915524235 1:156466442-156466464 AAGAGCAAGGAGGTGGGGTCAGG + Exonic
915587391 1:156851604-156851626 TATGACCAGGAGGAGGGGTGTGG + Intronic
916423622 1:164660096-164660118 AAGGAAAATGAGGAGGGGTTGGG + Intronic
916485312 1:165253648-165253670 AAGGGCAAGGAGGACTGGTGTGG - Intronic
917191640 1:172424679-172424701 AAGAACAAGGAGGCCGGGCACGG - Intronic
918179499 1:182074127-182074149 AAGAAGAAGGAGGAGGAGGGTGG + Intergenic
918356149 1:183707865-183707887 AAGGAAAAAGAGGTGGGGTGGGG + Intronic
918398289 1:184138129-184138151 AAGAGCAAGGAGGCCAGGTGTGG - Intergenic
918638780 1:186812661-186812683 AAGAAAAATGAGGAGGGCTGTGG + Intergenic
918968955 1:191387930-191387952 AAGTACAAAGAGAAGTGGTGTGG + Intergenic
919552049 1:199002803-199002825 AGAAACAAGGAGGAGGTGAGGGG + Intergenic
919947250 1:202328616-202328638 AAGGACAAGGAAGAGGTGTGGGG - Intergenic
920127181 1:203702583-203702605 AAGAACAAAGAAGGGAGGTGGGG - Intronic
920250855 1:204621353-204621375 AAGAACAAGTAGGAGTTGTCTGG - Exonic
920442271 1:205989147-205989169 GAGAGGATGGAGGAGGGGTGAGG - Intronic
920574284 1:207046115-207046137 AAGAGAAAGGAAGAAGGGTGGGG + Exonic
920663399 1:207939287-207939309 AGGAACAAGTAGGAGGTGGGTGG + Intergenic
920737317 1:208544668-208544690 AGGAATAAGGAGGAGTGGGGTGG + Intergenic
920760975 1:208783446-208783468 GAAAACAAGGAGGCCGGGTGTGG - Intergenic
920963140 1:210681594-210681616 AGGACTAAGGAGGTGGGGTGGGG + Exonic
921037528 1:211396079-211396101 ATGGAAAAGGAGGACGGGTGTGG - Intergenic
921490479 1:215769843-215769865 AAGAACCAGGAGGATGAGAGTGG + Intronic
921606130 1:217157421-217157443 AAAAACAAAAAGGAGGTGTGTGG - Intergenic
922023631 1:221730071-221730093 AAGGAGAAAGAGGAGGGGTGGGG - Intronic
922317547 1:224456209-224456231 AAGAAGCAGGAGGTGGTGTGAGG - Intronic
922493159 1:226034904-226034926 AAGAAAAAGCAGAAGGGCTGAGG - Intergenic
922662974 1:227446492-227446514 GAGTAGAAGCAGGAGGGGTGAGG + Intergenic
922707959 1:227800345-227800367 AAGGAGAAGGAGGGGGGCTGGGG - Intergenic
922867873 1:228875940-228875962 AATAATAAGGAGGAGGAGGGAGG - Intergenic
922880343 1:228975737-228975759 AGGGACAAGGAGGTGGGGAGGGG - Intergenic
922936294 1:229425713-229425735 AAGAAAGAGGAGGAGGGGGGAGG + Intergenic
923072353 1:230577592-230577614 AAGAAGGAGGAGGAGGGGTAGGG - Intergenic
923072434 1:230577883-230577905 AAGAAGAAGGAGAAGGGGAAGGG - Intergenic
923548738 1:234944189-234944211 AAGGACAAGGAGGAGGAAGGAGG + Intergenic
923869304 1:237973692-237973714 AAGAACAAGGAGAAAGGAAGGGG - Intergenic
923927985 1:238657908-238657930 AGGAGGAAAGAGGAGGGGTGAGG + Intergenic
923963598 1:239110257-239110279 ATGAACAATGGGGAGGGGTGGGG + Intergenic
924411898 1:243814868-243814890 AAGGACAATTAGGAGGTGTGTGG + Intronic
924453579 1:244200132-244200154 AAAAAAAAGGAGGTGGGCTGTGG + Intergenic
924608668 1:245556296-245556318 AAGAAGGAGGAGGAGGAGGGAGG - Intronic
924608669 1:245556299-245556321 AAGAAGAAGGAGGAGGAGGAGGG - Intronic
924634334 1:245771264-245771286 AAGAAGAAGGATGAGGGATAAGG + Intronic
924644803 1:245867713-245867735 AAAAACAAGGAAGAGGGATGGGG + Intronic
924735009 1:246747911-246747933 AAGAACAAAGAACAGGGGAGCGG + Intronic
924748649 1:246863286-246863308 AGGGACAATGGGGAGGGGTGAGG + Intronic
1062789010 10:289649-289671 AAGAAGGAGGATGAGGGGTAGGG + Intronic
1062879424 10:966162-966184 AAGAAGAAGGAGGCTGGGTGTGG + Intergenic
1062936556 10:1394896-1394918 AAGAAGAAGGAGGAGGAGGGAGG - Intronic
1063057224 10:2518964-2518986 AAGAAGAAGAAGAAGGGGGGGGG + Intergenic
1063057225 10:2518967-2518989 AAGAAGAAGAAGGGGGGGGGAGG + Intergenic
1063159508 10:3408955-3408977 AAGAAAGAGGAGGAGGAGGGAGG + Intergenic
1063287968 10:4711310-4711332 AAAAGCAAGGAGCAGGCGTGTGG + Intergenic
1063354474 10:5385285-5385307 AAGATAAAGGAAGTGGGGTGGGG - Intergenic
1063372078 10:5528580-5528602 AACACCAAGGGGGAGGGGAGGGG - Intergenic
1063440792 10:6071417-6071439 AAGAGGAAGGAGGAGGGAGGAGG - Intergenic
1063505055 10:6590274-6590296 AAGAACAAGCAGGAGTGGTGAGG + Intergenic
1063505687 10:6597036-6597058 AACAAGAAGGAGGAGGTATGAGG + Intergenic
1063621037 10:7649314-7649336 AAGAAGAAGGAGGAGGAGGAGGG - Intronic
1063857924 10:10275594-10275616 AAGAACAAGGGGAAGGGGGAAGG - Intergenic
1064213618 10:13381535-13381557 AAGGAAAAGGAGGCTGGGTGTGG + Intergenic
1064813778 10:19232815-19232837 AAGAGCAAGAAGCAGGGTTGGGG - Intronic
1064834994 10:19516729-19516751 AAGAACAAGGAAGAAGGAAGAGG - Intronic
1065064693 10:21949391-21949413 AAGAAGAAGGGGGTGGGGGGAGG - Intronic
1065382867 10:25107598-25107620 AAGAACAAGCAGGAAGGCTGTGG - Intergenic
1065589757 10:27252473-27252495 AAGAGCGAGGAGGAGGAGTACGG - Intergenic
1065655659 10:27946738-27946760 CATAAGAAGGAGGAGGTGTGTGG - Intronic
1065830960 10:29613190-29613212 AAGAAGAAGGAGGAGGGATGCGG + Intronic
1065940672 10:30561780-30561802 AAAAAAAAGGGGGGGGGGTGGGG - Intergenic
1066264424 10:33761923-33761945 AAGAAAAAGGAGGAGGTGCCAGG - Intergenic
1066357306 10:34697465-34697487 AAGACCCTGGAGCAGGGGTGCGG + Intronic
1067312632 10:45128662-45128684 ATAAGCAAGGAGGATGGGTGGGG + Intergenic
1067365081 10:45619524-45619546 AAGAACAAGTGGAAGGAGTGAGG + Intronic
1067557813 10:47284874-47284896 AGGAAGAAGGAGGAGGAGGGAGG + Intergenic
1067557819 10:47284894-47284916 AGGAAGAAGGAGGAGGAGGGAGG + Intergenic
1067653369 10:48173346-48173368 AAGAACGAGGAGGGGAAGTGAGG - Intronic
1067833537 10:49623916-49623938 AAGAACAAGGAAGGAGGTTGTGG - Intronic
1067902330 10:50255238-50255260 AAGAAGAAGTAGGAAGGGGGAGG + Intergenic
1067973000 10:50992529-50992551 ATGAAGAAGGCGGAGGGGTGAGG + Intronic
1068499039 10:57819829-57819851 CTGAAGAAGGAGGAGTGGTGGGG + Intergenic
1068643423 10:59437137-59437159 AAGAGAGAGGATGAGGGGTGAGG - Intergenic
1068702588 10:60035697-60035719 AAGAAAAAAAAGGCGGGGTGCGG + Intronic
1068765391 10:60757713-60757735 AGTATCAAGGGGGAGGGGTGGGG - Intergenic
1068803753 10:61171666-61171688 AAGAAAAATGAGGAGGGGACTGG + Intergenic
1069369007 10:67724134-67724156 AACACCAGGGAGCAGGGGTGAGG - Intergenic
1069555103 10:69392610-69392632 AATAACAAGGGGGTGGGGTGAGG + Intronic
1069668738 10:70183598-70183620 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
1069677586 10:70259701-70259723 GAGAACAAGGAGGAGGGGATGGG + Intronic
1069834820 10:71301860-71301882 AAGAACAGGGAGGAGGGGCACGG - Exonic
1069926432 10:71853746-71853768 AAAAAAAAAAAGGAGGGGTGTGG - Intergenic
1069987957 10:72297208-72297230 AAGAACATGGAGGCAGGGCGCGG - Intergenic
1070205145 10:74251278-74251300 AAGAGAAAGGAGGAGGAGTAGGG + Intronic
1070247321 10:74744551-74744573 AAGAATGAGGAGAAGTGGTGCGG - Intergenic
1070314105 10:75294705-75294727 AGGAAGAGAGAGGAGGGGTGGGG + Intergenic
1070332596 10:75429110-75429132 AAGGAGAAGGAGGAGGGGAAAGG - Intergenic
1070332598 10:75429116-75429138 AAGAACAAGGAGAAGGAGGAGGG - Intergenic
1070763857 10:79045147-79045169 AAGCTGAAGGAGGAGGGATGAGG + Intergenic
1070911838 10:80125723-80125745 CAGAACGGGGAGGATGGGTGGGG + Intergenic
1071702539 10:87955590-87955612 AAGAAAGAGAAGGAGTGGTGGGG + Intronic
1071807741 10:89142766-89142788 AAGAGAAAGGAGAAGGGGAGGGG + Intergenic
1071821553 10:89285810-89285832 AGGAACATGGGGAAGGGGTGGGG - Intronic
1072002378 10:91209464-91209486 AAGAAAAAGGAGGCCGGGCGCGG + Intronic
1072329224 10:94330173-94330195 AAGGTCATGGAGGAGGAGTGGGG - Exonic
1072918778 10:99558065-99558087 AAAAAAAAGGAGGCTGGGTGTGG - Intergenic
1073045298 10:100634244-100634266 AAGGACAAGGTGAAGGGCTGTGG - Intergenic
1073103293 10:101018346-101018368 AAGGACGAGGGGCAGGGGTGTGG + Intronic
1073308478 10:102522427-102522449 GAGAGAAAGGAGGAGGCGTGTGG - Intronic
1074126787 10:110534956-110534978 AAGAAGGAGGAGGAGGGGAGGGG + Intergenic
1074538108 10:114343470-114343492 GAGACAAAGGAGCAGGGGTGAGG - Intronic
1074697182 10:116059984-116060006 AAGAACAAGGTGGTGGAGGGAGG + Intronic
1074810804 10:117103379-117103401 ATGAACAACGAGGCTGGGTGTGG - Intronic
1074823463 10:117198278-117198300 AAGACCTGGGGGGAGGGGTGGGG + Intronic
1074853345 10:117456006-117456028 AAGAGCAAGCAGGAGGGGGTGGG + Intergenic
1074957269 10:118404419-118404441 AAGAACAGAGACGGGGGGTGGGG - Intergenic
1075544584 10:123345340-123345362 AAGTAAAAGAGGGAGGGGTGAGG + Intergenic
1075589037 10:123678295-123678317 AAGGTCTAGGAGGAGGGGTGGGG - Intronic
1075825878 10:125356729-125356751 CAGAGCAGGGAGGAGGGGAGAGG - Intergenic
1075867960 10:125743784-125743806 CAGACCAAGGAGGCGGTGTGAGG + Intronic
1076260040 10:129058111-129058133 GAGATCAAGCAGCAGGGGTGCGG - Intergenic
1076490760 10:130859731-130859753 ATGCACAAGGAGGCCGGGTGTGG + Intergenic
1076989817 11:267234-267256 AGGAGCAAGGAGGAGGAGTGAGG + Intergenic
1076989921 11:267504-267526 AGGAGCAACGAGGAGGGGGGAGG + Intergenic
1077239477 11:1503034-1503056 AAGCACAGTGAGGCGGGGTGCGG + Intergenic
1077308616 11:1878736-1878758 CAGAACAGGGAGCAGGGCTGGGG - Intronic
1077323949 11:1955496-1955518 GAGAAGAGGGAGGAGGAGTGAGG - Intronic
1077392510 11:2306739-2306761 ACGAAGAAGGAGGAGGGCAGAGG + Intronic
1077998899 11:7477008-7477030 AAGAAGAAGAAGGAGGGAAGAGG + Intergenic
1078192827 11:9106572-9106594 AAGAGCAAGGAGCAAGGGGGAGG + Intronic
1078355168 11:10627527-10627549 AAGTCTAAGGTGGAGGGGTGGGG - Intronic
1078361363 11:10670601-10670623 AAGAACTAGGAGGAGTATTGGGG - Intronic
1078366401 11:10710179-10710201 AAGAAGGAGGAGGAGGAGTGGGG + Intergenic
1078659664 11:13277272-13277294 AAGAAGAAGGAGGAGGGGTGAGG + Intronic
1078678691 11:13453761-13453783 AAGAAGAAAGAGGCTGGGTGCGG + Intronic
1079299717 11:19267181-19267203 AGGAACAAGGAGGAGGGAAGAGG - Intergenic
1079360305 11:19765418-19765440 AAGAAGGAGGAGGAGGAGAGAGG - Intronic
1079501507 11:21105881-21105903 AAGAATAAAGAGGAGAGGAGAGG - Intronic
1079528187 11:21415745-21415767 AAGCAAAAGGAGAAGGGCTGGGG + Intronic
1079686814 11:23369235-23369257 AAGAAAAAGGAGGCTGAGTGTGG - Intergenic
1079689298 11:23402440-23402462 TAGAGCAGGGAAGAGGGGTGAGG - Intergenic
1080478368 11:32619863-32619885 AAGGAGAAGGAGGAGGGGGAGGG + Intronic
1080527763 11:33144117-33144139 AAAAAAAAGGGGGAGTGGTGGGG - Intronic
1080767326 11:35308989-35309011 AAGAAAAAGGAGGCTGTGTGAGG - Intronic
1081060590 11:38470566-38470588 AAGAAAAAGGAGGAGGGGAAGGG - Intergenic
1081135759 11:39438484-39438506 AAGAAAAAAGAGGCCGGGTGCGG - Intergenic
1081286671 11:41278974-41278996 TAGAACAGGGAGGATGGGAGAGG - Intronic
1081461355 11:43275414-43275436 AAGAACCATGAGGAAGCGTGGGG + Intergenic
1081953915 11:47072113-47072135 GAGAACAAAGATGAAGGGTGAGG - Intronic
1082123182 11:48402541-48402563 AAGAACAAGCACAAGGGGTCAGG + Intergenic
1082733702 11:56831766-56831788 AAGAAGGAGGAGGAAGGGAGGGG + Intergenic
1082757916 11:57096455-57096477 AAGAAAAAAGAGAAGGGGTCTGG - Intergenic
1082764901 11:57159571-57159593 AAGCACATGGAGGCTGGGTGCGG + Intergenic
1082920956 11:58493269-58493291 AAGAAAAAGGAGGCTGGGGGCGG + Intergenic
1082952055 11:58827860-58827882 AAAAAGAAGGAGGCCGGGTGCGG - Intergenic
1083024383 11:59537634-59537656 AAAAAAAAGGAGGAGGGAAGGGG + Intergenic
1083179897 11:60978440-60978462 AGGAACCTTGAGGAGGGGTGAGG + Intronic
1083247635 11:61441872-61441894 AAAAAAAGGGAGGAGTGGTGGGG - Intronic
1083326307 11:61874723-61874745 AGGGACAGGGAGGAGGGGAGAGG - Intronic
1083334215 11:61913408-61913430 GAGACCATGGAGGAGGAGTGGGG + Intronic
1083570606 11:63760121-63760143 TAGAAGAATGAGGAGGGGTCAGG + Exonic
1083740891 11:64711361-64711383 AAGAACAGGGACGAGGGGCGGGG + Intronic
1084104873 11:66974975-66974997 GAGGAGAAGGAGGAGGGGGGAGG + Intergenic
1084128109 11:67114414-67114436 ATGAACATGGAGGAGGGGGTGGG + Intergenic
1084164001 11:67366745-67366767 AAGAAAAGGGAGGAGGGTGGCGG - Intronic
1084331475 11:68432984-68433006 AAGCACAGGCAGGAGGGCTGAGG - Intronic
1084563935 11:69919130-69919152 AAGAACAAGGAAGTGGGGCCTGG - Intergenic
1084787526 11:71452028-71452050 ACGTCCAAGGAGGAGGGGTTGGG - Intronic
1085074059 11:73573956-73573978 AATACCAAGGGGCAGGGGTGGGG + Intronic
1085095786 11:73760193-73760215 AAGAGCAAGGAATAAGGGTGGGG + Intronic
1085462393 11:76701996-76702018 CAGAACGAGGAGAAGGGTTGGGG + Intergenic
1085502890 11:77039180-77039202 AAGGACAAGGAAGAAGGCTGGGG + Intronic
1085542889 11:77289007-77289029 AAGAAACAGAAGGAGGGGAGGGG + Intronic
1086263922 11:84975105-84975127 ATGGGTAAGGAGGAGGGGTGGGG + Intronic
1086366929 11:86116500-86116522 GAGAACAAGTAGGGGGGTTGTGG + Intergenic
1086378896 11:86230614-86230636 AATGACAAAGAGCAGGGGTGTGG + Intergenic
1086446627 11:86877861-86877883 AAAAAAAAAGAGGTGGGGTGGGG + Intronic
1086518884 11:87646414-87646436 AAGAAGAAGGAGGAAAGGAGAGG - Intergenic
1087237223 11:95733477-95733499 GAGGAAATGGAGGAGGGGTGGGG - Intergenic
1087443928 11:98222005-98222027 AAGAACAAGGAGGTGGGGTGCGG - Intergenic
1087534462 11:99425502-99425524 AGGGACAAGGTGGTGGGGTGGGG + Intronic
1088592323 11:111414452-111414474 AAGATGAAAGAGGAGGGGAGAGG - Intronic
1088897880 11:114091763-114091785 AAAAACAAGGGGAAGGGGAGTGG - Intronic
1089264882 11:117251613-117251635 AAGAAAAAGTAGCAGGGGTCAGG + Intronic
1089503395 11:118946536-118946558 TGGAACATGGAGGAGAGGTGTGG - Intronic
1089610076 11:119664183-119664205 AAGAGGTAGGGGGAGGGGTGCGG - Exonic
1089723392 11:120450960-120450982 GAGGAGATGGAGGAGGGGTGAGG - Intronic
1089769533 11:120793414-120793436 AAGAAGAAGGAGGCCTGGTGAGG + Intronic
1090408630 11:126492543-126492565 AAGGAGGAGGAGGAGGGATGAGG + Intronic
1090520637 11:127475344-127475366 CAGAAAAAGGAAGAGGGGAGAGG - Intergenic
1090528600 11:127564666-127564688 AAGAATAAGGAGGCGGGGAGGGG - Intergenic
1090679125 11:129034496-129034518 AGAAAGAAAGAGGAGGGGTGGGG - Intronic
1090838841 11:130472674-130472696 GAGGAGGAGGAGGAGGGGTGGGG - Intronic
1090943075 11:131405742-131405764 CAGACCACAGAGGAGGGGTGTGG - Intronic
1091007297 11:131965043-131965065 AAGAAAAGGGAGGATGTGTGGGG + Intronic
1202806935 11_KI270721v1_random:10691-10713 GAGAAGAGGGAGGAGGAGTGAGG - Intergenic
1091446704 12:547910-547932 AAGAGCAAGGAGAAGGGATGAGG + Intronic
1091792272 12:3278757-3278779 AACCATGAGGAGGAGGGGTGTGG - Intronic
1091905106 12:4179375-4179397 ATGAAGAAGAAGGAGGGGAGGGG + Intergenic
1091994091 12:4979087-4979109 GAGGCCAGGGAGGAGGGGTGCGG + Intergenic
1092008698 12:5090514-5090536 AACAAAAAGGAGGTGGGGTGGGG - Intergenic
1092049673 12:5459250-5459272 AGGGTCAAGGAGGAAGGGTGTGG - Intronic
1092134568 12:6137674-6137696 AAAAACAAAGAGGCTGGGTGCGG - Intergenic
1092170928 12:6373776-6373798 CAGAACAAGGAGAATGGGTCAGG - Intronic
1092461684 12:8692722-8692744 AGGGAAAAGGAGGAGGGATGTGG + Intronic
1092774201 12:11928262-11928284 AAGGACAAGGACGCAGGGTGTGG - Intergenic
1092957061 12:13560795-13560817 AAAATCAAGGAGGAGGGTTGGGG + Exonic
1093057870 12:14572803-14572825 AAAAAGAAGAAGCAGGGGTGAGG - Intergenic
1093084579 12:14852466-14852488 AAGAAGAAGGAGGAGGAGGAGGG - Intronic
1093206258 12:16254313-16254335 AAGGACTAGGAGGAGTGGGGAGG + Intronic
1094083846 12:26566546-26566568 AAGGATAAGGAGGAGAGGAGAGG + Intronic
1094129893 12:27063500-27063522 AAGAAGAAGGAGGAGGAGGAAGG - Intronic
1094443829 12:30508091-30508113 AAGAACAAAGAGGAGGATGGAGG - Intergenic
1094628261 12:32146923-32146945 AAGAAGAAGGAGGAGGAAGGAGG - Intronic
1094821788 12:34231804-34231826 AAAAAAAAGTAGGGGGGGTGGGG + Intergenic
1095379539 12:41573528-41573550 AAGATCAAGGAAGAGCGGAGTGG + Exonic
1095827923 12:46549506-46549528 AAAAAAAAGGAGGTGGGGGGTGG + Intergenic
1096052650 12:48624597-48624619 CAGAACAAGGACCAAGGGTGTGG - Intergenic
1096215289 12:49795023-49795045 AAGAACAAGGAGGGGGCTGGCGG - Exonic
1096251799 12:50038233-50038255 AAATACAAGGATGAGGGGAGAGG - Intergenic
1096330006 12:50702748-50702770 AAAAAAAAAAAGGAGGGGTGGGG + Intronic
1096356872 12:50948852-50948874 CAGAGCGAGGAGGAGGGGGGAGG + Intergenic
1096366563 12:51033261-51033283 AAAAAGAAGGAGGAGGGGTGGGG - Intergenic
1096528419 12:52228133-52228155 AAGAAGAAGGAGGAGGGGGAGGG - Intergenic
1096550614 12:52369595-52369617 AAGAACCTGGAGGAGGGCAGAGG - Intergenic
1096553746 12:52390774-52390796 GGGAACAAGGAGGAGCTGTGTGG + Intergenic
1096592142 12:52667316-52667338 AAGATCAAGGAAGACGGCTGAGG - Intergenic
1096617488 12:52842146-52842168 AAGAACCAGGAGGATGGTTCTGG + Intronic
1096771516 12:53938774-53938796 AAGCACTAGGAGGAGGGGAGGGG + Exonic
1096792919 12:54056167-54056189 AAGAACAAGCAAGGGGGTTGGGG + Intergenic
1097744445 12:63285755-63285777 GAGAACAAGGTGGAGGTGAGTGG - Intergenic
1097876950 12:64652411-64652433 AAGAAAGAGGAGGGGGGGAGGGG - Intronic
1098194938 12:67989729-67989751 AAGAAGAAGGAGGAAGGCTGGGG + Intergenic
1098495882 12:71135285-71135307 AAGAAGAAGGAGGAGGGGGAGGG + Intronic
1098597157 12:72287182-72287204 AAGAACAAGGATGATGGGGGAGG - Intronic
1098952094 12:76650244-76650266 AAGAAAATGAAGGAGGAGTGAGG - Intergenic
1099398440 12:82170985-82171007 AAAAAGAAGGAGGAGGAGGGAGG + Intergenic
1099636490 12:85220786-85220808 AAAAACAGGGGGGAGGGGGGAGG - Intronic
1099742945 12:86665050-86665072 TAGAACAAGGTGGTGGGGGGAGG - Intronic
1100211446 12:92402571-92402593 AAGAAGGAGGGGGAGAGGTGAGG - Intergenic
1100460811 12:94797499-94797521 AAATACAAGGAGGGGAGGTGTGG - Intergenic
1100602065 12:96120661-96120683 AAGATGGAAGAGGAGGGGTGGGG + Intergenic
1101302178 12:103494507-103494529 AAAAAGGAGGAGGATGGGTGGGG + Intronic
1101386362 12:104261451-104261473 AAGAACAAGGGGGACGGGCATGG - Intronic
1101421030 12:104551267-104551289 AAGACCCAGAAGGAGGTGTGGGG + Intronic
1101590586 12:106121754-106121776 AAAAAAAAGGTGGGGGGGTGTGG + Intronic
1101671394 12:106878062-106878084 AAGCACAATGATGAGGGCTGAGG + Intronic
1101845295 12:108358660-108358682 AAGAAGAAAGAGAAGGGCTGGGG + Intergenic
1102001559 12:109560974-109560996 AGGAACAAGGGGGAGGGGGGAGG - Intronic
1102167844 12:110820695-110820717 AAGAAGAAGAAGGAGGGGACTGG - Intergenic
1102167957 12:110821025-110821047 AAGAAGAAGGTGGAGGGGGAGGG - Intergenic
1102188103 12:110965401-110965423 AAAAAAAAGGGGGGGGGGTGTGG - Intergenic
1102460011 12:113094155-113094177 AGAACCCAGGAGGAGGGGTGAGG - Intronic
1102655623 12:114480334-114480356 AAGAAAAAAGGGGTGGGGTGAGG + Intergenic
1102666493 12:114578380-114578402 GAGAACAAGGTGGAGGGCAGAGG - Intergenic
1102808081 12:115799656-115799678 AAGAAGAAGAAGGGGGGGTTGGG + Intergenic
1102866987 12:116382319-116382341 AAGAGGAAGGAGGAGGGAAGAGG + Intergenic
1102913482 12:116736754-116736776 AACAGCAAGGAGCACGGGTGGGG - Intronic
1102959684 12:117084646-117084668 CAGAACAGGGAGGATGGGAGGGG + Intronic
1103100342 12:118169312-118169334 AAAAAAAAGGGGGGGGGGTGGGG - Intronic
1103288736 12:119826242-119826264 AGGAACAAGGGTTAGGGGTGAGG - Intronic
1103368229 12:120398521-120398543 AAGAGCAGGGAGGTGGGGAGAGG - Intergenic
1103408907 12:120696561-120696583 CTGAACAGGGTGGAGGGGTGTGG + Exonic
1103558884 12:121781802-121781824 AAGCACTAGGAGGAGGGTGGTGG + Exonic
1103954614 12:124569109-124569131 CAAAACAAGGAGGTGGGGGGGGG - Intergenic
1104088121 12:125493966-125493988 GAGAAGAGGGAGGAGGGATGCGG - Intronic
1104159381 12:126163792-126163814 AAGAAGGAGGAGGAGGAGAGAGG + Intergenic
1104402421 12:128487240-128487262 TAGAACAAGGAGGATGGGTGAGG - Intronic
1104565928 12:129883050-129883072 AAGGGAAAGAAGGAGGGGTGTGG + Intronic
1104613938 12:130253283-130253305 CAGCACAAGGAGGCAGGGTGAGG + Intergenic
1104615280 12:130262857-130262879 AGGAACAAAGAGGAGGGAGGCGG + Intergenic
1104707889 12:130961433-130961455 GAGAAAATGGAGGAGGGGTGGGG - Intronic
1104849486 12:131864777-131864799 AAAAACAAGCAGGCCGGGTGCGG + Intergenic
1105258276 13:18759655-18759677 AAAAACAAGTAGGTAGGGTGGGG - Intergenic
1105414321 13:20195157-20195179 GAGGAGAAGGAGGAGAGGTGAGG + Intergenic
1105753616 13:23444687-23444709 AAAAACAAGGAGAACTGGTGTGG + Intergenic
1106308449 13:28533040-28533062 AAAAACTAGGAGGTGGGGGGCGG + Intergenic
1106322591 13:28656012-28656034 AAGAGCTAGGAGGAGGGAGGAGG + Intergenic
1107246693 13:38305317-38305339 AAGAAGAAAGAGGCTGGGTGTGG - Intergenic
1107758489 13:43651246-43651268 AAGAAAAAGGAAGAGGGGGAGGG + Intronic
1108269860 13:48748953-48748975 CAGAACAAGCAGCAGGTGTGAGG - Intergenic
1108869716 13:54968698-54968720 AAGAAGAAGAAAGAGGGTTGGGG - Intergenic
1109049322 13:57458276-57458298 AAGAGCAAGGAGAAGGGATGAGG + Intergenic
1109332892 13:60952308-60952330 AAAAAAAAGGAGGAGGGTGGAGG - Intergenic
1110244241 13:73303658-73303680 AAGAAGAAGGAGGAGGAGCTAGG - Intergenic
1110261280 13:73487865-73487887 AAGAGCAATGAGGAGAGGTGAGG + Intergenic
1110570454 13:76997126-76997148 AACAACAAAAAGGCGGGGTGGGG - Intronic
1110700383 13:78540620-78540642 AAGAAGAAGGAGGATGGGGAGGG - Intergenic
1110754173 13:79152297-79152319 GAGAAAAAGGAGGAGGGTGGTGG - Intergenic
1110855940 13:80296809-80296831 AATAACAAGAAGGAAGGGGGCGG + Intergenic
1111398266 13:87697094-87697116 ACCAACAAGAAGGAGGGGCGGGG + Intergenic
1111542358 13:89685755-89685777 AAGAAAAACGTGGAGGGGTCTGG - Intergenic
1111598520 13:90441985-90442007 AAGGAGAAGGAGGAGGGCTTTGG - Intergenic
1111961544 13:94816138-94816160 AAGAATTAGGAGGAGGGGCCAGG + Intergenic
1112046748 13:95604729-95604751 AATAACAAAGTGGAGGGGTGGGG + Intronic
1112308340 13:98295553-98295575 AAGAACATGGGGGAGGAGAGGGG - Intronic
1112458237 13:99580996-99581018 AAGAACAAATAGGCTGGGTGTGG - Intergenic
1112467764 13:99658630-99658652 AGGAACAAGGAGGTGGGGTGGGG + Intronic
1112492378 13:99879056-99879078 AACAACAGGGAGGAGAGCTGAGG - Intronic
1112536545 13:100262689-100262711 AAGAAGGAGGAGGGGGGGAGAGG - Intronic
1112584509 13:100706305-100706327 AAGAAGAAAGAGAAGGGGAGAGG - Intergenic
1112603089 13:100876266-100876288 AGGAAAAAGGAGGAAGGGAGAGG - Intergenic
1113613293 13:111663317-111663339 AGGAAGAAGGAGGAGGGGAAGGG - Intronic
1113668160 13:112155006-112155028 AGCAACAGGAAGGAGGGGTGTGG + Intergenic
1113757642 13:112824600-112824622 AAGAGCAGGAAGGAGGGGTGTGG - Intronic
1113777139 13:112954300-112954322 TGGAGCAGGGAGGAGGGGTGTGG - Intronic
1113898838 13:113784548-113784570 AAGAAGAAGGAGGAGAAGGGAGG + Intronic
1114201220 14:20522572-20522594 AAGGAGAAGGAGGAGGAGGGAGG + Intergenic
1114483177 14:23047858-23047880 AAGGACAGGGAGGAGGCCTGGGG + Exonic
1115344911 14:32332312-32332334 AATTAGAATGAGGAGGGGTGGGG - Intronic
1115659133 14:35474601-35474623 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1115664878 14:35534970-35534992 AAGATCAAGGAGGAGGAGCCCGG + Exonic
1115977599 14:39013718-39013740 AAGATCAAGGAAGAGGCGTTTGG - Intergenic
1116037538 14:39645508-39645530 AAGGATAAGGAGGAGGAGTGGGG + Intergenic
1116239161 14:42319206-42319228 AAAGATATGGAGGAGGGGTGGGG + Intergenic
1116628408 14:47297393-47297415 AAGAAGAAAGAGGAAGGGAGGGG + Intronic
1116676436 14:47911905-47911927 GACAATAAGGAAGAGGGGTGAGG - Intergenic
1116797575 14:49408261-49408283 AAGAAAAAGGAGGAGGAAAGAGG + Intergenic
1117106769 14:52405429-52405451 AAGAACAAAGAAGAAGGGTGGGG + Intergenic
1117348582 14:54858686-54858708 AAGAACAAGATGAAGGGGTCGGG - Intronic
1117687940 14:58274593-58274615 ATGAACATGGAGGCTGGGTGTGG + Intronic
1117729903 14:58711973-58711995 AAGAACAAAGATTATGGGTGAGG + Intergenic
1118077781 14:62319881-62319903 AAGAAGCAGAAGGATGGGTGAGG - Intergenic
1118798448 14:69167072-69167094 AAGAAAAAAGAGGCTGGGTGCGG + Intergenic
1118850859 14:69582298-69582320 AAGAAAAAGGAGGGGGGGCTAGG - Intergenic
1119157250 14:72422611-72422633 TTGGACAAGGACGAGGGGTGAGG - Intronic
1119611926 14:76070768-76070790 AGGAGCAAGAGGGAGGGGTGGGG - Intronic
1119947565 14:78711003-78711025 AAGAAGAAGTATGGGGGGTGTGG - Intronic
1119977843 14:79045225-79045247 GAGATGAAGAAGGAGGGGTGTGG - Intronic
1120076905 14:80169271-80169293 AAGAATAAGAACGAGGGGTGTGG - Intergenic
1120162594 14:81161834-81161856 AATAAAAAGGAGGAGGGCTTGGG + Intergenic
1120762530 14:88298497-88298519 AATTACGAGGAGGAGAGGTGGGG - Intronic
1120872092 14:89347007-89347029 AAGAACAAAATGGTGGGGTGGGG - Intronic
1120886255 14:89454011-89454033 AAGAAGAAGAAGGACTGGTGTGG + Intronic
1120904920 14:89611940-89611962 AAGAAAAAGCAGGATGGGTTGGG - Intronic
1121085011 14:91139251-91139273 GAGAACAAGGAGGAGGAGGAAGG - Intronic
1121109624 14:91303507-91303529 TAGAGCCTGGAGGAGGGGTGGGG - Intronic
1121558171 14:94854309-94854331 AACAACATGCAGGTGGGGTGTGG - Intergenic
1121832762 14:97066121-97066143 AAGAAAGAGGAGGAGGAGGGAGG - Intergenic
1121973769 14:98383346-98383368 AATAACAAGGATGTGGGGGGTGG + Intergenic
1122038652 14:98966220-98966242 AATATCAAGGAGGAGGTGTGGGG - Intergenic
1122077121 14:99243188-99243210 AATAACAAGGAGCTGGGGTGGGG + Intronic
1122103797 14:99435730-99435752 AAAAAAAAGGTGGGGGGGTGGGG - Intronic
1122360035 14:101153641-101153663 AAGAAGAAGGAAGAGGACTGGGG - Intergenic
1122403941 14:101487185-101487207 AAAAACATGAAGGATGGGTGGGG - Intergenic
1122428257 14:101624010-101624032 GAGAACCAGGATGTGGGGTGAGG - Intergenic
1122623044 14:103070603-103070625 CAGAACAAAGAGGAGGAGAGAGG - Intergenic
1122648571 14:103211439-103211461 AAGAACAATGTGGCCGGGTGCGG - Intergenic
1122733461 14:103820081-103820103 AAAAACAAGGGGGAGGGGCAGGG + Intronic
1122786637 14:104167100-104167122 GAGAAGACGCAGGAGGGGTGAGG + Intronic
1123221422 14:106860397-106860419 GAGAAAAAGGAGGAGGGGTTGGG - Intergenic
1202879811 14_KI270722v1_random:47260-47282 AAGAACAAGCAGGCCGGGTGCGG + Intergenic
1123419851 15:20122856-20122878 AAGAAAACGGAGGAGAGGAGGGG - Intergenic
1123446009 15:20330676-20330698 AAGAAAACGGAGGAGAGGAGGGG + Intergenic
1123449034 15:20349058-20349080 AGGCACAAGGAGGAGGCTTGCGG + Intergenic
1123529073 15:21129392-21129414 AAGAAAACGGAGGAGAGGAGGGG - Intergenic
1123970342 15:25502709-25502731 AAGAAAGAGTGGGAGGGGTGAGG - Intergenic
1124082469 15:26514485-26514507 AAAAAAAAGGGGGGGGGGTGGGG + Intergenic
1124139368 15:27063892-27063914 AGGCAAAAGGAGAAGGGGTGTGG - Intronic
1124459631 15:29877610-29877632 AAGAAGAAGGAGGAGGAGGAGGG - Intronic
1124639732 15:31390169-31390191 AGGGACAAGGAGTGGGGGTGCGG - Intronic
1124720069 15:32104189-32104211 AAGAACAGAGGGGAGGGGAGAGG - Intronic
1124791267 15:32729594-32729616 AATAACAAGGAGGTGAGGTGAGG - Intronic
1124879514 15:33628305-33628327 AGGAAGAGGGAGGAGGGCTGGGG + Intronic
1124920634 15:34022895-34022917 AAGAACAATGAGGCCGGGCGCGG + Intronic
1125024816 15:35019522-35019544 AAGAAGGAGGAGGAGGAGGGAGG - Intergenic
1125323801 15:38515774-38515796 AAAAAAAAGGGGGGGGGGTGCGG - Intronic
1125487024 15:40118615-40118637 ATGAAAGTGGAGGAGGGGTGGGG - Intergenic
1125732634 15:41901974-41901996 AAGAGCAGGGAGTAGGGCTGGGG + Intronic
1125891962 15:43273711-43273733 GAGAAGGAGGAGGAGGGGAGGGG + Intergenic
1126477917 15:49085897-49085919 TAGAAAATGGAGGAGGGGAGAGG + Intergenic
1126580191 15:50235842-50235864 CAGAGCAAGGGGTAGGGGTGGGG - Intronic
1126730941 15:51681644-51681666 AAGAGCCAGGAGGGTGGGTGTGG - Exonic
1126764161 15:51996690-51996712 AAGAAGAAGGAGGAGGAGGACGG - Intronic
1127276557 15:57450564-57450586 AACAACAATGAGGCTGGGTGGGG - Intronic
1127393997 15:58529033-58529055 AAGGAATAGAAGGAGGGGTGGGG - Intronic
1127446649 15:59070012-59070034 AAAAAGCAGGAGGTGGGGTGGGG - Intronic
1127469069 15:59274304-59274326 AAGAGGAAGAAGGAGTGGTGAGG - Intronic
1127901796 15:63346411-63346433 AGCATCCAGGAGGAGGGGTGGGG - Intronic
1128029611 15:64468302-64468324 AAGCAGAAGGAGGAGGAGAGAGG - Intronic
1128247127 15:66140723-66140745 AAGAAAAAGGAATAGGGGTGGGG + Intronic
1128335046 15:66780371-66780393 AAGCACAGGGAGGCGGGCTGGGG - Intronic
1128920021 15:71602099-71602121 AAGAACAGACAGGAGGGGTGAGG + Intronic
1129254228 15:74325047-74325069 AACAACGAAGAGGAGGGTTGGGG - Intronic
1129297596 15:74608484-74608506 ATGAACTAGGAGGGGGAGTGGGG + Intronic
1129310630 15:74706123-74706145 AAGAAAATGAAGGCGGGGTGCGG - Intergenic
1129765037 15:78159291-78159313 AAGAAAAAGGAGGAGGGGGTAGG - Intronic
1129913544 15:79247762-79247784 AAGAAGATGGGGCAGGGGTGTGG + Intergenic
1130620710 15:85459487-85459509 AAGAAAAAGCAGGCTGGGTGTGG - Intronic
1130678194 15:85973049-85973071 AAGTAGGAAGAGGAGGGGTGGGG + Intergenic
1130708849 15:86259787-86259809 AAGAGCAAGCAAGAGGGGAGGGG - Intronic
1130751433 15:86717207-86717229 GAGAACAAGGAGAAGGAGTGGGG + Intronic
1131111762 15:89768804-89768826 AATCACAAGAAGCAGGGGTGGGG - Intronic
1131123148 15:89835735-89835757 ACAAACAAGCAGGATGGGTGTGG + Intronic
1131139824 15:89968112-89968134 AAGAAGGAGGAGGAGGAGGGAGG + Intergenic
1131229088 15:90647231-90647253 AGGATTGAGGAGGAGGGGTGTGG - Intergenic
1131229096 15:90647257-90647279 AGGATTGAGGAGGAGGGGTGTGG - Intergenic
1131229122 15:90647341-90647363 AGGATTGAGGAGGAGGGGTGTGG - Intergenic
1131284836 15:91048185-91048207 AAGAAGAAGAAGGAGGGGGAGGG - Intergenic
1131289909 15:91098747-91098769 AAGATGAGGGTGGAGGGGTGAGG + Intergenic
1131620784 15:94065905-94065927 AAAAAAAAGGTGGGGGGGTGGGG + Intergenic
1131780912 15:95857700-95857722 GAAAACTAGGAGGTGGGGTGAGG + Intergenic
1132565434 16:620393-620415 AAAAAAAAGGAGGAGCTGTGTGG + Intronic
1132878319 16:2149917-2149939 TAGGACAAGCAGGAGGGTTGGGG - Intronic
1133963099 16:10511428-10511450 GAGAAAAAAGAGGACGGGTGCGG + Intergenic
1133981701 16:10637442-10637464 AGGAGGAAGGAGGAGGGGAGAGG + Intronic
1134287181 16:12872035-12872057 AAGAAGAAGGAGGAGGGGGGAGG - Intergenic
1134297564 16:12960743-12960765 AAGAAAAGGGAGGACAGGTGAGG - Intronic
1134650783 16:15907016-15907038 AAGACCATGGAGGAGTGGAGTGG - Intergenic
1134858050 16:17537157-17537179 AAGAACAAAGAGGTTGGGGGTGG + Intergenic
1135626497 16:23999581-23999603 AAGAACAAGAAGGATGACTGTGG - Intronic
1135631607 16:24039855-24039877 AAGACCAAGGAGGAGGGGGCTGG - Intronic
1135942428 16:26834220-26834242 AAGAAGAAGGAAGAGGAGGGAGG + Intergenic
1135963420 16:27016402-27016424 AAGAAGAAGGAGGAAGTGGGGGG - Intergenic
1136058011 16:27705199-27705221 AAGAAAATGGAGGCTGGGTGTGG - Intronic
1136162299 16:28428358-28428380 AAAAAAAAGGAGGCGGGGTGCGG - Intergenic
1136200667 16:28686631-28686653 AAAAAAAAGGAGGCGGGGTGCGG + Intergenic
1136217013 16:28800824-28800846 AAAAAAAAGGAGGCGGGGTGCGG + Intergenic
1136417321 16:30112101-30112123 AAGAGGACGGGGGAGGGGTGGGG + Intronic
1136452174 16:30359615-30359637 AAGAACAAGGAGGAGGGGTGGGG + Intronic
1136498519 16:30658458-30658480 AGGAAGAGGGAGGAGGGGTAGGG + Exonic
1136499742 16:30664411-30664433 GAGAACAAGGAGGGGTGGTGGGG - Exonic
1136720758 16:32317999-32318021 AAGAAAACGGAGGAGAGGAGGGG - Intergenic
1136839138 16:33524280-33524302 AAGAAAACGGAGGAGAGGAGGGG - Intergenic
1136956879 16:34798197-34798219 AAAAAGGAGGAGGAGGGGTATGG - Intergenic
1137525992 16:49236762-49236784 ATGAAGATGGAGGAGGGGGGTGG + Intergenic
1137556975 16:49477040-49477062 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
1137556991 16:49477122-49477144 AAGAAAAAGGAGGAGGAGGAGGG + Intergenic
1137862892 16:51864684-51864706 AATAACAAGAAGGAAGTGTGAGG + Intergenic
1138091165 16:54175795-54175817 AAGAAAGAGGGGGCGGGGTGGGG - Intergenic
1138229005 16:55324291-55324313 AGGGAGAAGGAGGAGGGGAGAGG - Exonic
1139844379 16:69909229-69909251 AAGTTCAAGGAGAAGGGGTTTGG + Intronic
1140088285 16:71815813-71815835 AAACAAAAGGAGGAGGGGAGGGG + Intergenic
1140117760 16:72057565-72057587 AAGAGCCAGGAGGAGGGATGTGG + Intronic
1140117981 16:72059280-72059302 AAGAGCCAGGAGGAGGGATGTGG + Intronic
1140119995 16:72075318-72075340 AAGAGCCAGGAGGAGGGATGTGG + Intronic
1140292610 16:73675089-73675111 AAGTATAAGGAGGAGGTGTTGGG - Intergenic
1140337419 16:74120903-74120925 CAGAACAATGAGGAGGGAAGGGG + Intergenic
1140358380 16:74324768-74324790 AAGAAAAAAAAGGCGGGGTGTGG + Intergenic
1140872784 16:79122272-79122294 AAGAAAAGGGAGGAGGTGGGAGG + Intronic
1141269114 16:82522828-82522850 AAGAACAAGAAGTGTGGGTGAGG - Intergenic
1141393322 16:83682644-83682666 CAGAGGAAGGAGGAGGAGTGAGG - Intronic
1141527135 16:84618536-84618558 AAGAAGAGGGAGGAGGAGAGAGG - Intergenic
1141603491 16:85139990-85140012 AAGAAGAAAGAGGAGCGGGGAGG + Intergenic
1141775722 16:86121612-86121634 AAGAAGGAGGAGGAGGGAGGAGG - Intergenic
1141775723 16:86121615-86121637 AAGAAGAAGGAGGAGGAGGGAGG - Intergenic
1141845116 16:86603371-86603393 AGGAAGAAGGAGGAGGGGGAAGG - Intergenic
1142341433 16:89525518-89525540 GAGGACAGGGATGAGGGGTGGGG - Intronic
1203005674 16_KI270728v1_random:199771-199793 AAGAAAACGGAGGAGAGGAGGGG + Intergenic
1203137224 16_KI270728v1_random:1735891-1735913 AAGAAAACGGAGGAGAGGAGGGG + Intergenic
1203149303 16_KI270728v1_random:1824567-1824589 AAGAAAACGGAGGAGAGGAGGGG - Intergenic
1142859392 17:2751709-2751731 AAGAGACAGGAAGAGGGGTGAGG - Intergenic
1143150476 17:4804872-4804894 AAGAAAAAGAAGGCGGGGCGCGG - Intergenic
1143512033 17:7401861-7401883 AAGAACAAGATGGAGAGGGGAGG - Intronic
1143520645 17:7442422-7442444 GAGGACAAGGAAGAGGGCTGAGG - Intronic
1144039801 17:11400432-11400454 TAGAACAAGGATGAGGGGCAAGG - Intronic
1144048044 17:11470917-11470939 AAGAAGAAAGAGGCCGGGTGTGG + Intronic
1144307549 17:13982999-13983021 AGGAATGAGGAGGAGGGGTTAGG + Intergenic
1144348311 17:14369669-14369691 AAGAAGATGGGGGTGGGGTGGGG + Intergenic
1144854027 17:18258347-18258369 GAGAACACGGACGCGGGGTGGGG + Intronic
1145988908 17:29066296-29066318 GGGAGCAAGGAGTAGGGGTGGGG + Intergenic
1146055577 17:29579142-29579164 AAGCCAGAGGAGGAGGGGTGGGG - Intronic
1146622458 17:34409659-34409681 AAGAACAAGAATGATGAGTGAGG + Intergenic
1146673681 17:34758592-34758614 AAGAAGAAGGAGGAAGGGAGAGG + Intergenic
1146796433 17:35784592-35784614 CAGTAGAAGGAGCAGGGGTGTGG + Intronic
1146915172 17:36673730-36673752 AAGAAGACAGAGGAGGGGTGAGG + Intergenic
1147043277 17:37734260-37734282 AGGAAGAGGGAGGAGAGGTGGGG - Intronic
1147338930 17:39742533-39742555 AAGAAAAAGGGAGAGAGGTGTGG - Intronic
1147361747 17:39935207-39935229 AAGAACAAGGGAGAGCTGTGTGG - Intergenic
1147643953 17:42022626-42022648 AAGGACAAGAAGGAGGTGTGTGG + Exonic
1147945437 17:44077806-44077828 AAGAGGAAGGAGGAGGAGAGGGG + Exonic
1148112538 17:45154122-45154144 AAGAAATAGGAGGCCGGGTGTGG - Intergenic
1148153419 17:45409788-45409810 AGGAGCAAGGAGGAGGGTAGGGG - Intronic
1148569437 17:48656335-48656357 AAGATTAAGGAGGAGTTGTGGGG + Intergenic
1148602519 17:48905148-48905170 AAAAAAAAGGGGGGGGGGTGGGG + Intergenic
1148618504 17:49017020-49017042 AGGGATAAGGAGGCGGGGTGGGG + Intronic
1148645834 17:49219358-49219380 AATGACAAGGGGGTGGGGTGGGG + Intronic
1148667907 17:49388421-49388443 AAGAACAGGAAGGAAGTGTGGGG - Intronic
1148774489 17:50087973-50087995 GAGGACAGGGAGGAAGGGTGGGG - Intronic
1148962198 17:51402693-51402715 AGGCACAAGTAGGAGGCGTGTGG - Intergenic
1148996981 17:51719261-51719283 AAGAACAAGGAGGAGCCATCTGG - Intronic
1149282604 17:55124889-55124911 ATGCACACAGAGGAGGGGTGGGG + Intronic
1149403282 17:56321113-56321135 AAGAAAAAAGAAAAGGGGTGGGG - Intronic
1149448112 17:56729443-56729465 AGGAACAAGGAGGTGGGGGTGGG + Intergenic
1149456564 17:56793026-56793048 AAGAAGGAGGAGGAGGAGAGGGG + Intronic
1149521265 17:57320010-57320032 AGGGCCAAGTAGGAGGGGTGGGG - Intronic
1149778942 17:59381017-59381039 AAGGCCAAGGAGGAGAGGTAGGG + Intronic
1149785799 17:59433901-59433923 AAGAAGAAGAAGGAGGAGAGGGG - Intergenic
1150683726 17:67303618-67303640 AAGAAGGATGATGAGGGGTGGGG + Intergenic
1150705943 17:67487463-67487485 AACAAAAAGGAGGCTGGGTGTGG - Intronic
1151376803 17:73694744-73694766 AAGGACAAAGGTGAGGGGTGGGG + Intergenic
1151591626 17:75047867-75047889 GAGAATATGGAGAAGGGGTGTGG - Intronic
1151999915 17:77638769-77638791 AAAAAAAAGGGGGGGGGGTGGGG + Intergenic
1152000089 17:77639925-77639947 AAGAAGGAGGAGGAGGGAAGAGG - Intergenic
1152084069 17:78206686-78206708 AAGAAGAAGAAGGGGGGGTAGGG - Intronic
1152326926 17:79647012-79647034 AAAATCAAGGAGGAGAGGTGGGG - Intergenic
1153299794 18:3582742-3582764 AATAACAAGGACGAGGTGTCTGG + Intronic
1153626760 18:7028771-7028793 AGGAGCAAAGGGGAGGGGTGCGG + Intronic
1154031231 18:10756006-10756028 GAGAATGAGGAGGAGGGATGGGG + Intronic
1154031353 18:10756625-10756647 GAGGATGAGGAGGAGGGGTGGGG + Intronic
1154050737 18:10954601-10954623 AAGAAGAGGGAGGAGGGGAAGGG + Intronic
1154149820 18:11897725-11897747 AAGGTCAAGGAGGGGTGGTGGGG - Intronic
1155014718 18:21821889-21821911 AAGAACACAGAGGAAGGGCGCGG - Intronic
1155066207 18:22271210-22271232 GAGAAGGAGGAGGAGGAGTGGGG + Intergenic
1155164991 18:23224857-23224879 AAGAAAAAGAAGGCCGGGTGCGG - Intronic
1156132088 18:33988477-33988499 AAGAAGATGCAGGAGAGGTGGGG + Intronic
1156438806 18:37163353-37163375 AACAAAAAGGAGGAAGGGAGCGG - Intronic
1156658915 18:39322305-39322327 AAGAACAATAAGGAGGGAAGTGG + Intergenic
1156697954 18:39790642-39790664 CAGAACAAGGATTAGGGGTAGGG + Intergenic
1157153753 18:45244628-45244650 AAGAAAAAGGAGTGGGGGGGTGG + Intronic
1157310881 18:46552441-46552463 AAACACAAGGAGGAGGGGGTTGG - Intronic
1157651570 18:49337844-49337866 AAGAACAAGAAGAAGGGGAAGGG + Intronic
1157842505 18:50971683-50971705 AAGAACAAAGAGGCTGGGTATGG - Intronic
1157979075 18:52359534-52359556 AGCAACAAGGAGGAAGGGGGTGG - Intronic
1158073950 18:53506868-53506890 AAAAAAAAGGAGGAGGAGTGTGG + Intronic
1158140171 18:54247090-54247112 AAGAACAAAGATGGGGGGTGGGG - Intergenic
1158701889 18:59755558-59755580 AAGAAGAAGAAGGCTGGGTGTGG + Intergenic
1159768643 18:72521970-72521992 AACAACAGGGTGGAGGGTTGAGG - Intergenic
1159925972 18:74269394-74269416 ACGCAGATGGAGGAGGGGTGAGG - Intronic
1160917592 19:1504540-1504562 CTGGACCAGGAGGAGGGGTGGGG + Intergenic
1160949724 19:1659684-1659706 AAGGACAAGGGGGCTGGGTGTGG - Intergenic
1160965757 19:1746265-1746287 AAGGAAATGGAGGAGGAGTGGGG + Intergenic
1160971260 19:1768782-1768804 AAGGTCATGGAGGAGGTGTGGGG + Intronic
1161195439 19:2983758-2983780 GAGAAGAAGGAGGAGGGATGAGG + Intronic
1161366940 19:3885564-3885586 AAGAAGAAGGAGAAGGAGAGAGG + Intronic
1161403963 19:4081670-4081692 AAGAGCAGGGAGGAGGGAGGAGG - Intergenic
1161404032 19:4081895-4081917 AAGAGCAGGGAGGAGGGGCAGGG - Intergenic
1161635116 19:5383649-5383671 AAGAAGGAGGAGGAGGAGGGAGG - Intergenic
1161635117 19:5383652-5383674 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1161670167 19:5602915-5602937 ATGAACTTGGAGGAGGGGGGTGG - Intronic
1161929653 19:7329471-7329493 AATAACAAGGGGGCTGGGTGTGG + Intergenic
1162055947 19:8064152-8064174 AAAAAAAAAGAGGAGGGGAGGGG - Intronic
1162176813 19:8836465-8836487 AAGAAGGAGGAGGAGAGGGGGGG - Intronic
1162818710 19:13210381-13210403 AAGAAAAGGGGGTAGGGGTGAGG + Intronic
1162902088 19:13801159-13801181 AAAAAAAAGGAAGAGAGGTGAGG + Intronic
1162984109 19:14258338-14258360 AAGAACAAAGGGAAGGGGAGGGG - Intergenic
1163113038 19:15172995-15173017 AAGAAGAAGGAAGAGGGGGAGGG - Intronic
1163113055 19:15173039-15173061 AAGAAGAGGGAGGAGGGAGGGGG - Intronic
1163162118 19:15470932-15470954 AAGAAGAAGGAGGCCGGGAGCGG - Intronic
1163387247 19:17007405-17007427 AAGAAGAAGCAGGAGGAGAGGGG + Intronic
1163387259 19:17007459-17007481 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
1163462832 19:17448891-17448913 AAGAAAAAGGAGGCCGGGGGCGG + Intronic
1163464085 19:17456020-17456042 AAGTACTGGGAGGAGGGATGTGG - Intronic
1163689233 19:18729845-18729867 AAGAACGAGGATAAGGAGTGTGG - Intronic
1163827873 19:19533634-19533656 GAAAAAGAGGAGGAGGGGTGAGG - Intronic
1163919657 19:20276573-20276595 AAGATCCCGGGGGAGGGGTGTGG + Intergenic
1164249930 19:23467535-23467557 GAGGAGAAGGAGGAGGAGTGGGG - Intergenic
1164324772 19:24181452-24181474 GAGAAAAAGGGGGAGGGGAGAGG + Intergenic
1164431920 19:28196459-28196481 AAGAATGAGGAGGAGTGGGGAGG - Intergenic
1164570072 19:29367858-29367880 AAGCAGAAGGAGGAGGCGGGAGG - Intergenic
1164592495 19:29514187-29514209 AGGAAGAAGGAGGAGGGATGAGG + Intergenic
1164734034 19:30527205-30527227 AAAAAAAAGGAGGCTGGGTGTGG - Intronic
1164858644 19:31545015-31545037 GAGAAGAAGGAGGAGGGAGGAGG - Intergenic
1165149201 19:33750980-33751002 AAGGACAAGGGGGAGTGATGGGG + Intronic
1165197735 19:34118123-34118145 AAGAAGAAGGGGGAGGGGGAGGG + Intergenic
1165281524 19:34802327-34802349 CAGCACAATGAGGAGGAGTGGGG + Intergenic
1165313048 19:35040095-35040117 ATCAGCAAGGAGGAGGGGTGCGG - Intronic
1165690894 19:37862395-37862417 AGGAGGAAGGAGGAGGGGGGAGG + Intergenic
1165690924 19:37862550-37862572 GAGGAAGAGGAGGAGGGGTGGGG + Intergenic
1166193347 19:41190582-41190604 AAGCCAAAGGAGGAGGGGTGGGG - Intergenic
1166729728 19:45052332-45052354 AAGAACAATGAGCAGGGGTTGGG + Intronic
1166737886 19:45096991-45097013 AACAGCAAGGAGCAGGGGTTAGG + Intronic
1166881284 19:45931660-45931682 AAGGCCAAGGAGGCTGGGTGGGG - Intergenic
1167047771 19:47060886-47060908 AAGTAAAAGGAAGAAGGGTGGGG + Intergenic
1167069923 19:47215380-47215402 AAAAAAAAGGAGGCCGGGTGTGG + Intergenic
1167256371 19:48432198-48432220 AAGAAAAAGAAGGCCGGGTGCGG - Intronic
1167465443 19:49648556-49648578 AAAAAAAAGGGGGGGGGGTGTGG - Intronic
1167578604 19:50329328-50329350 GAGAGCAGGGAGGAGGGGCGGGG + Exonic
1167608171 19:50492805-50492827 AAGAGGAAGGAGGAGGAGGGAGG + Intergenic
1167689806 19:50978360-50978382 GTGAGCAAGGAGGATGGGTGTGG + Intronic
1168082110 19:54017718-54017740 AAGTAAAAGGAGGAGGAGGGAGG - Intergenic
1168251359 19:55144058-55144080 AAAAAAAAGGGGGTGGGGTGGGG - Intronic
1168261924 19:55200171-55200193 AAGAACCAGCAGGAGCGGCGTGG - Intronic
1168357245 19:55709122-55709144 AAGAATAAAGAGGAGAGGAGAGG - Intronic
1168566864 19:57432283-57432305 AAAAAAAAGGAGGCGGGGCGCGG + Intronic
1202655429 1_KI270708v1_random:16279-16301 AAGAACAAGCAGGCCGGGTGTGG + Intergenic
1202689376 1_KI270712v1_random:76172-76194 AAGAAAATGGAGGAGAGGAGGGG - Intergenic
925402566 2:3586028-3586050 AGGAAAAAGGAGGAGGGGGAAGG + Intergenic
925508471 2:4597081-4597103 AAGAAAAAGGAGGAGGAGGAAGG + Intergenic
925615143 2:5738125-5738147 AAAAAAAATGAGTAGGGGTGAGG + Intergenic
925657912 2:6169077-6169099 AAGAAAAAGGTGGGGGAGTGAGG - Intergenic
925915816 2:8604980-8605002 AAGTAGAAGGAGGCAGGGTGCGG - Intergenic
925988363 2:9234124-9234146 AAAAAAAAGGAAGAGGGGAGTGG + Intronic
926626176 2:15091821-15091843 AAACACAAGGAGGCTGGGTGCGG - Intergenic
926819704 2:16839048-16839070 AGGAACAAGTAGAGGGGGTGGGG - Intergenic
927156918 2:20225749-20225771 AAGAAAAAGGGGGACGGGGGCGG + Intergenic
927168700 2:20350732-20350754 GAGAAGGAGGAGGTGGGGTGGGG - Intronic
927571187 2:24161806-24161828 AAGAACAAGTAGGCTGGGTGCGG + Intronic
927928980 2:27032183-27032205 AAGAACAAGGAAGAGGATGGGGG - Intergenic
928106974 2:28476796-28476818 ATGAGAAAGGAGGAGGGGAGAGG + Intronic
928234036 2:29524664-29524686 GAGAACAAAAAGGAGGGCTGTGG + Intronic
928370156 2:30734721-30734743 AAGAGGAAGGAGCATGGGTGAGG - Intronic
928388064 2:30886245-30886267 AGGAACAAGCAGAGGGGGTGGGG - Intergenic
928496450 2:31837841-31837863 AAGAAAAAGGGGGCTGGGTGTGG - Intergenic
929137436 2:38637996-38638018 AAGAAAAGAGAGGAGGGGAGGGG + Intergenic
929230673 2:39556653-39556675 AAGAACAAGGCGGCTGGGCGCGG - Intergenic
929394446 2:41506839-41506861 AAAAAGAAGGAAGAGGGATGGGG + Intergenic
929430099 2:41879409-41879431 AAAAACAAAGGGGAGGGGAGAGG + Intergenic
929609266 2:43257840-43257862 AGGAAAAAAGAGGAGAGGTGAGG + Intronic
929804860 2:45136223-45136245 AAAAAAAAGAAGGAAGGGTGAGG - Intergenic
929863227 2:45696954-45696976 AATAAAAAGGAAGTGGGGTGTGG - Intronic
930364680 2:50424289-50424311 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
930389338 2:50740765-50740787 AAGGACAAGGAGGAAGGATGAGG + Intronic
930764246 2:55068671-55068693 AAAAAAAAGGGGGGGGGGTGGGG + Intronic
930952346 2:57157921-57157943 ACAAACGAGGAGTAGGGGTGTGG - Intergenic
931366775 2:61626077-61626099 AAAAAAAAGTAGGATGGGTGCGG + Intergenic
931393519 2:61865278-61865300 AAGAAAAAGGTGGCTGGGTGTGG + Intergenic
931429676 2:62197867-62197889 AAGAACCAGGAGCAGGAGTTAGG - Intronic
931435813 2:62245292-62245314 AAGAAAAAGTAGGCTGGGTGTGG + Intergenic
931678587 2:64723490-64723512 AAAAAAAAGGCGGCGGGGTGGGG - Intronic
931868197 2:66433808-66433830 GAGAATAAAGAGAAGGGGTGAGG + Intronic
932153515 2:69394341-69394363 AAGAACAAGGAGGAAAGGTGTGG - Intergenic
932415898 2:71573789-71573811 AAGAAAAATCAGGAGGGGAGAGG - Intronic
932993133 2:76812794-76812816 AAGAATAAGGAGGAGGAGGGGGG - Intronic
933009476 2:77041068-77041090 AAGTATAAGGAGGAAGGGTGTGG - Intronic
933895593 2:86807786-86807808 AAGGAGACGGAGGAGGAGTGTGG + Intronic
933957058 2:87379920-87379942 AAGAAAATGGAGGAGAGGAGGGG + Intergenic
934241178 2:90271809-90271831 AAGAAAATGGAGGAGAGGAGGGG + Intergenic
934271998 2:91544877-91544899 AAGAAAATGGAGGAGAGGAGGGG - Intergenic
934574630 2:95392178-95392200 AAGTACATGGAGGAGGGGCTGGG - Intergenic
934579616 2:95427716-95427738 AGGAGTAGGGAGGAGGGGTGGGG - Intergenic
934599829 2:95649009-95649031 AGGAGTAGGGAGGAGGGGTGGGG + Intergenic
934608532 2:95717012-95717034 CAGAACTAGGGGTAGGGGTGAGG - Intergenic
934652386 2:96099921-96099943 AAGGACAAAGAGGAGGGGGAGGG + Intergenic
935559838 2:104548605-104548627 AAGGAGAAGGAGGAAGGCTGCGG - Intergenic
935583630 2:104781811-104781833 AAGAAGAAAGAGGTTGGGTGTGG + Intergenic
935805945 2:106747770-106747792 AGGAACAAGGTGGTGGGATGAGG + Intergenic
935942249 2:108252848-108252870 AAGAAAAAGGAGGAGAAGTAGGG + Intronic
936428086 2:112436237-112436259 AAGAACAAACAGCAGGGGTGGGG - Intergenic
936533174 2:113291014-113291036 AGGAGTAGGGAGGAGGGGTGGGG + Intergenic
936541826 2:113358478-113358500 GAGAACTAGGGGTAGGGGTGAGG - Intergenic
938097970 2:128475620-128475642 AGGGAGCAGGAGGAGGGGTGAGG + Intergenic
938172072 2:129088211-129088233 AAGACCAAGGAGGCCAGGTGAGG - Intergenic
938225753 2:129614714-129614736 AAGAACAGGAAGGAGGAGGGGGG + Intergenic
938225754 2:129614717-129614739 AACAGGAAGGAGGAGGGGGGAGG + Intergenic
938378112 2:130821978-130822000 ATCAACAAGGGGGAGTGGTGGGG + Intergenic
938425369 2:131182068-131182090 AAGAAATAAGAGGAGGGGGGAGG + Intronic
938551941 2:132390747-132390769 AAAAACAATAGGGAGGGGTGGGG - Intergenic
938755606 2:134376318-134376340 AAGAGGAAGGAGGAGAAGTGAGG - Intronic
938947754 2:136228415-136228437 GAAAAAAAGGAGGAGGCGTGAGG + Intergenic
939257520 2:139763814-139763836 AAGAGCAGGCAGAAGGGGTGAGG + Intergenic
939379808 2:141420547-141420569 AAGAACAAGGAAGAGCAGAGTGG - Intronic
939459436 2:142480240-142480262 ATGAAAAATGAGGAAGGGTGTGG + Intergenic
939983215 2:148805645-148805667 GAGGAGGAGGAGGAGGGGTGGGG - Intergenic
939983237 2:148805685-148805707 GAGGAGGAGGAGGAGGGGTGGGG - Intergenic
940216128 2:151305390-151305412 AAGAAAAAGGAGGAGGAGGAGGG + Intergenic
940293364 2:152098796-152098818 AGGGACGTGGAGGAGGGGTGGGG + Intronic
941038192 2:160590510-160590532 AAGGAGAAGGGGGAGGGGAGGGG - Intergenic
941180744 2:162256188-162256210 AATCACAAGGTAGAGGGGTGGGG + Intergenic
941361641 2:164558793-164558815 AAGAACAAGTAGTAGGGCAGAGG + Intronic
941918543 2:170828045-170828067 CAGCAGAAGGAGGAGGGGTGAGG - Intronic
941918552 2:170828083-170828105 CAGCAGAAGGAGGAGGGGTGAGG - Intronic
941918580 2:170828214-170828236 CAGCAGAAAGAGGAGGGGTGAGG - Intronic
942043738 2:172087246-172087268 AAGAAGGAGGAGGAGGAGGGAGG - Intronic
942207728 2:173638192-173638214 AAGAAGAAGGAGGAGGAGGCAGG + Intergenic
942350249 2:175045189-175045211 GAGAGAAAGGAGGAGGGGAGGGG - Intergenic
942496027 2:176541046-176541068 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
942498628 2:176565035-176565057 AAGGACATGGTGGTGGGGTGTGG - Intergenic
942548078 2:177085379-177085401 AAGTACAAGGAGTAGGGAAGAGG + Intergenic
942671673 2:178382600-178382622 AAGAACAATTAGCAGGGGTGGGG - Intronic
943043684 2:182832696-182832718 AAGAACAAAGAGAAAGGCTGGGG + Intergenic
943921538 2:193713269-193713291 AAGAAGAAGGAGAAGGGGAAGGG - Intergenic
944750629 2:202705652-202705674 AAGAACACGGAGGCAGTGTGGGG - Intronic
945085704 2:206129951-206129973 AAAAAAAAGGAGGAGGAGTGGGG + Intronic
945155166 2:206830432-206830454 AAGAAGAAGAAGAAGGGGGGAGG + Intergenic
945500624 2:210568919-210568941 AATAATCAGGAGGATGGGTGTGG + Intronic
945703613 2:213201642-213201664 AAGAAGGAGGAGGAGGGGGGAGG - Intergenic
945767220 2:213995952-213995974 AAGGACAAGGAGAAAGAGTGAGG - Intronic
945911532 2:215655365-215655387 AAGAAACAGGAGGGTGGGTGAGG + Intergenic
945960924 2:216134402-216134424 AAAAACAAGAAGGAAGGATGGGG - Intronic
945979538 2:216297787-216297809 AAGACCATAGGGGAGGGGTGTGG - Intronic
946093719 2:217253418-217253440 AAGATAAAGGAAGAGTGGTGGGG - Intergenic
946222144 2:218237179-218237201 AAGAAAAAGGAGCAGGGCAGGGG - Intronic
946539112 2:220664150-220664172 AAGAACAAGCAGGCCGGGTGTGG - Intergenic
946656823 2:221957644-221957666 CAAAACAAGGAGGATGGGTCAGG + Intergenic
947106311 2:226671405-226671427 ATTAACAAGCAGGTGGGGTGGGG + Intergenic
947295658 2:228627750-228627772 AAGAAGAAGGAGGGGAGGAGGGG - Intergenic
947316761 2:228867048-228867070 AAAAACAAGAAGGAGCAGTGTGG - Intronic
947970599 2:234319918-234319940 AAGAAGGAGGAGGAGGGAGGAGG - Intergenic
947970600 2:234319921-234319943 GAGAAGAAGGAGGAGGAGGGAGG - Intergenic
948029999 2:234809617-234809639 AGGAAGAAGGAGGAGAGGAGAGG - Intergenic
948091913 2:235302132-235302154 AAGAGGAGGGAGGAGGGGGGAGG - Intergenic
948109530 2:235443676-235443698 AGGGACAAGAAGGAGGGGAGAGG - Intergenic
948227021 2:236319109-236319131 ATGAAGAAGGAGGAGGGGCATGG - Intergenic
948293854 2:236846793-236846815 AAGAAGAAGGCAAAGGGGTGAGG + Intergenic
948309821 2:236976763-236976785 GAGAACAAGGAGGAGGGGGAAGG - Intergenic
948413380 2:237782333-237782355 TAGCAGAAGGCGGAGGGGTGGGG + Intronic
948437675 2:237965276-237965298 AAGAAGGAAGAGGAGGGCTGAGG + Intergenic
948538967 2:238672217-238672239 GAGGAGAAGGAGGAGGGGGGAGG - Intergenic
948577644 2:238964980-238965002 AAGAGGAAGGAGGAAGGATGGGG - Intergenic
948721567 2:239904096-239904118 GGGCAAAAGGAGGAGGGGTGGGG + Intronic
948855063 2:240726318-240726340 AAGCACATGGAGGATGGGTGCGG + Intronic
948867122 2:240781838-240781860 AAGAACTGGGAGAAGGCGTGTGG - Intronic
948939190 2:241187721-241187743 GAGAAACAGGAGGAGGGGAGTGG + Intergenic
949035882 2:241815596-241815618 AAGAATAAGAGGAAGGGGTGGGG - Intronic
1168866342 20:1090112-1090134 GAGAAGAAGGAGGAAAGGTGAGG + Intergenic
1168971228 20:1932288-1932310 CAGATCAAGGAGGTGGGGTCTGG + Intronic
1169014406 20:2279984-2280006 AAGAAGAAGGAGGTTGGGTTTGG - Intergenic
1169260474 20:4134683-4134705 AATATCACGGAGGAGGGGCGTGG + Intronic
1169525987 20:6426253-6426275 AAGAAGAAAGAGAAGGGGAGAGG - Intergenic
1169948515 20:11015398-11015420 AAGAATAAAGAGGTGTGGTGCGG - Intergenic
1170145077 20:13164328-13164350 AAGAACAAAGAGGAATGTTGCGG - Intronic
1170306354 20:14942441-14942463 AAGAAAAAGGAGGAGGAGAAAGG - Intronic
1170347325 20:15401326-15401348 AAGAACAAGCTGGCTGGGTGTGG - Intronic
1170803201 20:19607382-19607404 AAGACCAAGGATGAGGAGTGGGG - Intronic
1170836936 20:19892665-19892687 AAGAGGAAGGAGGCTGGGTGCGG - Intronic
1171263292 20:23751006-23751028 AAGAAAGAGGAGGAGGAGTCAGG - Intronic
1171409510 20:24936650-24936672 AAGAAGAGGGAGGTGGAGTGTGG - Intergenic
1171982428 20:31637628-31637650 AACAGCAAGGAGGGGAGGTGTGG + Intergenic
1172038694 20:32028779-32028801 AGGAAGAAGGAGAAGGGGGGTGG + Intronic
1172044494 20:32070886-32070908 AAGAAAGAGGAGGAGGAGGGAGG + Intronic
1172053652 20:32139049-32139071 CAAAACAGGGTGGAGGGGTGAGG + Intronic
1172227035 20:33311953-33311975 GAGAAGAAGGAGGTGGTGTGGGG - Intergenic
1172291690 20:33781429-33781451 AAGGGCAAGGAGGTGGGGTGGGG + Intronic
1172306215 20:33882577-33882599 AGAGACAAGGAGGTGGGGTGGGG - Intergenic
1172326056 20:34035604-34035626 ATGAACAAAAAGGAGGAGTGGGG - Intronic
1172354668 20:34271230-34271252 AAGGAGAAGGAGGTGGGGCGTGG - Intergenic
1172519304 20:35556888-35556910 AAGGGGAAGGAGCAGGGGTGGGG + Intronic
1172606285 20:36216376-36216398 AAGCACACGGAGGAGGAGTCGGG + Intronic
1172775331 20:37403666-37403688 AGGAACCAGGAGAAGGGCTGGGG + Exonic
1172880250 20:38195139-38195161 AAGAACAGGGAGCAGAGGCGGGG + Intergenic
1172947432 20:38700315-38700337 AACAACAAGGGTGTGGGGTGGGG + Intergenic
1173132785 20:40410268-40410290 AAGAGCAAGGAGGGGTGTTGTGG + Intergenic
1173866376 20:46315009-46315031 AAAATAAAGGAGGAGAGGTGGGG + Intergenic
1174001489 20:47378228-47378250 AAGATCAAGGAGGAGGCGTGGGG + Intergenic
1174581720 20:51576940-51576962 CAGAAGAAGGGGAAGGGGTGGGG - Intergenic
1174607366 20:51770495-51770517 AAGACCAAGGAGGCCGGGCGCGG + Intergenic
1174613149 20:51815551-51815573 AAGAGCAAGGATGAGGCCTGGGG + Intergenic
1174709528 20:52690275-52690297 AAGAAAAAGGAGAAGGGGAAGGG - Intergenic
1174723880 20:52841045-52841067 AAGAATAAGGAAGAGGAGAGGGG - Intergenic
1174812611 20:53660076-53660098 AAGAACAAGGGGGGGTGGGGAGG + Intergenic
1174817216 20:53697304-53697326 AAAAAAAAGGAGGCCGGGTGCGG + Intergenic
1175101261 20:56580327-56580349 AAGAACAAGGTGGGTGGGTTGGG + Intergenic
1175249051 20:57597965-57597987 AAGAGGAAGGAGGAGGTGAGAGG + Intergenic
1175287030 20:57843903-57843925 AAGAAAAGGGAGGCGAGGTGGGG + Intergenic
1175661420 20:60816262-60816284 AAGAAGAAGGAGGAGGAGCAAGG - Intergenic
1176296294 21:5075262-5075284 AGGAGCAGGGAGGAGGGATGAGG - Intergenic
1176362066 21:6006183-6006205 AAGGAGGAGGAGGAGGGGGGGGG + Intergenic
1176641115 21:9304723-9304745 AAGAACAAGCAGGCCGGGCGCGG + Intergenic
1176742588 21:10617515-10617537 AAGAAAAGGGAGAAAGGGTGGGG + Intergenic
1176842535 21:13852076-13852098 AAGGAAAAGGAGGAGTAGTGTGG - Intergenic
1177008289 21:15700669-15700691 AAGAATAAGGAGCAGGGAGGTGG + Intergenic
1177115953 21:17087640-17087662 AAGAAAAAGGAGGAGGAGGAGGG + Intergenic
1177507233 21:22034756-22034778 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1177758257 21:25373578-25373600 GAGGAGGAGGAGGAGGGGTGGGG - Intergenic
1177758284 21:25373637-25373659 GAGGAGGAGGAGGAGGGGTGGGG - Intergenic
1177801398 21:25832231-25832253 AAAAACAAGGAGCAGGTGAGTGG - Intergenic
1177809071 21:25905339-25905361 AACATCAAAGAAGAGGGGTGGGG + Intronic
1178122271 21:29481470-29481492 AAAAAAAAGGGGGGGGGGTGGGG - Intronic
1178150824 21:29791489-29791511 AAGAAGAAGGAGAAGGGAAGTGG + Intronic
1178274135 21:31221011-31221033 AGGAGGAAGGAGGAGGTGTGAGG - Intronic
1178349881 21:31865018-31865040 AAGAAGAAGGAGGAGGAGAAGGG - Intergenic
1178473779 21:32918448-32918470 AAAAAAAAGGGGGGGGGGTGGGG + Intergenic
1178683443 21:34692976-34692998 AAGAACAAGGGGTGGGGCTGGGG - Intronic
1178995488 21:37395413-37395435 AAGAACAATGAGGTGAGGAGCGG - Intronic
1179081804 21:38178535-38178557 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
1179488606 21:41726580-41726602 AAGAAGAAGAAGGGGGGGGGAGG - Intergenic
1179761452 21:43532362-43532384 AAGGAGGAGGAGGAGGGGGGGGG - Intronic
1179860755 21:44186859-44186881 AGGAGCAGGGAGGAGGGATGAGG + Intergenic
1179930485 21:44568203-44568225 CAGGAGCAGGAGGAGGGGTGGGG - Intronic
1179988622 21:44934249-44934271 AAGAACATGGAGGAGGAATGTGG - Intronic
1180023980 21:45148168-45148190 AAAACCAAGGAGGAGGTGAGTGG - Intronic
1180187989 21:46149871-46149893 AAGACCAAGCAGAAAGGGTGGGG + Intronic
1180350136 22:11794105-11794127 AAGAACAAGCAGGCCGGGTGCGG + Intergenic
1180374421 22:12077550-12077572 AAGAACAAGCAGGCCGGGCGTGG + Intergenic
1180388074 22:12198147-12198169 AAGAACAAGCAGGCCGGGTGCGG - Intergenic
1180552044 22:16548440-16548462 AAGAAAACGGAGGAGAGGAGGGG + Intergenic
1180637512 22:17272692-17272714 AAAATGAAGGGGGAGGGGTGGGG - Intergenic
1180674570 22:17578404-17578426 AAGAAAAGAGAGGAGGGGTGGGG - Intronic
1180872536 22:19154647-19154669 AAGAAGGAGGAGGAGGGGGAGGG - Intergenic
1180995802 22:19964615-19964637 AGGACCAAGGAGATGGGGTGGGG + Intronic
1181021374 22:20105181-20105203 AAGAAGAGGGAGGAGGGGCAGGG + Intronic
1181043015 22:20201754-20201776 CAGCACCAGGAGCAGGGGTGAGG + Intergenic
1181163739 22:20972752-20972774 TTGAAAAAGGAGGCGGGGTGTGG + Intronic
1181450668 22:23017909-23017931 CAGAAAAAGGACGAGGCGTGTGG + Intergenic
1181577171 22:23802429-23802451 AAGGAAAAGGAGGAGGGGGTAGG - Intronic
1181779921 22:25185103-25185125 ATGGACAAGGATGAGAGGTGAGG + Exonic
1181916965 22:26289240-26289262 AAGAGCAGGGGGGAGGGGTCAGG - Intronic
1181977208 22:26738467-26738489 GAGAACAAGGAGGAGGGGAAGGG - Intergenic
1182053690 22:27332693-27332715 AAGGACAAGGAGGAAGATTGTGG + Intergenic
1182296286 22:29312522-29312544 AAGGAAAAGGAGAAGGGATGGGG - Exonic
1182367971 22:29791387-29791409 AAGAAGAAGAAGGCTGGGTGTGG + Intronic
1182563480 22:31180099-31180121 CAGAACATGGCGGGGGGGTGGGG + Intronic
1182636887 22:31735147-31735169 AAGAACAGGGTGGCGGGGCGCGG + Intronic
1182672774 22:32011145-32011167 AAGAAAAAGAAGGCTGGGTGTGG + Intergenic
1183038145 22:35155746-35155768 ATAAACAGGGAGGAGGGGTTGGG + Intergenic
1183058054 22:35319052-35319074 AAGATCAGGGAGCAGGGCTGAGG - Intronic
1183313544 22:37124754-37124776 GAGAAAAAGGAGGAGAGGTGGGG - Intergenic
1183385433 22:37511460-37511482 AAGGAGAAGGAGGAGGCGGGAGG + Intronic
1183611562 22:38910655-38910677 AGGAACAAGGATATGGGGTGTGG - Intergenic
1183653269 22:39171129-39171151 CAGTACAGGGAGGAGGGCTGTGG + Intergenic
1184130208 22:42513062-42513084 AGTAACTGGGAGGAGGGGTGGGG - Intronic
1184140384 22:42574885-42574907 AGTAACTGGGAGGAGGGGTGGGG - Intergenic
1184244991 22:43231335-43231357 AAGGATAATGAGGAGGGGTCTGG - Intronic
1184427799 22:44423399-44423421 AAGAACATGGAGGGAGGGGGAGG - Intergenic
1184870000 22:47231824-47231846 AGGAACAAGGAGAAGGGCTTGGG - Intergenic
1184989886 22:48160220-48160242 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
1184992705 22:48181674-48181696 AAGCACAGGGAGGAGGGCAGGGG + Intergenic
1185036910 22:48484271-48484293 ACGCACAGGGAGGAGGGGCGAGG - Intergenic
1185108197 22:48885931-48885953 AAGACCAGGAGGGAGGGGTGAGG - Intergenic
1185311809 22:50160221-50160243 AAGAAACAGGAGGTGGGGGGAGG - Intronic
1185409775 22:50675342-50675364 AAACACAAGTGGGAGGGGTGAGG + Intergenic
949102539 3:163453-163475 AAGAAGATGGAGGAGGGAGGAGG - Intergenic
949250082 3:1973143-1973165 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
949420018 3:3855816-3855838 GAGAACAAGAAGTAGGGATGTGG - Intronic
949464875 3:4333734-4333756 AAGAAGAAGGAGGAATAGTGTGG + Intronic
949478929 3:4474855-4474877 AAAGACAACGAGGAGGGGGGAGG - Intergenic
949587683 3:5458408-5458430 AAGAGGGAGGAGGAGGAGTGGGG - Intergenic
949614667 3:5739734-5739756 AGGAACAAGGAAGAGGGGAAAGG - Intergenic
949869067 3:8571446-8571468 AGGAAGAAGGAAGTGGGGTGTGG - Intergenic
949981839 3:9506869-9506891 AATAACAATGAGGGCGGGTGTGG - Intronic
950002090 3:9664766-9664788 AGGAACAAGGGGGAGGAGTGGGG + Intronic
950020786 3:9786227-9786249 AAGAGCAAGGAGGCCGGGCGCGG - Intronic
950727238 3:14924341-14924363 AAGAAAGAGGAGGAGGGGAGAGG - Intronic
951017599 3:17747059-17747081 AAGAGCCAGGAGAAGGGATGTGG - Intronic
951179457 3:19641933-19641955 AAGAACAAAGAGAAGAGGTGGGG + Intergenic
951490953 3:23270138-23270160 AAAAAAAAGGAGGAGGGGGGTGG - Intronic
951798441 3:26568448-26568470 AACAACAAGGAGGTAGAGTGTGG + Intergenic
951897864 3:27627545-27627567 AAGAAAAAGGAGGCCGGGTGCGG + Intergenic
951946841 3:28147680-28147702 AAGTACAAATAGGATGGGTGAGG + Intergenic
952047569 3:29341972-29341994 AAGATCAAGCAAGAGGGGTGAGG - Intronic
952290052 3:32006234-32006256 TAAAACAAGATGGAGGGGTGCGG - Intronic
952657298 3:35801635-35801657 AAGCACAGGCAGCAGGGGTGGGG + Intergenic
952989447 3:38818909-38818931 AAGAATAAGGAGGGGAGTTGTGG - Intergenic
953230240 3:41058300-41058322 AAGAAGGAGGAGGAGGAGGGAGG + Intergenic
953443582 3:42941863-42941885 AAGAACAAGCAAGGGAGGTGAGG - Intronic
953682310 3:45048956-45048978 AAGTTCCAGGTGGAGGGGTGGGG - Intergenic
953701469 3:45199194-45199216 AATCACAAAGAGGATGGGTGTGG + Intergenic
953843107 3:46405855-46405877 AAGAAGGAGGAGGAGGGGCGGGG - Intergenic
954180801 3:48879974-48879996 AAGGCCAAGGAGGATGGCTGTGG + Intronic
954245190 3:49325848-49325870 ATGAACAAGAGGCAGGGGTGAGG + Intronic
954440297 3:50518100-50518122 CAGAATGAGGAGGTGGGGTGTGG + Intergenic
954447838 3:50556060-50556082 AGGAAAAAGAAGGTGGGGTGGGG - Intergenic
954690959 3:52395348-52395370 CAGCACAAAGATGAGGGGTGTGG - Exonic
955307450 3:57848549-57848571 AAGAAAAAGGAGAAGGAGGGAGG - Intronic
955486391 3:59438825-59438847 AGGAAGAAGAAGGAGGGGTCTGG + Intergenic
955756301 3:62228230-62228252 AAGAAAAAGGAGGCTGGGCGCGG + Intronic
956198803 3:66683940-66683962 AAGAAAAAGGAGGAGGAGGAGGG - Intergenic
956659058 3:71581948-71581970 AACAACAAAAAGGAGGGGGGAGG + Intronic
956730356 3:72190825-72190847 AAAAAAAAGGATGAGGGGAGGGG - Intergenic
956833962 3:73080545-73080567 AAGTAGAAGGTGGAGGGGAGGGG - Intergenic
957735056 3:84192456-84192478 AAGAAAGTGGAGAAGGGGTGGGG + Intergenic
957867780 3:86046777-86046799 AAGCACAATGAGGGGGGGTTGGG - Intronic
958028892 3:88083038-88083060 AGGAAGAGGGAGGAGGAGTGAGG - Intronic
958037674 3:88189539-88189561 CAGAAAAAGGAAGAGGGGAGGGG - Intergenic
958636858 3:96755850-96755872 TAGAACAAGGAGTTGGGGTAGGG + Intergenic
958792704 3:98670359-98670381 ACAACCAAGGAGGAGGTGTGTGG - Intergenic
959166965 3:102792512-102792534 AAGAAAAAGAAGGAGGAGTGAGG + Intergenic
959186185 3:103050619-103050641 AAGGAAAAGGAGGAGAGGTGAGG + Intergenic
959381362 3:105644937-105644959 AACAACTAAGAGAAGGGGTGGGG + Intergenic
959677049 3:109048162-109048184 AAGAACAGAGAGGAGGGGAGTGG + Intronic
960134733 3:114093890-114093912 GAGGACAAGGAGGAGGTGAGGGG - Intergenic
960170462 3:114454776-114454798 AGGAGAGAGGAGGAGGGGTGGGG - Intronic
961010540 3:123432856-123432878 AGGCACAAGGAAGAGAGGTGGGG + Intronic
961030572 3:123599990-123600012 AAGAAGGAGGAGGAAGAGTGGGG - Intergenic
961051420 3:123750300-123750322 AAAACCAAAGGGGAGGGGTGGGG + Intronic
961083397 3:124045177-124045199 AAGGGCTAGGAGGAGGGGTCTGG + Intergenic
961748287 3:129080106-129080128 AAGAACAAAGAGGAGGTTGGAGG + Intergenic
962249715 3:133828384-133828406 AACAGGAAGGAGGAGGTGTGTGG + Exonic
962660856 3:137599125-137599147 AAGGACAAGAAAGAGGAGTGGGG - Intergenic
962737434 3:138338480-138338502 AAGACCATGGAGGAGGCGTGGGG + Intergenic
962958332 3:140286785-140286807 TAGAAGAAGGAGGAGTAGTGGGG + Intronic
963108326 3:141665196-141665218 AAGAAAAAAGAGGCTGGGTGTGG + Intergenic
963260821 3:143189254-143189276 AAGAACATAGTGGAGGGGTTTGG - Intergenic
963741256 3:149084405-149084427 ATGAACAAGGCGCTGGGGTGTGG + Intronic
963926990 3:150961173-150961195 AGCCACAAGGAGGAGGGGAGGGG - Intronic
963946075 3:151146805-151146827 AGAGAAAAGGAGGAGGGGTGGGG - Intronic
964356608 3:155856838-155856860 AAGAACAGGGAGGAGGACAGTGG - Intergenic
964374400 3:156035405-156035427 AAGAAGGAGGAGGAGGAGGGAGG - Intergenic
964374401 3:156035408-156035430 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
964376342 3:156052159-156052181 AAGAAAAAGGGGGAGGGGGAGGG - Intronic
964828019 3:160850965-160850987 GAAAACAGGGAGGTGGGGTGGGG - Intronic
965329157 3:167348385-167348407 AAGAAGAAGGAGGGAGGGAGAGG + Intronic
965486903 3:169289445-169289467 ATGAACAAGAAGGAAGGATGTGG - Intronic
965764525 3:172115931-172115953 AATCAGAAGGAGGAGGGCTGTGG - Intronic
966546126 3:181151060-181151082 AGGGACAAGTGGGAGGGGTGAGG + Intergenic
966667349 3:182486921-182486943 AGTAACAAGGAGGTGGGGTGGGG + Intergenic
966798153 3:183735835-183735857 AATTACAAGGAGGCTGGGTGCGG - Intronic
966854129 3:184182630-184182652 CAGAACAAGGAGAAGTGGTCAGG - Intronic
966963833 3:184969414-184969436 AAAAAAAAGGGGGGGGGGTGGGG - Intronic
967349315 3:188494542-188494564 AACAAAAAGGGTGAGGGGTGGGG - Intronic
967389317 3:188940059-188940081 AAGGACAAGGAGGAGGGGTTTGG + Intergenic
967588686 3:191246313-191246335 AAGAACTAGTAGGCCGGGTGTGG + Intronic
967987684 3:195107510-195107532 AAGAAGAAGGAGGAGGAAGGAGG + Intronic
1202745779 3_GL000221v1_random:100303-100325 AAGAACAAGCAGGCCGGGCGCGG - Intergenic
968440895 4:623917-623939 AGGAAAAAGGAGGTGGGGAGGGG + Intergenic
968479995 4:829024-829046 GAGAAGGAGGAGGTGGGGTGTGG + Intergenic
968856540 4:3128275-3128297 GAGAACAAGCAGGAGGGTTCAGG - Intronic
968938364 4:3625125-3625147 AAGGACAAGGAGAAGCAGTGTGG + Intergenic
969239801 4:5890683-5890705 AAGAGGAAGGAGTAGGGGAGAGG + Intronic
969260687 4:6031429-6031451 AAGAGGCATGAGGAGGGGTGAGG + Intronic
969288649 4:6224296-6224318 AGCAACAAGGAGCAGTGGTGGGG - Intergenic
969471125 4:7389899-7389921 AAGGACAGTGAGCAGGGGTGCGG + Intronic
969727187 4:8927300-8927322 AAGGAGAAACAGGAGGGGTGCGG - Intergenic
969955205 4:10882408-10882430 AAGAAAAAGGAAGAGGGCTGAGG - Intergenic
970235956 4:13958166-13958188 AAGAAAAAGGAGGAGCGGGGAGG - Intergenic
970368939 4:15388925-15388947 AAGAGCAAGGAGGAGCAGGGAGG + Intronic
970406062 4:15765577-15765599 AAGAACAAGGAGGAAATATGTGG - Intergenic
970536733 4:17037682-17037704 GAGATGAAGGAGGAGAGGTGGGG + Intergenic
971009619 4:22418862-22418884 CAGAAGAAGCAGGAGGGCTGAGG + Intronic
971655248 4:29336000-29336022 AAGAAAAAGGAGGAAGGAGGAGG - Intergenic
972754616 4:42032648-42032670 AAGATCAAGGAAGAGGGAAGAGG + Intronic
972796096 4:42421195-42421217 AAGAAAAAGGTGGAGGGAGGAGG + Intronic
973304421 4:48629345-48629367 AAGAACAAAAAGGATGGGAGAGG + Intronic
973759303 4:54101773-54101795 AAGCACAAGAAGGAGGGGAAGGG + Exonic
973771341 4:54209879-54209901 AAGAACAGGAAGGAGGGGTCAGG + Intronic
973846745 4:54920629-54920651 ATGAACAAAGAGGAGAGGGGAGG - Intergenic
974379189 4:61116697-61116719 AAGTAAAATGAGGAGGGGAGAGG + Intergenic
974889283 4:67860120-67860142 AAGATAAAGAAGCAGGGGTGGGG + Intronic
975136131 4:70876077-70876099 AGGAAGAAAGAGGTGGGGTGGGG - Intergenic
975393077 4:73842825-73842847 AAGAAAGGGGAGGAGAGGTGAGG + Intronic
976124242 4:81816444-81816466 AAGACCTCGGAGAAGGGGTGAGG + Intronic
976866552 4:89734812-89734834 AAGAACAAAGAGGAGGTTGGAGG + Intronic
977183126 4:93902591-93902613 AAGCAGGAGGAAGAGGGGTGAGG - Intergenic
977662111 4:99601310-99601332 AAAAAAAAAAAGGAGGGGTGAGG - Intronic
978310264 4:107379601-107379623 AAGAAAAATGAGGTGGGGTGGGG - Intergenic
978358581 4:107904337-107904359 AAGAACAAGGAGGACAGGGGAGG - Intronic
978828172 4:113049618-113049640 CAGGAGGAGGAGGAGGGGTGGGG - Intronic
979036606 4:115727557-115727579 AAATACAAGAAGGAGGGGTTGGG + Intergenic
979603286 4:122609296-122609318 AAGAAGAATGAGGAGGGCAGGGG + Intergenic
979670717 4:123357540-123357562 AAGGAAAAGCAGGAGGGGAGAGG - Intergenic
981025053 4:140069476-140069498 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
981025068 4:140069537-140069559 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
981287390 4:143034507-143034529 AGGAGCAAGAAGGAGGGGAGGGG + Intergenic
981963753 4:150576170-150576192 AAAAAAAAGGAGGAGGGGAGAGG + Intronic
982068890 4:151677931-151677953 AGGAAGAAGGAGGAGGAGGGAGG - Intronic
982115579 4:152096031-152096053 AAGAACAAGGGAGATGGCTGTGG + Intergenic
982399413 4:154949829-154949851 AAAAAAAAGGGGGAGGGATGTGG + Intergenic
982971457 4:161993007-161993029 TTGCACAAGGCGGAGGGGTGTGG + Intronic
983653163 4:170053611-170053633 AAGAAGAAGGAGGGGGGAGGGGG - Intergenic
984703428 4:182833000-182833022 GAGGAGAAGGAGGAGGGGAGAGG - Intergenic
984703445 4:182833049-182833071 GAGGAGAAGGAGGAGGGGAGAGG - Intergenic
984703481 4:182833149-182833171 GAGGAGAAGGAGGAGGGGAGAGG - Intergenic
984703487 4:182833168-182833190 GAGGAGAAGGAGGAGGGGAGAGG - Intergenic
984703503 4:182833221-182833243 GAGGAGAAGGAGGAGGGGAGAGG - Intergenic
984703521 4:182833272-182833294 GAGGAGAAGGAGGAGGGGAGAGG - Intergenic
984703559 4:182833370-182833392 GAGGAGAAGGAGGAGGGGAGAGG - Intergenic
984703565 4:182833389-182833411 GAGGAGAAGGAGGAGGGGAGAGG - Intergenic
984703576 4:182833424-182833446 GAGGAGAAGGAGGAGGGGAGAGG - Intergenic
984703625 4:182833550-182833572 GAGGAGAAGGAGGAGGGGAGAGG - Intergenic
984703631 4:182833569-182833591 GAGGAGAAGGAGGAGGGGAGAGG - Intergenic
984703637 4:182833588-182833610 GAGGAGAAGGAGGAGGGGAGAGG - Intergenic
984703648 4:182833623-182833645 GAGGAGAAGGAGGAGGGGAGAGG - Intergenic
984703697 4:182833749-182833771 GAGGAGAAGGAGGAGGGGAGAGG - Intergenic
984703703 4:182833768-182833790 GAGGAGAAGGAGGAGGGGAGAGG - Intergenic
984703709 4:182833787-182833809 GAGGAGAAGGAGGAGGGGAGAGG - Intergenic
984703722 4:182833826-182833848 GAGGAGAAGGAGGAGGGGAGAGG - Intergenic
984703728 4:182833845-182833867 GAGGAGAAGGAGGAGGGGAGAGG - Intergenic
984703740 4:182833883-182833905 GAGGAGAAGGAGGAGGGGAGGGG - Intergenic
984703753 4:182833918-182833940 GAGGAGAAGGAGGAGGGGAGAGG - Intergenic
984703772 4:182833972-182833994 GAGGAGAAGGAGGAGGGGAGAGG - Intergenic
984703778 4:182833991-182834013 GAGGAGAAGGAGGAGGGGAGAGG - Intergenic
984703798 4:182834042-182834064 GAGGAGAAGGAGGAGGGGAGAGG - Intergenic
984703835 4:182834139-182834161 GAGGAGAAGGAGGAGGGGAGAGG - Intergenic
984703841 4:182834158-182834180 GAGGAGAAGGAGGAGGGGAGAGG - Intergenic
984703847 4:182834177-182834199 GAGGAGAAGGAGGAGGGGAGAGG - Intergenic
984703853 4:182834196-182834218 GAGGAGAAGGAGGAGGGGAGAGG - Intergenic
984703864 4:182834231-182834253 GAGGAGAAGGAGGAGGGGAGAGG - Intergenic
984703913 4:182834357-182834379 GAGGAGAAGGAGGAGGGGAGAGG - Intergenic
984703919 4:182834376-182834398 GAGGAGAAGGAGGAGGGGAGAGG - Intergenic
984703925 4:182834395-182834417 GAGGAGAAGGAGGAGGGGAGAGG - Intergenic
984703931 4:182834414-182834436 GAGGAGAAGGAGGAGGGGAGAGG - Intergenic
984703937 4:182834433-182834455 GAGGAGAAGGAGGAGGGGAGAGG - Intergenic
984703950 4:182834472-182834494 GAGGAGAAGGAGGAGGGGAGAGG - Intergenic
984703956 4:182834491-182834513 GAGGAGAAGGAGGAGGGGAGAGG - Intergenic
984703962 4:182834510-182834532 GAGGAGAAGGAGGAGGGGAGAGG - Intergenic
984703968 4:182834529-182834551 GAGGAGAAGGAGGAGGGGAGAGG - Intergenic
984703974 4:182834548-182834570 GAGGAGAAGGAGGAGGGGAGAGG - Intergenic
984703980 4:182834567-182834589 AAGGAGAAGGAGGAGGGGAGAGG - Intergenic
984725162 4:183013450-183013472 AAGAAGAAGGAGAAGGGGAAGGG - Intergenic
984820760 4:183879800-183879822 AAATACAGGGAAGAGGGGTGGGG + Intronic
984846215 4:184110168-184110190 AAGAACAGAAAGAAGGGGTGAGG - Intronic
984886605 4:184455281-184455303 AAGAAGAAGAAGGAAGGGAGGGG - Intronic
984952530 4:185018031-185018053 AAGAGGGAGCAGGAGGGGTGGGG + Intergenic
984962473 4:185111102-185111124 AAAAGCATGGAGAAGGGGTGAGG + Intergenic
985282404 4:188300451-188300473 GGGAAGAAGGAGGAGGGATGGGG - Intergenic
1202756004 4_GL000008v2_random:62989-63011 AAGAACAAGCAGGCCGGGCGTGG + Intergenic
985846327 5:2352242-2352264 AAGAACGAGGATGAGGCGGGTGG + Intergenic
986009680 5:3700897-3700919 AAGAAGAAGAAGGAGGGAGGAGG - Intergenic
986086408 5:4455162-4455184 AAGAAGAAGGAGGAGAGTTTGGG + Intergenic
986826365 5:11527051-11527073 AAGAAAAAGAAGGTGGGGTTGGG + Intronic
987062366 5:14254641-14254663 AAGAAACAGGAGGAGGAGGGTGG - Intronic
987368072 5:17167749-17167771 ATGAAAAAGGATGAGGGGTGAGG + Intronic
988862896 5:35303326-35303348 CAGAAGAAGCAGGAGGGGTGGGG + Intergenic
988914652 5:35880396-35880418 AAGAAAAAGTAGGAAGGGGGAGG - Intergenic
989012540 5:36889420-36889442 AAGAACTGGGAGGAGGTGTTGGG + Intronic
989047684 5:37288761-37288783 AAAAAAAAGTAGGGGGGGTGGGG + Exonic
989079706 5:37605006-37605028 AAAAAAAAGAAGGAGGGGGGAGG - Intronic
989242011 5:39212501-39212523 GGGAACAAGGGGGAGGGTTGAGG - Intronic
989438766 5:41445895-41445917 AAGAACAACGAGGCCGGGCGCGG + Intronic
989740144 5:44761071-44761093 AACAAAAAGGTGGAGGGGTTTGG + Intergenic
990327722 5:54694615-54694637 AGGCAGAAGGAGGAGGGGTAAGG + Intergenic
990499918 5:56385779-56385801 AAGAAAGAGGAGGAGGAGAGAGG - Intergenic
992064340 5:73091764-73091786 AACAAAATGGAGCAGGGGTGGGG - Intergenic
992095272 5:73357333-73357355 ACCAACAAGGGGTAGGGGTGGGG - Intergenic
992306741 5:75447762-75447784 AAAAAAAAGGAGGCCGGGTGTGG - Intronic
992565416 5:77991101-77991123 AAGCACAAAGGGGTGGGGTGAGG - Intergenic
992813989 5:80418252-80418274 AAGAGCAAAGAGGAGGGGAAAGG - Intronic
994163169 5:96579651-96579673 AAGAACAAGGAAAACTGGTGTGG - Intronic
994825392 5:104707621-104707643 AAGAAGAAGGAGGAGGAGGAAGG + Intergenic
995505541 5:112856456-112856478 AACTACAGAGAGGAGGGGTGAGG - Intronic
995907434 5:117142492-117142514 AAGAAGGAGGGGGAGGGGAGGGG - Intergenic
996105398 5:119496102-119496124 AAGAACTGGGAGTAGGGGTGAGG + Intronic
996224674 5:120977328-120977350 AAGAGCAAGGAGGCCGGGCGCGG + Intergenic
996651929 5:125888666-125888688 AAGAAAGAGAGGGAGGGGTGGGG - Intergenic
996678998 5:126209409-126209431 AAAAACAAGAAGTGGGGGTGGGG + Intergenic
997241618 5:132312194-132312216 AAGAACAGGGAGGTGGTGAGGGG - Exonic
998126387 5:139625426-139625448 AAAAAAAAGGGGGGGGGGTGGGG - Intronic
999023009 5:148191412-148191434 AAAATCATGGGGGAGGGGTGAGG + Intergenic
999154071 5:149445618-149445640 AAGAAGGAGGAGAAGGAGTGGGG + Intergenic
999261496 5:150241466-150241488 GAGAAGAAGGAGGAGAGGGGAGG - Intronic
999347575 5:150838011-150838033 AAGAACAAAAAGATGGGGTGGGG - Intergenic
999402145 5:151273499-151273521 AAGAAGAAGCTGGAGAGGTGGGG + Intergenic
1000126010 5:158244888-158244910 AAGAACAATGGGAAGGGGTGAGG - Intergenic
1000762996 5:165250015-165250037 AAGAAAAAGGAAGATTGGTGTGG + Intergenic
1000832876 5:166126124-166126146 AATAACAAGGAGCTAGGGTGGGG - Intergenic
1001079410 5:168656112-168656134 AATAAAAAGGAGGAGGAGGGAGG - Intergenic
1001326932 5:170735615-170735637 AAAAACAAGAAGTAAGGGTGGGG - Intronic
1001409709 5:171502153-171502175 AAAAACATAAAGGAGGGGTGTGG - Intergenic
1001483638 5:172104984-172105006 CAGCCCAAGGAGGAGGTGTGTGG - Intronic
1001590097 5:172859115-172859137 AAGCACCAGGAGGAGGGAAGGGG - Intronic
1001654023 5:173335758-173335780 ATGAACCAGGAGAATGGGTGAGG + Intergenic
1001890969 5:175338207-175338229 AATAAGAAGGAGGAGGAGAGAGG - Intergenic
1002100988 5:176857550-176857572 AATAGCAAGGAGGAGGGGCAAGG - Intronic
1002191356 5:177479419-177479441 AGGAACAAGGCGGGAGGGTGGGG - Intergenic
1002461334 5:179375446-179375468 AAGCACAAGGAGGGGGAGTGTGG - Intergenic
1003020429 6:2504826-2504848 ATGAAGGATGAGGAGGGGTGAGG - Intergenic
1003020436 6:2504862-2504884 ATGAAGGATGAGGAGGGGTGAGG - Intergenic
1003486912 6:6588024-6588046 TAGAAAAAGTAGGAAGGGTGGGG - Intergenic
1003487853 6:6595242-6595264 GAGAACAAGAAGGAGGGAAGGGG + Intronic
1003517286 6:6827599-6827621 AAGAAAAAGGAGGCCGGGTGTGG + Intergenic
1003659724 6:8049030-8049052 AAGAAAGAAGAGGAGGGGAGGGG + Intronic
1004002044 6:11604808-11604830 AAGAAGAAGAGGGAGGGGAGAGG + Intergenic
1004117979 6:12789918-12789940 AAGAAAAAGAGGGAGGGGGGAGG - Intronic
1004365565 6:15009657-15009679 AAGAGAAAGGAGGACGGGTAGGG - Intergenic
1004406075 6:15335076-15335098 AAGAAAAAAAAAGAGGGGTGTGG - Intronic
1004518071 6:16337377-16337399 ATGAGGAAGGAGGAGGGGCGGGG + Intronic
1004588818 6:17029234-17029256 AAAAAAGAGGAGGAAGGGTGGGG + Intergenic
1004629536 6:17408281-17408303 AAGAAGCAGGAGGAGAGGAGAGG + Intronic
1004836845 6:19540088-19540110 AAAGACACGGAGAAGGGGTGGGG - Intergenic
1005002975 6:21261302-21261324 AAGAAGAAGGAGGAGGAGGAAGG + Intergenic
1005088495 6:22032067-22032089 AAGAAGAAGGAAGCGGGGAGGGG - Intergenic
1005480790 6:26253432-26253454 GTGGACAGGGAGGAGGGGTGGGG + Intergenic
1006275280 6:33000275-33000297 AACCACAAGGAGGAGAGGAGAGG + Intergenic
1006294014 6:33161803-33161825 AAGTACGGGGAGGAGGGGCGGGG + Intergenic
1006376379 6:33673797-33673819 TAGAAAAAGGAGCAGGGCTGAGG - Intronic
1006413278 6:33888149-33888171 GAGAACAAGGAAGAGGGGCAAGG + Intergenic
1007002273 6:38325393-38325415 AACAACAAAGAGGCTGGGTGCGG + Intronic
1007306606 6:40911573-40911595 AAGATCAAGGAGGGTGGGGGTGG - Intergenic
1008003567 6:46386306-46386328 AACCACAAGGAGGCCGGGTGCGG + Intronic
1008016433 6:46525636-46525658 GAGAAGAAGGGGGAGGGGGGAGG + Intergenic
1008246759 6:49184684-49184706 AAGAAGAAGGAGGTGGGGGGAGG - Intergenic
1008246760 6:49184687-49184709 AAGAAGAAGAAGGAGGTGGGGGG - Intergenic
1008339958 6:50352823-50352845 CAGAACAAGAAGGAGGCGAGAGG + Intergenic
1008664894 6:53706467-53706489 AAGAAGATGGAGGTAGGGTGGGG + Intergenic
1008965217 6:57307894-57307916 AAGAACACAGAGCAGGGGAGGGG + Intergenic
1009029371 6:58038194-58038216 AAGAAGGCAGAGGAGGGGTGGGG - Intergenic
1009965081 6:70569252-70569274 AAGAAAAAAGAGGCCGGGTGCGG - Intronic
1010869681 6:81021991-81022013 AAGAGAAAGGAGAAGGGGTAGGG - Intergenic
1011438005 6:87359168-87359190 AAGATCAAGCAGTATGGGTGGGG + Intronic
1011742617 6:90377649-90377671 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1011788637 6:90874049-90874071 AAGAAGATGGATGAGGGGAGGGG - Intergenic
1011910215 6:92426442-92426464 AAATACAAGGAGGCCGGGTGCGG - Intergenic
1012165669 6:95948056-95948078 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
1012316510 6:97787509-97787531 AAGAACAAGAAGCGGGGGTGGGG + Intergenic
1012494375 6:99818510-99818532 AAGAAGAAGGGGGAGGGGGAGGG - Intergenic
1013054894 6:106574079-106574101 AAGAATAAGGCAGAGGGCTGTGG + Intronic
1013101066 6:106987148-106987170 GAGGAGGAGGAGGAGGGGTGGGG + Intergenic
1013165506 6:107587510-107587532 AGGACGTAGGAGGAGGGGTGAGG - Intronic
1014207567 6:118672782-118672804 AAGAAGAAGGAGGAGGAAGGAGG + Intronic
1014236301 6:118959250-118959272 AACAACAAGGAAGGGGGTTGAGG - Intergenic
1014869973 6:126581949-126581971 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1015112337 6:129607478-129607500 AAGCACAAGGAGAAGTGGTAGGG - Intronic
1016417767 6:143851019-143851041 AAGAAGGAGGGGGAGGGGTGGGG + Intronic
1016830115 6:148425728-148425750 AAAAAAAAGGAGGAGGGGGAGGG - Intronic
1016940968 6:149482559-149482581 AAGAGCAGGGAGGAAGGGAGGGG + Intronic
1017339640 6:153305453-153305475 AAGAAGAAGGAGGAGGAGTAGGG - Intergenic
1017519301 6:155187559-155187581 AAAAAAAAGGGGGCGGGGTGGGG - Intronic
1017943367 6:159073252-159073274 AAGAACATAGAAAAGGGGTGAGG - Intergenic
1018008466 6:159645914-159645936 AAGACCACAGAGGAGGGGAGGGG + Intergenic
1018038075 6:159898652-159898674 AAGAGGAAGGAGGAGGGAGGAGG - Intergenic
1018256213 6:161922219-161922241 TAGAACAAGGAAGAGAAGTGAGG - Intronic
1018306375 6:162461209-162461231 AAAAAAAAGGAGGCTGGGTGTGG + Intronic
1018415864 6:163601692-163601714 GAGGACAGGGAGGAGGGGAGAGG - Intergenic
1018799725 6:167212516-167212538 GAAAACAAGGAGGAGGAATGGGG + Intergenic
1018844708 6:167547511-167547533 GTGAAGAAGGAGGAGGGATGGGG - Intergenic
1019358809 7:594513-594535 AAGGACAGAGTGGAGGGGTGCGG + Intronic
1019457331 7:1137247-1137269 AGGAAGCAGGAGGAGGAGTGAGG - Intronic
1019602367 7:1891116-1891138 CAGCACAAGGACGAGGGGTGCGG + Intronic
1019849498 7:3540114-3540136 AAGAAGAGGGAGGCCGGGTGTGG + Intronic
1020080244 7:5282859-5282881 AAGAGGGAGGAGGAGGGGGGAGG + Intronic
1020120552 7:5500842-5500864 CAGAACACGGAGGAGGGCTGGGG + Exonic
1020214855 7:6182338-6182360 AAGAAGCAGGAGGCTGGGTGCGG - Intronic
1020221331 7:6240414-6240436 AAGAAAAATGAGGTGGGGAGGGG + Intronic
1020605316 7:10330164-10330186 AAGAACAAAGAGAAGGGAAGTGG - Intergenic
1020903095 7:14030297-14030319 AAGAACAAGGTGGAGGGAGCTGG + Intergenic
1021289380 7:18823989-18824011 AAGAAGAAGGAGAAGGGGAATGG + Intronic
1021316003 7:19147708-19147730 AAGAAAAAGGAGTAAGGGGGAGG - Intergenic
1021622461 7:22562254-22562276 AAGAAGAAGGAGGAGGAGGAGGG - Intronic
1021844247 7:24748665-24748687 AAGAAAGAGAAGGAGGAGTGGGG - Intronic
1021927362 7:25546250-25546272 CAGGGCAAGGAGGAGGGGTTGGG + Intergenic
1021962981 7:25891173-25891195 AAGGACAAGGAGAATGGCTGGGG - Intergenic
1023176473 7:37440478-37440500 AAAAACAAAGAGGCTGGGTGTGG + Intronic
1023596390 7:41833351-41833373 AGGAAAATGGAGGAGAGGTGGGG - Intergenic
1023624281 7:42100741-42100763 AAGAAAAAGAAGAGGGGGTGGGG + Intronic
1023628595 7:42140809-42140831 AAGAAAAAGGAGGAGGGCCGAGG + Intronic
1024116985 7:46204049-46204071 AAGAGCCAGAAGGAGGGCTGTGG - Intergenic
1024503542 7:50140694-50140716 AAGAATATGGAGGAGGGATCTGG + Intronic
1024721003 7:52137363-52137385 AAGAAGAAGGAGGAGGAGGGGGG + Intergenic
1024721004 7:52137366-52137388 AAGAAGGAGGAGGAGGGGGGAGG + Intergenic
1024777923 7:52809715-52809737 AAAAACAGGGAGGAGTGGTGGGG + Intergenic
1024846259 7:53646192-53646214 AAGAAGAAGGAGGAGGAGGAAGG - Intergenic
1025004267 7:55342861-55342883 AAGACCAAGGACAAGGGCTGAGG + Intergenic
1025231655 7:57206849-57206871 AAGAAAGAGGTGGAGGGGAGGGG - Intergenic
1025481392 7:60988138-60988160 AGAAAAAAGGAGGAGGGGGGAGG - Intergenic
1025950684 7:66143072-66143094 AGGATCAGGGAGGAGGAGTGAGG - Intronic
1026217662 7:68364012-68364034 AAGAAGAAGGAGGAGGGCGAAGG - Intergenic
1026298780 7:69079076-69079098 AAAAAGATGGAGGAGGGGAGGGG + Intergenic
1026379501 7:69784762-69784784 AAGAAGAAAGAGGAGGCATGTGG + Intronic
1026679033 7:72451378-72451400 AAGAAGGAGGAGGAGGAGTGGGG + Intergenic
1026700150 7:72634165-72634187 AAAAAAAAGGAGGTGGGGAGAGG - Intronic
1026777142 7:73237602-73237624 CTGAACAAGCAGAAGGGGTGAGG - Intergenic
1026797193 7:73373913-73373935 AAGTCCAGGGAGGAGCGGTGAGG - Intergenic
1026802276 7:73407885-73407907 AAGAAAAAGGAGCAGCGGGGTGG + Intergenic
1026863309 7:73807884-73807906 AGGCAGAAGAAGGAGGGGTGGGG + Intronic
1027017988 7:74790974-74790996 CTGAACAAGCAGAAGGGGTGAGG - Intergenic
1027070036 7:75154953-75154975 CTGAACAAGCAGAAGGGGTGAGG + Intergenic
1027186541 7:75974815-75974837 AAGAAAAAAGAGGCTGGGTGCGG - Intronic
1027453957 7:78364029-78364051 GAGAAGAAGGAGGAGGGAGGAGG - Intronic
1027856230 7:83515167-83515189 AAGGAAAAGGAGGAGAGGAGGGG - Intronic
1028055826 7:86241328-86241350 AAAAAGAAGGAGAAGGGGAGAGG + Intergenic
1028224539 7:88234354-88234376 AAGAAAAAGGGGCAGGGGTGAGG - Intergenic
1028246828 7:88489565-88489587 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1028248025 7:88505989-88506011 AAGAAAATGGAGGTGGGCTGGGG - Intergenic
1028417059 7:90592026-90592048 TGGAACAAGGAGGAGAGATGAGG + Intronic
1028625264 7:92870479-92870501 AAAAAAAAGGAGGCCGGGTGTGG + Intergenic
1029026582 7:97423269-97423291 AAGAGAGAGGAGTAGGGGTGAGG - Intergenic
1029139462 7:98400331-98400353 AAGAACCAAGAGGAGGGGGAGGG + Intronic
1029298982 7:99563606-99563628 AAGAAAAAGGAGGCTGGGTGCGG - Intronic
1029527653 7:101104852-101104874 AACACCAAGGAGGCCGGGTGTGG - Intergenic
1029574986 7:101397529-101397551 AAAAAAAAGGAGGGGGGGGGAGG - Intronic
1029678509 7:102090675-102090697 AAAAAAAAAGAGGCGGGGTGCGG - Intronic
1029886461 7:103877810-103877832 AAGAAGAAGGAGGAGGAGGAAGG - Intronic
1029905909 7:104093304-104093326 GAGACCAAGGAAGAGGGGAGAGG - Intergenic
1030028644 7:105349154-105349176 AAGAAAGAGGGGGAGGGGAGGGG + Intronic
1030583100 7:111384314-111384336 AAGGAGAAGGAGGAGGGAGGAGG + Intronic
1030982585 7:116204252-116204274 AAAAACAAGGAGGCCAGGTGTGG - Intergenic
1031838615 7:126709479-126709501 AAGAAGAAGAAGGAGGAGGGAGG + Intronic
1031838616 7:126709482-126709504 AAGAAGAAGGAGGAGGGAGGAGG + Intronic
1031943596 7:127815493-127815515 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
1032624335 7:133573638-133573660 AAGAAAAGAGAGGAGGGGAGGGG - Intronic
1032683750 7:134210223-134210245 AAGAAACAAGAGGAGGGCTGGGG - Intronic
1032962040 7:137046859-137046881 CAGAAGAAGGAGGAGGGGGAAGG + Intergenic
1033133344 7:138764229-138764251 AAGGAGATGGAGGAGGGGTGAGG + Intronic
1033635168 7:143205378-143205400 AAGAACAAAGAGGCGGGGCATGG + Intergenic
1033683556 7:143619962-143619984 AAAATCAAGGTGGAAGGGTGTGG - Intergenic
1033701057 7:143837676-143837698 AAAATCAAGGTGGAAGGGTGTGG + Intergenic
1033798734 7:144876782-144876804 AAAAACAAGGAGGCAGGGGGCGG + Intergenic
1033912869 7:146285933-146285955 AAGGAAAAGGGGGAGGGGAGGGG - Intronic
1034275844 7:149823532-149823554 AAGAAGGAGGAGCAGGAGTGTGG - Intergenic
1034643753 7:152625934-152625956 AGGAACAAGGGGGTGGGGGGCGG + Intergenic
1034882980 7:154776450-154776472 AAGAAAATGGAAGCGGGGTGGGG - Intronic
1034945486 7:155259156-155259178 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1035038051 7:155908168-155908190 AGGGAGAAGGGGGAGGGGTGGGG + Intergenic
1035584385 8:760810-760832 GAGAGCAAGTGGGAGGGGTGGGG - Intergenic
1035840691 8:2809656-2809678 AGGAACAGAGATGAGGGGTGAGG - Intergenic
1036561967 8:9905830-9905852 AGGAAGAAGGGGGAGGGGAGGGG + Intergenic
1036789154 8:11706762-11706784 AAGTACAATCAGAAGGGGTGGGG - Intronic
1036987982 8:13557930-13557952 AAGAACAAGGAGAAGGTTGGAGG + Intergenic
1037096444 8:14992638-14992660 TTGAACGAGGAGGATGGGTGGGG - Intronic
1037277718 8:17199660-17199682 AAGAAGAAGAAGGAGGGAGGAGG - Intronic
1037568890 8:20141719-20141741 GAGGGCAAGGAGGAGGGGAGGGG + Intergenic
1038075251 8:24066020-24066042 AAGAACAAAAAGGAGGAGTTTGG + Intergenic
1038154820 8:24979385-24979407 AAGAACCAGTGGGAGAGGTGAGG + Intergenic
1039583840 8:38688746-38688768 GAGAACAAAGGGGTGGGGTGGGG - Intergenic
1039827273 8:41185192-41185214 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
1039889566 8:41674843-41674865 AAGAACAAGGAGGAAGGAGTGGG + Intronic
1040029588 8:42812672-42812694 AAGAATCAGGAGGCTGGGTGTGG + Intergenic
1041023079 8:53657777-53657799 CAGAGCAAGGATGGGGGGTGGGG - Intergenic
1041177554 8:55212120-55212142 AAAAAAAAGGCAGAGGGGTGGGG + Intronic
1041267607 8:56080332-56080354 AAGAAGAAGGAGGAGGGGGAGGG + Intergenic
1042100568 8:65271516-65271538 ATGAAAAAGGAGGACGGGGGAGG + Intergenic
1042161244 8:65897907-65897929 AAAAATAAGGAGGCCGGGTGCGG - Intergenic
1042488838 8:69376573-69376595 AACAACAGGGAGGCGGGGAGAGG - Intergenic
1042505003 8:69550472-69550494 AAGAAAAAGGTGGAATGGTGAGG + Intronic
1042696360 8:71558042-71558064 ATGAAAACGGAGGAGGGGTTGGG - Intronic
1042730904 8:71933936-71933958 AAGAAGAAGGGGAAGGGATGAGG - Intronic
1042889336 8:73589972-73589994 AAGAAGAAAGAGGAGGGAGGAGG + Intronic
1043091702 8:75912735-75912757 AAGAAGAAAGAGGAAGGGTCTGG + Intergenic
1043812951 8:84765294-84765316 AAGAACAAGGAGAGGTAGTGGGG + Intronic
1044662690 8:94606805-94606827 AAGAAAAAAGAGGCCGGGTGCGG + Intergenic
1044750714 8:95412871-95412893 GAGAAGAAAGAGGAGGGGTTGGG - Intergenic
1044831147 8:96250675-96250697 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
1044831150 8:96250678-96250700 AAGAAGGAGGAGGAGGAGGGGGG + Intronic
1045054020 8:98353828-98353850 AGGAACCAGGAGGAGAGGTATGG + Intergenic
1045355168 8:101380481-101380503 AAGCACAAAGAGGCCGGGTGTGG - Intergenic
1045846374 8:106641867-106641889 GAGAACAAGATGGATGGGTGAGG + Intronic
1046225923 8:111280278-111280300 AAGAACAAAGAGGCAGTGTGAGG - Intergenic
1046612884 8:116445248-116445270 AAGAAGCAGGAGGAGGAGAGAGG + Intergenic
1046641601 8:116737741-116737763 AAGAACAATGAGGCCAGGTGCGG + Intronic
1046929337 8:119826874-119826896 AAGAAGGAGGAGGCTGGGTGTGG - Intronic
1047247844 8:123160404-123160426 AAGAAAAGGGAGGAGAGGAGGGG + Intergenic
1047404955 8:124577741-124577763 AAGAACAAGGAGCAGAGGGTGGG - Intronic
1047711073 8:127553005-127553027 AAGGACAATGAGGAGGGCAGAGG + Intergenic
1048059313 8:130901229-130901251 AAAAAAAAAGAGGAGGGATGGGG - Intronic
1048103651 8:131383159-131383181 AGGAACAAGAAGGAGTGGGGAGG + Intergenic
1048188949 8:132271002-132271024 AAAGACAAGGAGGAGTGATGTGG + Intronic
1048213767 8:132478708-132478730 AGGAACCAGCAGGAAGGGTGGGG - Intronic
1048489389 8:134878482-134878504 AAGAACAATAAGGCTGGGTGCGG - Intergenic
1049055010 8:140229560-140229582 AAGAAAAAAGAGGCCGGGTGCGG - Intronic
1049273127 8:141706645-141706667 AAGGACACGGAGGAGGGGCAGGG + Intergenic
1049361046 8:142212775-142212797 GAGAAGGAGGAGGAGGGGAGAGG - Intronic
1049429054 8:142550809-142550831 AAGGACACGGAGGAGAGGTGGGG - Intergenic
1049825787 8:144666926-144666948 AGGACCAAGGAGGAGGGGCTTGG - Intergenic
1049846772 8:144806311-144806333 AAGAACATGGCTGTGGGGTGAGG + Intronic
1050108321 9:2188928-2188950 TGGAACAAGGGGTAGGGGTGGGG - Intronic
1050358547 9:4805390-4805412 AAGAAGAAGGAGAAGGGGAAGGG + Intronic
1050583899 9:7090011-7090033 AAGTACAAAGAGGAGGCTTGGGG - Intergenic
1050609110 9:7332891-7332913 AAGGACAAGGAGGGGAGGAGAGG - Intergenic
1050727715 9:8670764-8670786 AAGAACTAAGACTAGGGGTGTGG + Intronic
1051141003 9:13978870-13978892 AAGAAAAAGAAGAAGGGGAGTGG - Intergenic
1051188213 9:14482449-14482471 AAGAACATGGTGAGGGGGTGAGG - Intergenic
1051546739 9:18283938-18283960 AAGAAGAAGAAGGCTGGGTGTGG + Intergenic
1051872534 9:21755108-21755130 AAAACCAAGGAGGAGGGGTGGGG - Intergenic
1052037443 9:23698743-23698765 AAGAAGAAGGGGGAGTGGGGCGG + Intronic
1052179504 9:25506677-25506699 AAGAAGAAAGAGAAAGGGTGGGG + Intergenic
1052374251 9:27699913-27699935 AAGAAAAAGAAGAAGGGATGTGG + Intergenic
1052531182 9:29686295-29686317 GAGAAGGAGGAGGAGGGGAGAGG + Intergenic
1052594986 9:30545697-30545719 GAAAAAAAGGAGGTGGGGTGGGG - Intergenic
1052595768 9:30556648-30556670 AAGAACAAGGAAAATGAGTGAGG + Intergenic
1052666501 9:31501380-31501402 AATAACAATGAGGCTGGGTGCGG - Intergenic
1052862184 9:33443904-33443926 AAGAACAGGCAGGGAGGGTGAGG + Intronic
1052976791 9:34417057-34417079 AAGAAGAAGGAGAAGGGGAAGGG - Intronic
1053008755 9:34621590-34621612 AAAAACAAGCAGGAGGGGGTAGG + Intronic
1053303022 9:36965059-36965081 TGGAGCAAGGAGAAGGGGTGTGG - Intronic
1054452851 9:65412685-65412707 AAGGACAAGGAGAAGCAGTGTGG - Intergenic
1055080270 9:72261818-72261840 AAGAAGGAGGAGGAGGGGGAGGG - Intergenic
1055842196 9:80518962-80518984 AAAAACAAAGAGGCAGGGTGTGG - Intergenic
1056430995 9:86527615-86527637 AAGAACAAGAAGAAGAGGTTGGG + Intergenic
1056470808 9:86903226-86903248 AGAAAAAAAGAGGAGGGGTGGGG - Intergenic
1056482061 9:87015922-87015944 GAGAACAAGTGGGAGGGGAGGGG + Intergenic
1056691297 9:88810857-88810879 AAAAACAAGGAGGAAGGGGAAGG - Intergenic
1056925508 9:90830873-90830895 AAGAAAGAGGAGGCCGGGTGTGG - Intronic
1057191796 9:93092525-93092547 AAGAACAGAGATGGGGGGTGGGG + Intergenic
1057593042 9:96390591-96390613 AAAGACAAGGAGGCGAGGTGCGG + Intronic
1058254462 9:102743727-102743749 AAGCATAAGGAGGATCGGTGGGG - Intergenic
1058483160 9:105417396-105417418 AAGACCAAGCAGGAGGGAGGAGG - Intronic
1058508069 9:105687006-105687028 AAGAATAAGATGGATGGGTGAGG - Intergenic
1058578247 9:106426186-106426208 AAGGACAAGGTGAAGGGGGGTGG + Intergenic
1058649769 9:107164431-107164453 AAGAACCAGGAGGAACGGAGAGG - Intergenic
1059258847 9:112956458-112956480 AACAAAAAGGCGGGGGGGTGGGG + Intergenic
1059974497 9:119701120-119701142 ATGAACAGGGAAAAGGGGTGAGG + Intergenic
1060030392 9:120209919-120209941 AAGAACAAGGATTAGAGGTAAGG + Intergenic
1060172890 9:121476302-121476324 TGGAGCAAGGAGGTGGGGTGGGG - Intergenic
1060180838 9:121532632-121532654 AAGAAAAAAGAGGCCGGGTGTGG - Intergenic
1060259838 9:122064766-122064788 AAGACAAAGGAGGAGGGAAGAGG + Intronic
1060294076 9:122331464-122331486 CAGAACTAGGAGTAGGCGTGAGG - Intergenic
1060561451 9:124548133-124548155 AAGAGCAAGGGGGAGGGGGGAGG + Intronic
1060731215 9:126038201-126038223 AAAAATTAGGAAGAGGGGTGGGG + Intergenic
1060744779 9:126124115-126124137 GAGAACAGTGAGGAGGGCTGGGG + Intergenic
1060914023 9:127374009-127374031 AAAAAAAAGGAGGCTGGGTGCGG + Intronic
1061288414 9:129637342-129637364 AAGGAAAAGGGGCAGGGGTGGGG + Exonic
1061306622 9:129736251-129736273 AAGCTCAAGGTGGAGGGGTCTGG + Intergenic
1061412293 9:130428210-130428232 AAGAGCTAGCAGAAGGGGTGGGG + Intronic
1061419359 9:130464763-130464785 AAGGTCAAGCTGGAGGGGTGGGG - Intronic
1061541621 9:131280538-131280560 AATGAGAAAGAGGAGGGGTGGGG + Intergenic
1062074727 9:134579744-134579766 AAGAAGGAGGAGGAGGGGGAGGG + Intergenic
1062080848 9:134622617-134622639 AAGAGGAGGGAGGAGGGGGGAGG - Intergenic
1062080879 9:134622716-134622738 AAGAGGAGGGAGGAGGGGGGAGG - Intergenic
1062080910 9:134622817-134622839 AAGAGGAGGGAGGAGGGGGGAGG - Intergenic
1062271820 9:135713355-135713377 CAGAACAAGGAGCAGGGTTTGGG + Intronic
1062299958 9:135860673-135860695 AAGAAGACGGCGGAGGGGTTGGG - Intronic
1062460507 9:136660796-136660818 AAGAAGAGGAAGGAAGGGTGAGG + Intronic
1062638367 9:137503445-137503467 AAGGAGAAGGAGGAGGGGGAAGG + Intronic
1062638374 9:137503464-137503486 AAGGAGAAGGAGGAGGGGGAAGG + Intronic
1062638381 9:137503483-137503505 AAGGAGAAGGAGGAGGGGGAAGG + Intronic
1062638393 9:137503521-137503543 AAGGAGAAGGAGGAGGGGGAAGG + Intronic
1203687607 Un_GL000214v1:10039-10061 AAGAACAAGCAGGCCGGGCGCGG + Intergenic
1203714400 Un_KI270742v1:130259-130281 AAGAACAAGCAGGCCGGGCGCGG - Intergenic
1203536807 Un_KI270743v1:47826-47848 AAGAACAAGCAGGCCGGGCGTGG + Intergenic
1203648668 Un_KI270751v1:94014-94036 AAGAACAAGCAGGCCGGGCGCGG - Intergenic
1185529311 X:804890-804912 AAGGACAAGGAGGATTGGGGTGG + Intergenic
1185814493 X:3142397-3142419 AAGAAGAAGGAGGAGGAGGTGGG + Intergenic
1185814984 X:3146307-3146329 AAGAAGAAGGAAGAGGGAGGAGG - Intergenic
1186047322 X:5550476-5550498 AAGAAGGAGGAGGAGGGGAAGGG - Intergenic
1186108220 X:6227951-6227973 AAGAATAAGGGGGGGGGGTGGGG + Intronic
1186367742 X:8913062-8913084 AGGGACCAGGAGGAGGGTTGGGG + Intergenic
1187013930 X:15307707-15307729 AAGCACCCCGAGGAGGGGTGAGG + Intronic
1187195587 X:17080429-17080451 AAGAACAAGGTGGTGGTGTGGGG - Intronic
1187316770 X:18203132-18203154 AAGGAAAAGGAGGATGGGTTTGG + Intronic
1187343462 X:18442001-18442023 AGCAGCAGGGAGGAGGGGTGGGG - Intronic
1187492056 X:19761186-19761208 GAAAACAAGGAGGAGGGAGGGGG + Intronic
1188305211 X:28553507-28553529 AAGAATATGGAGGAGGGTGGAGG + Intergenic
1188346461 X:29072598-29072620 AAGAACCAGCAGGAGGTGAGGGG - Intronic
1189314008 X:40040901-40040923 AAGGAGAAGGAGGAGGGGCCAGG - Intergenic
1189481340 X:41394451-41394473 CAGAAGAAGGAGGAGGGATTAGG + Intergenic
1189496891 X:41516675-41516697 AGCAAGAAGGAGGAGGGATGAGG + Intronic
1189737775 X:44089074-44089096 ATGAAGAAGGAGGAGGGTTGGGG + Intergenic
1189737782 X:44089102-44089124 AAGAACAAGGAGGAGGGTTTGGG + Intergenic
1189812016 X:44789616-44789638 TAGAACAAGGAGGCAGGGAGGGG + Intergenic
1189880366 X:45485245-45485267 AAGAAGAAAGAGGCTGGGTGTGG - Intergenic
1189881943 X:45503229-45503251 AAGAACAAATAAGAGGGTTGAGG - Intergenic
1190055427 X:47178669-47178691 TAGAGCTAAGAGGAGGGGTGCGG + Intronic
1190059918 X:47204041-47204063 AACAAGAAAAAGGAGGGGTGAGG - Intronic
1190075024 X:47310716-47310738 CACAAGATGGAGGAGGGGTGTGG - Intergenic
1190223751 X:48530054-48530076 AAAAAAAAGGAGGTGGGGGGTGG + Intergenic
1190727248 X:53197627-53197649 AAGAACAGGTGGGAGGGGTGAGG - Intronic
1190730026 X:53219791-53219813 AATAAGAAGGAGCAGGGATGAGG - Intronic
1192311716 X:70021643-70021665 AAGAACTGGGAGGAGAGGAGAGG + Intronic
1192436443 X:71146103-71146125 AAGAAAAAGGAAGAGGAGGGAGG - Intronic
1192448076 X:71225044-71225066 AAGGAAAAGGAGGAGGTGTCTGG + Exonic
1192746379 X:73943083-73943105 AAGAAGAGGGAGGCTGGGTGCGG + Intergenic
1192831437 X:74754595-74754617 AAGAAAAAGAAGGCTGGGTGCGG - Intronic
1192930331 X:75799744-75799766 AAGAAGAAGGAAGAGTAGTGTGG - Intergenic
1194456841 X:94115243-94115265 AAGAATAAGGCGGCTGGGTGTGG - Intergenic
1194992903 X:100564044-100564066 AAGAAGGAGGAGGAGGAGTGGGG + Intergenic
1195084984 X:101405628-101405650 AAGAAAAAAGAGGCCGGGTGCGG + Intronic
1195508030 X:105681248-105681270 GAGAACAAGGAGGAGGAGACAGG + Intronic
1196686718 X:118516419-118516441 AAGAAAAAGGAGGGGAGGGGAGG - Intronic
1196686719 X:118516422-118516444 AAGAAGAAAAAGGAGGGGAGGGG - Intronic
1196717454 X:118824728-118824750 AATAACAAGGGGGACGGGCGTGG + Intronic
1196919482 X:120571021-120571043 AAAAAAAAGGGGGTGGGGTGGGG + Intronic
1197611615 X:128645366-128645388 AAGAACTTGGGGGAAGGGTGGGG - Intergenic
1197720393 X:129740946-129740968 AAAAAAAAGGAGGGGGGGCGGGG + Intronic
1197744526 X:129922705-129922727 AAAAAAAAGGAGGCTGGGTGCGG - Intronic
1197784588 X:130187394-130187416 AAGAAAGAGGAGGAGAGGGGAGG - Intergenic
1198310600 X:135424017-135424039 AAGAAGACTGGGGAGGGGTGTGG - Intergenic
1198444824 X:136701995-136702017 AAGAAAAATGAGGCCGGGTGCGG - Intronic
1198603903 X:138315143-138315165 AAGAACAAAGTGGTGGGGTTGGG + Intergenic
1198706172 X:139450819-139450841 AAGAAAAAGGAGGAGAGGGAAGG + Intergenic
1198833761 X:140779253-140779275 AAGAAAAAAAAGGAGGGGTGGGG + Intergenic
1198870394 X:141172629-141172651 AAGAACCAAGAGGCCGGGTGCGG + Intergenic
1199963302 X:152796803-152796825 AAGTACATGGAGCAGAGGTGGGG - Intergenic
1200415573 Y:2906590-2906612 AAGAAGAAGGAGGAGAGGGGAGG - Intronic
1200415619 Y:2906909-2906931 AAGGAGAAGGAGGCTGGGTGTGG - Intronic