ID: 1136452347

View in Genome Browser
Species Human (GRCh38)
Location 16:30360448-30360470
Sequence CTGTGGAGGTGGAGAGGAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 948
Summary {0: 1, 1: 1, 2: 13, 3: 97, 4: 836}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136452347 Original CRISPR CTGTGGAGGTGGAGAGGAGC AGG (reversed) Intronic
900086613 1:901296-901318 CAGTGGAGGTGGGCAGGGGCTGG + Intergenic
900146142 1:1159608-1159630 CTGTGGACATGGAGAGTGGCGGG - Intergenic
900157862 1:1210775-1210797 GTGTGGAGGGGAAGAGGGGCAGG + Intergenic
900382144 1:2390293-2390315 CTCGGGAGGTGGTGAGGAGCAGG + Intronic
900785312 1:4645940-4645962 CGGTGGTGGTGGTGAGGAGAGGG - Intergenic
900802324 1:4745089-4745111 CTGTGGAGGGGAAGAGCAGCTGG - Intronic
900848183 1:5120629-5120651 GTGTGGAGGTGGGTAGGAGTGGG - Intergenic
900914840 1:5629558-5629580 CTGTGATGATGGAGTGGAGCTGG + Intergenic
900952618 1:5866320-5866342 CGGTGGCGGAGGAGAGGAGGAGG - Intronic
900964035 1:5945193-5945215 GGGGGGAGGTGGGGAGGAGCAGG - Intronic
901436606 1:9250605-9250627 CTGCAGGGGTGGAGAGCAGCTGG - Intronic
901479963 1:9518453-9518475 CTGCGAAGGTGCAGAGGAGGGGG + Intergenic
901849126 1:12004298-12004320 CTGTGGAGGTCCAGAGGAAAGGG - Intronic
901902613 1:12378449-12378471 CTGTGGAGGATGACAGGAACAGG + Exonic
902226528 1:14999799-14999821 ATGTGGAGGTGGGGAGGCCCAGG - Intronic
902363754 1:15957439-15957461 CGGTGTATCTGGAGAGGAGCAGG + Intronic
902378977 1:16043809-16043831 CTGTCCAGGTGCAGGGGAGCTGG + Exonic
902429654 1:16352991-16353013 CAGTGGAGGTGGGGCGGCGCGGG + Intronic
902439184 1:16418159-16418181 CTGTGGGGGAGAAGAGGAGAGGG - Intronic
902467311 1:16626148-16626170 CTGGGGAGGGGGAGATGAGGAGG + Intergenic
902470803 1:16646712-16646734 GAGTGGGGGTGGAGAGGGGCAGG + Intergenic
902487997 1:16760736-16760758 GAGTGGGGGTGGAGAGGGGCAGG - Intronic
902507274 1:16946596-16946618 CTGGGGAGGGGGAGATGAGGAGG - Intronic
902912183 1:19607843-19607865 GTGTGGTGTTGGAGAAGAGCTGG + Intronic
903026143 1:20430962-20430984 GAGAGGAGGTGGAGAGGAGACGG - Intergenic
903176706 1:21585851-21585873 CTGTGGAAATGGAGAGGGGAGGG + Intergenic
903468850 1:23570871-23570893 GCGAGGAGGTGGAGAGGTGCAGG + Intergenic
903537078 1:24074124-24074146 CTGGGGAGGTGGCAGGGAGCGGG + Intronic
903651711 1:24926692-24926714 CTGTGGAGTTGGGGAGCAGAGGG + Intronic
903653580 1:24935383-24935405 CGCGGGAGGTGGAGAGGAGGTGG - Intronic
903818064 1:26079547-26079569 CTGTGGGGGTGGGGAGCGGCAGG - Intergenic
903827058 1:26154022-26154044 TGGTGGAGGTGGAGAGGTGGTGG + Intergenic
903832330 1:26182744-26182766 CTGGGGAGGTGCAGAGCAACGGG - Intronic
903917248 1:26773509-26773531 CTGGGGGAGTGGACAGGAGCTGG - Intronic
904009050 1:27379709-27379731 CTGTGGCTGTGGGCAGGAGCTGG - Exonic
904043147 1:27595591-27595613 CTGTGGTTTTGGGGAGGAGCTGG + Intronic
905224674 1:36471544-36471566 CTGTGGTGTTGCAGAGGGGCAGG + Exonic
905310340 1:37044526-37044548 CCTTGGAGGTGGAGTGGGGCTGG - Intergenic
905334991 1:37239011-37239033 CAGGGGAGGAGGAGTGGAGCTGG - Intergenic
905456870 1:38094420-38094442 CAGAGAAGGTGGAGAGGAGATGG + Intergenic
906125440 1:43424409-43424431 CAGTGAGGATGGAGAGGAGCTGG - Exonic
906273053 1:44496632-44496654 CTGTGGAGGTGGCCAAGGGCAGG - Intronic
906725352 1:48040316-48040338 CTGGGGATGGGGAGAGGAGTGGG + Intergenic
906829825 1:49019307-49019329 GTGGGGAGGATGAGAGGAGCAGG - Intronic
907327800 1:53652266-53652288 CTGAGGATGTGGAGATGAGTTGG + Intronic
907328704 1:53657612-53657634 ATGTGGAGGGGGAGAGGACCGGG + Intronic
907855686 1:58301220-58301242 ATGTGGGGGTGGAGAGGGGGGGG + Intronic
907914186 1:58853474-58853496 CTGTGCAGGAGCAGAGGAGCAGG + Intergenic
908241742 1:62194499-62194521 CTGTGGAGTTGGAGAGACGCCGG + Intergenic
908388297 1:63663040-63663062 GTGAGTAGGGGGAGAGGAGCGGG - Intergenic
908496161 1:64696977-64696999 CTGTGCTGGAGGAGATGAGCAGG + Intergenic
908777336 1:67653249-67653271 CAGTGGAAGTGGGGAGGAGTAGG - Intergenic
908807814 1:67949009-67949031 GTGTGCTGGTTGAGAGGAGCTGG - Intergenic
908816542 1:68041374-68041396 CTGTGGAGGAAGAGAAGAGGAGG - Intergenic
909132490 1:71755260-71755282 CAGTGGAGGTGAAGAGGACTCGG - Intronic
909554919 1:76942796-76942818 CTGTGGAGGTGGAGAATGACAGG - Intronic
909878626 1:80844679-80844701 GTGGGGAGGTGGAGAGCATCAGG - Intergenic
910313584 1:85856679-85856701 CAGTGGAGGTGGGGAAGAGTAGG - Intronic
910655472 1:89614125-89614147 CTCAGGAGTTGGAGAGCAGCTGG - Intergenic
911593079 1:99770176-99770198 CAGTGGAGATGGAGAAGAGGGGG - Intergenic
911730018 1:101283118-101283140 TTGGATAGGTGGAGAGGAGCAGG + Intergenic
912269020 1:108190746-108190768 CTGGGGAGGTGGAGACGTGTGGG + Intronic
912552417 1:110492714-110492736 CTGTGGGGGTGAAATGGAGCAGG + Intergenic
912552519 1:110493359-110493381 CAGAGGAGTTGGAGAGGAGTTGG - Intergenic
912582565 1:110734005-110734027 ATGGGGAGGTGGAGAGGAGAAGG + Intergenic
912707709 1:111927252-111927274 CTGAGGAGGCTGTGAGGAGCAGG + Intronic
912717052 1:111990096-111990118 CAGTGGAGGAAGAGAGGAGGAGG + Intergenic
912764463 1:112396219-112396241 CTGTGGATGGGGAGTGGAGGCGG + Exonic
913242356 1:116840074-116840096 CTCAGGAGGTGGAGAGGTGGAGG + Intergenic
913689201 1:121262388-121262410 CTCTGGAGGTGGAGAGGGAAGGG + Intronic
914148398 1:145017893-145017915 CTCTGGAGGTGGAGAGGGAAGGG - Intronic
914346897 1:146807639-146807661 CTCTGGTGGTGGGAAGGAGCTGG + Intergenic
914718850 1:150272729-150272751 CTTTGGAGGAGGAGGGGAGGCGG + Intronic
914915377 1:151816121-151816143 CTGTGGTGGTGGAGGTGTGCAGG + Intronic
915465110 1:156092795-156092817 CTGGAGAGGTGGGCAGGAGCTGG - Intronic
915482402 1:156195868-156195890 GAGTAGAGGTGGAGAGGAGGAGG + Intronic
915594588 1:156888812-156888834 CAGTGGAGGTGCTGAGGAGTGGG - Intergenic
915726637 1:158022781-158022803 ATGCAGATGTGGAGAGGAGCTGG - Intronic
916029418 1:160863093-160863115 TTGTGGAGGTGGAGTGGAGAGGG + Intergenic
916299337 1:163256432-163256454 GTTTGGAGGTAGAGGGGAGCAGG + Intronic
916452432 1:164933882-164933904 CTGGGGAGTGGGAGTGGAGCTGG + Intergenic
917271179 1:173276348-173276370 TGGTAGAGGTGGAGAGGAGAAGG - Intergenic
917486359 1:175458530-175458552 CTGTGGAGGTGAGCTGGAGCTGG + Intronic
917727254 1:177839590-177839612 GTGTCGGGGTGGAGAGGAGAAGG - Intergenic
917963822 1:180166156-180166178 CTGGGGGGATGGCGAGGAGCAGG + Intronic
918040200 1:180909330-180909352 CTGGGGAGTTGGGGAGGGGCAGG - Intergenic
918093336 1:181315756-181315778 TTTTGACGGTGGAGAGGAGCGGG + Intergenic
918242852 1:182635335-182635357 GTGAGGAGGGGGTGAGGAGCTGG - Intergenic
918475249 1:184917676-184917698 CTTTTGAGGTGGACAGGAGGAGG - Intronic
919728771 1:200900059-200900081 CTGGGCAGGTGGAGAGGACCTGG + Intronic
920476524 1:206280863-206280885 CTCTGGAGGTGGAGAGGGAAGGG + Intronic
920989473 1:210922878-210922900 ATGAGGAGGTGGAGAGTAGGTGG - Intronic
921189811 1:212699556-212699578 CTGCGGAGGTGCAGAGGTGGCGG - Intronic
921292489 1:213671370-213671392 GTGGGGAGGTGGAGGGGAACGGG + Intergenic
921956973 1:220994884-220994906 CTGTGGATGTGGTGGGGAGAAGG + Intergenic
922345643 1:224694075-224694097 CTGTGGAGGAGGAGAGGAGAGGG + Intronic
922504453 1:226118535-226118557 GTGTGGAGGAGGGGAGGAGATGG + Intergenic
922627654 1:227065733-227065755 CTTTGGAGGAGGAGAGGCACTGG + Intronic
922796918 1:228344819-228344841 CTGTGGAAGTAGGGTGGAGCTGG - Intronic
923162203 1:231324177-231324199 CTGTGGTGGTGGGGGGAAGCGGG + Intergenic
923271258 1:232357172-232357194 CAGTGGAGGTGGTGAGGCGTGGG + Intergenic
923482327 1:234397196-234397218 CTGTGAAGGGGAAGAGGAGGAGG + Intronic
923918088 1:238530745-238530767 CTGTGGAGATGGTGTGGACCAGG - Intergenic
1062817744 10:513434-513456 CTGTGGTGGATGAGAGGTGCGGG - Intronic
1064325135 10:14343433-14343455 GAGGGGAGATGGAGAGGAGCTGG - Intronic
1065866419 10:29919059-29919081 GGGAGGAGGTGGAGAGGAGGAGG - Intergenic
1066215165 10:33279433-33279455 CTCTGAAGATGGAGAGGATCTGG - Intronic
1066402526 10:35090081-35090103 CTGGGGCGGAGGAGAGGAGTTGG - Intronic
1066453095 10:35549164-35549186 CTGGTGAGGTGGGGAGGGGCAGG - Intronic
1067087567 10:43250922-43250944 GGGTGGAGGTGGAGACGTGCAGG + Intronic
1067716215 10:48692926-48692948 GTTTGAAAGTGGAGAGGAGCAGG + Intronic
1067817558 10:49493842-49493864 CTTTGGTGGTGTAGAGGAGCAGG - Intronic
1069041422 10:63699476-63699498 GTGTGGAAGTGGAGAGGAGAGGG + Intergenic
1069893155 10:71664473-71664495 CCGTGGAGGTGGAGCGGAAGTGG - Intronic
1069930801 10:71880441-71880463 CTGGAGAGGTGGAGAGGTGGAGG - Intergenic
1070307602 10:75248865-75248887 CTGTGGAGGTTTGGAGGAGAAGG - Intergenic
1070476273 10:76832274-76832296 AGGTGGAGGTTGAGAGGATCAGG + Intergenic
1070573986 10:77663318-77663340 CTGTGGAGGAGGGGAGAAGGTGG - Intergenic
1070647570 10:78212389-78212411 CAGTGGAGCTGGAGAGCAGAAGG - Intergenic
1070846333 10:79525096-79525118 CTGTGGAGGGGCAGAGGAGGAGG - Intergenic
1070927464 10:80235210-80235232 CTGTGGAGGGGCAGAGGAGGAGG + Intergenic
1071292654 10:84198600-84198622 CTGTGGTGGTGGAGAGCAGGTGG - Intronic
1071294179 10:84207254-84207276 GTGAGGAGGAGGAGAGGGGCAGG + Intronic
1071468973 10:85965923-85965945 CTCTGGAGCTGGGGAGGAGGTGG - Intronic
1071571574 10:86700195-86700217 CTGTGGGGCAGGAGAGCAGCAGG - Intronic
1072076188 10:91976413-91976435 CTCTGGAGGTGGGGAGCAGGAGG + Intronic
1072343059 10:94474486-94474508 TTTTGGAGGTGGAGGGGAGCTGG - Intronic
1072798106 10:98372078-98372100 AAGTGGAGGTGGAGATGGGCGGG - Intergenic
1073100240 10:101002662-101002684 CCGTGGTGGCGGGGAGGAGCTGG - Exonic
1073137154 10:101226374-101226396 CTGTGGAGGAGGTGAGGTGAGGG + Exonic
1073789624 10:106927517-106927539 CTGTGGAAGGGGACATGAGCGGG + Intronic
1074120798 10:110493294-110493316 CTGAGGAGCTGGGGAGGAGCTGG + Intergenic
1074153988 10:110782643-110782665 CTGGGGAGGTGGCGGGGAGAAGG - Intronic
1074562297 10:114545125-114545147 CTGAGGAGGTGGCCAGGGGCTGG + Intronic
1074895127 10:117770801-117770823 CTGTCTGGTTGGAGAGGAGCTGG - Intergenic
1074949239 10:118312893-118312915 CTGTGGGGCTGGGGAGGAGTTGG + Intronic
1075167850 10:120085327-120085349 CTATGGAGGTGGAGGGGAGGAGG + Intergenic
1075492165 10:122880324-122880346 CTGTTTTGGTGGAGAGGAGGTGG - Intergenic
1075688521 10:124380045-124380067 CAGAGGAGGTGGGGAAGAGCTGG - Intergenic
1076426830 10:130372981-130373003 CCCTGGAGGTAGAGAGGAGAGGG - Intergenic
1076434770 10:130432544-130432566 ATTTGCAGGTGGAGAGGAGCTGG + Intergenic
1076822428 10:132946145-132946167 CTGTGGAGGCACAGGGGAGCAGG + Intergenic
1077268991 11:1666294-1666316 CGGGGAAGGAGGAGAGGAGCAGG - Intergenic
1077343763 11:2037281-2037303 GTGGGGAAGTGGAGAGGAGAAGG - Intergenic
1077363136 11:2149696-2149718 ATGTGGAGGTGGTGGGGAGTGGG + Intronic
1077528146 11:3081094-3081116 CTGGAGAGGTGGTGAGGAGGTGG + Intergenic
1077699952 11:4432040-4432062 CAGTGGAGGTGCAGAGGACCAGG + Intergenic
1077737236 11:4804140-4804162 GAGTGGAGGAGGAGAGGACCAGG + Exonic
1077896077 11:6454548-6454570 CTAGGGAGTTGGAAAGGAGCTGG + Intronic
1077914651 11:6603532-6603554 CTGTGCACGTGGAGAAGAGCGGG - Exonic
1078470575 11:11582868-11582890 CTGTGGCTGTGGTGAGGAGTTGG - Intronic
1078868953 11:15326312-15326334 TTGGGGAAGTGGAGAGGAGAAGG + Intergenic
1080517975 11:33040773-33040795 GTCTGGAGGGGGAGAGGAGGGGG - Intronic
1080700503 11:34640210-34640232 CTTTGGAGCTGGAGAGATGCAGG - Intronic
1080846988 11:36035335-36035357 CTGTGGCGGTGGAGGTGGGCAGG - Intronic
1081816373 11:45945842-45945864 CTGTGGAGGTGGGGCTGGGCAGG + Exonic
1081992503 11:47345415-47345437 ATGGGGACGGGGAGAGGAGCTGG - Intronic
1083612766 11:64011990-64012012 CAGTGGAGGTGGTGGGGAGGGGG - Intronic
1083622418 11:64055750-64055772 CTGAGGCAGTGCAGAGGAGCAGG - Intronic
1083725017 11:64623386-64623408 CCTTGGAGCTGGAGAGGAGAGGG - Intronic
1083831437 11:65236363-65236385 CTGAGGAGGAGGGGAGGAGAGGG - Intergenic
1083877521 11:65532084-65532106 GTGGGCAGGTGGGGAGGAGCAGG + Intronic
1084138637 11:67207812-67207834 CTGAGGAGTTTGAGAGCAGCCGG + Intronic
1084188678 11:67488995-67489017 CTGTGGTGGGGGTGAGGAGGGGG + Intronic
1084494902 11:69498041-69498063 ATGTGTAGGTGGAGGGGTGCAGG + Intergenic
1084494972 11:69498301-69498323 AAGTGTAGGTGGAGAGGTGCAGG + Intergenic
1084495021 11:69498501-69498523 AAGTGTAGGTGGAGAGGTGCAGG + Intergenic
1084495032 11:69498541-69498563 ATGTGTAGGTGGAGGGGTGCAGG + Intergenic
1084601812 11:70150133-70150155 CCGTGGGGGTGGAGAGGAAATGG + Intronic
1084642589 11:70434682-70434704 CTGTGGAGGGGGTGGGGAGATGG - Intronic
1084774048 11:71363977-71363999 CTGGGGAGGTGGAGGTGCGCGGG + Intergenic
1084796553 11:71509895-71509917 ATGGGTAGGTGGGGAGGAGCAGG + Intronic
1084869921 11:72091457-72091479 CTGAGGAGGAGGAGAGGTGGGGG + Intronic
1085518861 11:77126635-77126657 GTGTGGTGGTGGGGAGAAGCAGG + Intergenic
1085707583 11:78800487-78800509 ATGAGGAGGTGGGGAGGAGGTGG + Intronic
1085850851 11:80117928-80117950 ATGTGGCATTGGAGAGGAGCTGG - Intergenic
1086162641 11:83739835-83739857 CAGTGCAGCTGGAGAGGAGCTGG + Intronic
1086273394 11:85095593-85095615 CTGTGAAGAGGGATAGGAGCTGG - Intronic
1086392923 11:86384308-86384330 CTGTGGGGGTGGGGAGGAGTGGG + Intronic
1086888276 11:92226904-92226926 GTCTGGGGGCGGAGAGGAGCGGG - Intergenic
1087539568 11:99498565-99498587 CTGTGGAGGTGGGTGGGAGTAGG - Intronic
1088627768 11:111744023-111744045 CTGTGTAAGTGGAGAGAAGCGGG + Intronic
1088843260 11:113644281-113644303 CTGTGGGGGTGGGGAGGAGCTGG - Intergenic
1089194285 11:116684053-116684075 GGGTGGGGGTGGAGGGGAGCGGG - Intergenic
1089436442 11:118472829-118472851 AGGTGGAGGTGGAGACGAGGAGG - Exonic
1089624249 11:119741370-119741392 GTGGGGAGGCGGAGAGGAGGTGG - Intergenic
1089650261 11:119908327-119908349 CTGGGGAGGTGGAGCAGGGCTGG + Intergenic
1089794607 11:120970246-120970268 GTGTGGTGGTGCAGAGGTGCTGG + Intronic
1089849044 11:121481200-121481222 CTGTGCACTAGGAGAGGAGCTGG - Intronic
1089849088 11:121481416-121481438 CTGTGCACTAGGAGAGGAGCTGG - Intronic
1090086398 11:123654409-123654431 CTGGGGAGGTGCAGCGGGGCCGG + Exonic
1090403879 11:126465935-126465957 GCGGGGAGGTGGTGAGGAGCAGG + Intronic
1090431976 11:126653777-126653799 CTGAGAAGGTGGAGAAGGGCAGG + Intronic
1091113595 11:132993983-132994005 CTGCGGAGGTGGAGAGATGCGGG - Intronic
1091355980 11:134937965-134937987 GAATGGAGGTGGGGAGGAGCAGG + Intergenic
1202826749 11_KI270721v1_random:92470-92492 GTGGGGAAGTGGAGAGGAGAAGG - Intergenic
1091626690 12:2126584-2126606 AAGTGGAGGTGGAGAGAAGACGG + Intronic
1091847152 12:3666076-3666098 CTCTGGTGGTGGGGAGGAGGGGG + Intronic
1092135329 12:6142993-6143015 CTGTGGAAGGGGACCGGAGCGGG - Intergenic
1092174542 12:6394194-6394216 CTGTTGGGGAGGAGAGAAGCCGG - Intergenic
1092264382 12:6969970-6969992 CTGTGGTCGTGGAGAGGAGCAGG - Intronic
1092598851 12:10036569-10036591 CTGTGGATGTGTAGAAGAGAAGG - Intronic
1092887962 12:12941956-12941978 GTGTGAAGGTGAAGAGCAGCAGG - Intronic
1093189543 12:16058212-16058234 CTGTGGAAGGGGACCGGAGCGGG - Intergenic
1093254739 12:16853437-16853459 TTAGGGAGGTGCAGAGGAGCAGG - Intergenic
1093711279 12:22333026-22333048 CTGGGGAGGTGGAGAGGAAGGGG + Intronic
1095248136 12:39946249-39946271 CAGTGGAGGTTGTGGGGAGCAGG + Intronic
1095370859 12:41465731-41465753 CAGTGGAGATGAAGAGGAGCAGG + Intronic
1095919260 12:47513043-47513065 TTGTGGAGGGGGAGGGGAGAGGG + Intergenic
1096243586 12:49972458-49972480 CTGTGGGGTTGCAGAGGGGCGGG - Intronic
1096561271 12:52437670-52437692 CTGTGGAGGAGGAGAGGAAGTGG + Intergenic
1096816893 12:54207469-54207491 CAGTGGAGGTGGGGGGAAGCAGG + Intergenic
1096886159 12:54721350-54721372 CTGAGGAGGAGGAGGGGAGGAGG - Intergenic
1096886182 12:54721434-54721456 CTGAGGAGGAGGAGGGGAGGAGG - Intergenic
1096979355 12:55719476-55719498 CTGGGAAGGGGGAGAGGAGGTGG - Intronic
1097021173 12:56021664-56021686 CTGAGGAGATGGAGAGGATGGGG + Intronic
1097369269 12:58757008-58757030 ATGTGGAGGTGGCAGGGAGCTGG + Intronic
1098645697 12:72898041-72898063 CTGTAGACGAGGAGAGGAGGTGG + Intergenic
1100164290 12:91898871-91898893 CTGTGGTGGAGAAAAGGAGCAGG - Intergenic
1101323955 12:103698284-103698306 CTGTGGGGAAGGAGAGGAGAAGG - Intronic
1101640938 12:106585310-106585332 CAGTTGAGGTGAAGAGGACCCGG - Intronic
1102427892 12:112858795-112858817 CTCTGGAGGTGGTGAGAAGCAGG - Intronic
1102709652 12:114914884-114914906 CTGAGGAGGTTGTAAGGAGCAGG + Intergenic
1102856949 12:116302453-116302475 GTGGGGAGGTGGAGAGGGGTGGG + Intergenic
1103367671 12:120394902-120394924 CTTTGGAGGGTGGGAGGAGCTGG - Intergenic
1103636353 12:122309786-122309808 CTGAGGAGCTGGGGAGAAGCAGG - Exonic
1103995313 12:124825900-124825922 CTGGGGAGGTGGGGAGATGCAGG + Intronic
1104090851 12:125516560-125516582 CTGGGAAATTGGAGAGGAGCAGG + Intronic
1104242997 12:127008999-127009021 CTGTGAAGGAGGATAGCAGCAGG - Intergenic
1104590556 12:130081259-130081281 CTGGGGAGGTGGGGAGGATGTGG - Intergenic
1105203463 13:18199381-18199403 CTGGGGAGGTGGAGAGGGTCTGG - Intergenic
1106160413 13:27196325-27196347 CTGGGGAGTGGGAGAGGAGCAGG - Intergenic
1106233947 13:27845652-27845674 CTGAGGCGGTGGGGAGGAGAAGG - Intergenic
1107350962 13:39514332-39514354 CTCTGGATGTGGAGAGGGGTTGG - Intronic
1107720877 13:43246748-43246770 CTGGGCAGGTGGAGAGGCTCAGG + Intronic
1109107629 13:58275771-58275793 AGGTGGAGGGGGAGAGGAGTTGG - Intergenic
1110179289 13:72595857-72595879 ATGATGAGGTGGAGAGGAGGGGG + Intergenic
1111445741 13:88345014-88345036 GTGTGGAAGGGGACAGGAGCAGG + Intergenic
1111507535 13:89213633-89213655 CTGGGGTGGTGGGGAGGAGAGGG - Intergenic
1111628739 13:90823003-90823025 CTATGGAGATGGAGAGTAGAAGG - Intergenic
1111900056 13:94189264-94189286 CTTTGGGGGTGGACAGGAGGAGG + Intronic
1111947784 13:94683487-94683509 CAGTAGAGGTTGAGGGGAGCAGG + Intergenic
1112417760 13:99217701-99217723 CTGTGGAGGTTGTGGGGGGCAGG + Intronic
1113030600 13:105990013-105990035 CGGTGGTGGTGCCGAGGAGCTGG - Intergenic
1113102269 13:106733547-106733569 CTGGGGAGGTGGAGAGGCAATGG - Intergenic
1113746314 13:112747320-112747342 GTCTGCAGGTGGAGAGGTGCAGG - Intronic
1113939451 13:114010756-114010778 GTGGGGAGGTGGGGAGGAGGGGG + Intronic
1114461042 14:22886441-22886463 CTGTGGAGGTGCGAAGGAGAGGG - Intronic
1114556488 14:23565309-23565331 CTGTGGAGGTGAGGAGGTGGGGG - Intronic
1114967375 14:27979794-27979816 CTGTTGAAGTGGAGAGCATCAGG + Intergenic
1116776701 14:49189467-49189489 AAAGGGAGGTGGAGAGGAGCAGG + Intergenic
1116817468 14:49597719-49597741 CTGGGGAGGTCGAGAGGCTCCGG - Intronic
1117612229 14:57496247-57496269 CAGAGGAGATGGAGAGAAGCAGG + Intergenic
1117705514 14:58463216-58463238 GTGAGGAGATGGAGAGGAACAGG - Intronic
1117987086 14:61397143-61397165 ATGTAGGGGTGGAGAGGAGGGGG + Intronic
1118303534 14:64635886-64635908 CTATGGAAGTGGAGGGGAGATGG - Intergenic
1118456322 14:65948310-65948332 CTGGGAGGGTGAAGAGGAGCTGG + Intergenic
1118608623 14:67522252-67522274 CAGTAGAGTGGGAGAGGAGCGGG - Intronic
1119199769 14:72743738-72743760 TTGTGAAGGGGGAGTGGAGCTGG - Intronic
1119562595 14:75603056-75603078 ATGTGGAGATGGAGGGGAGGTGG - Intronic
1119727159 14:76928497-76928519 CTGCAGAGCAGGAGAGGAGCTGG - Intergenic
1119727806 14:76932730-76932752 GTGAGGAGGTGGAGAAGAGGAGG - Intergenic
1119802464 14:77458009-77458031 CGGTGGGAGTGGGGAGGAGCCGG + Exonic
1120186169 14:81395910-81395932 CTGATGAGGTGGAGATGTGCTGG + Exonic
1120701691 14:87705465-87705487 GTGTGGAGGGGGAGAAGAGTGGG + Intergenic
1121095613 14:91216162-91216184 CTCTTGAGGTGGAGAGCAGGAGG + Intronic
1121522845 14:94598258-94598280 CTGTGGAGATGGAGAGTGGGTGG + Intronic
1122149606 14:99717830-99717852 AAGTGGAGGTGGAGAGGAATGGG - Intronic
1122211837 14:100178565-100178587 CTGGGGAAGGGGAGTGGAGCAGG + Intergenic
1122426352 14:101608151-101608173 AGGTGGAGGAGGAGAGGAGAAGG - Intergenic
1122606048 14:102948228-102948250 GTGTGGAGGTGGAGGGGAGTCGG + Intronic
1123023479 14:105412762-105412784 CTGTGGAGGTGGCTAGGTGGAGG + Exonic
1123048001 14:105527748-105527770 CTGTGGAGGGGGTGAGGGGCTGG + Intronic
1123068722 14:105630707-105630729 CTCTGGAGAGAGAGAGGAGCTGG + Intergenic
1123096503 14:105769426-105769448 CCGTGGAGTGGGAGAGCAGCGGG - Intergenic
1123476130 15:20593523-20593545 CTGTGGTGGTGGGGACCAGCTGG + Intergenic
1123641882 15:22406841-22406863 CTGTGGTGGTGGGGACCAGCTGG - Intergenic
1123948875 15:25251931-25251953 CTGGGGTGGTTGAGTGGAGCTGG + Intergenic
1123992864 15:25696341-25696363 GTGTGGAGATGGATAGGAGAGGG + Intronic
1124624697 15:31301189-31301211 CAGTGGGGGTGGGGAGGGGCAGG - Intergenic
1124694524 15:31852964-31852986 CTGAGGAGGTGGGGAAGAGTGGG + Intronic
1125329142 15:38565015-38565037 CAGGGGAGTTGGAGAGGAGCGGG + Intronic
1125589893 15:40847540-40847562 CTGGGGAGGAGGAGAGGTGGGGG - Intronic
1126054918 15:44720996-44721018 CTGGGAAGGTGAAGGGGAGCTGG - Intergenic
1126365440 15:47889507-47889529 CTGTGGAGATAGAGAGTAGAAGG + Intergenic
1126567165 15:50112772-50112794 CTGGGGAGGTGGAAATGAGATGG - Intronic
1126808961 15:52381419-52381441 CTGTGGAGGGGGTGAGGGGTGGG + Intronic
1127002791 15:54529720-54529742 GTGTGGAGGAGGAGAGGAGTGGG + Intronic
1127738395 15:61870280-61870302 GTCTGGAGGTGGGGAGGGGCAGG - Intronic
1127804852 15:62509847-62509869 CCGTTGAGGTGGAGAGAATCCGG + Intronic
1128214000 15:65921950-65921972 CTGTGGGAGTGCAGAGGAGCTGG - Intronic
1129002734 15:72347608-72347630 CTGTAGAGGCAGGGAGGAGCTGG + Intronic
1129190029 15:73931733-73931755 CTGTGGAGGTGGGGTGGAGCAGG - Intronic
1129440722 15:75579193-75579215 CTGTGGCGCTGTGGAGGAGCGGG - Exonic
1129521737 15:76190542-76190564 CAGTGGAGGTGGAGGGAGGCGGG + Intronic
1129566105 15:76625135-76625157 CTGGGGGTGTGGAGATGAGCTGG + Intronic
1129654472 15:77514882-77514904 CTGTGGGGATGCAGAGCAGCAGG + Intergenic
1129669242 15:77598001-77598023 CTAGGGAGATGGAAAGGAGCTGG + Intergenic
1131090672 15:89622695-89622717 CTGGGGAGGTGGAGCGGGGAGGG - Intronic
1132271816 15:100533022-100533044 GTGTGGAAGCGGAGTGGAGCGGG - Intronic
1132556554 16:575241-575263 CTGTGATTGTGGAGAGAAGCAGG - Intronic
1132808852 16:1788158-1788180 CAGGGGCGGCGGAGAGGAGCTGG + Exonic
1133020097 16:2963462-2963484 CGGGGGAGGGGGAGGGGAGCAGG - Intergenic
1133281979 16:4671754-4671776 CTGGGGAGGCGGGCAGGAGCCGG - Intronic
1133487381 16:6233410-6233432 GTGTGGAGGTGGGGACGAGTGGG - Intronic
1133710100 16:8393132-8393154 CTGTGGAGCAGAAGAGGGGCAGG - Intergenic
1133741090 16:8652067-8652089 CCGTGGAAGTGGAGTGGAGCTGG - Intergenic
1134675156 16:16085237-16085259 GTGTGGAGGTGGGCAGGGGCTGG - Intronic
1135711988 16:24725523-24725545 CTGGGGAGGGGGAGAGGAGGGGG - Intergenic
1135833741 16:25803956-25803978 CTCTGGAGGTGAGGAGGAGAGGG - Intronic
1136109695 16:28057076-28057098 CTGTGGGGGCAGAGAGGAGTGGG + Intronic
1136452347 16:30360448-30360470 CTGTGGAGGTGGAGAGGAGCAGG - Intronic
1136532729 16:30880580-30880602 CTGGGGAGTTGGAGATGAGAAGG + Intronic
1136632899 16:31499478-31499500 CAGTGGAGGTGAGGAGGGGCGGG - Exonic
1137238379 16:46633819-46633841 TTTTGGAGGGGGACAGGAGCAGG - Intergenic
1137408855 16:48211053-48211075 CACTGGAGCTGGAGAGGAACGGG - Exonic
1137570162 16:49560202-49560224 CTCTGGGGGTGGGAAGGAGCAGG - Intronic
1137712547 16:50576329-50576351 ATCTGGAGGAGGAGAGGAGAGGG - Intronic
1138158890 16:54734699-54734721 CTGTGGAGGTGAATAGAAGAGGG - Intergenic
1138328431 16:56193362-56193384 GGGTGGGGGAGGAGAGGAGCTGG - Intronic
1139516280 16:67454169-67454191 CTGTGGGAGTGGAGTGGAGAGGG + Intronic
1139954093 16:70685198-70685220 CTGTGGGGGTGGGGCGGGGCTGG + Intronic
1139956934 16:70697659-70697681 CTGCAGAGGTGGGGAGGAGATGG - Intronic
1139987085 16:70907631-70907653 CTCTGGTGGTGGGAAGGAGCTGG - Intronic
1140134928 16:72197601-72197623 CAGTGGAGGAGGAGGGCAGCCGG - Intergenic
1140690442 16:77478379-77478401 CTTTGAAGGTGGAGTGGAGTGGG - Intergenic
1140919045 16:79519975-79519997 CTGTGCAGGTGGAGTTGGGCAGG + Intergenic
1140975271 16:80054109-80054131 CTGGGGAGGGGGAGAGCATCAGG - Intergenic
1141638467 16:85328212-85328234 CTGTGGAGGAGGAGCGGAAAGGG - Intergenic
1141673681 16:85506356-85506378 ATGTGGGGGTGGGGAGGAGCAGG + Intergenic
1141785263 16:86195456-86195478 CTGTGGTTTTGGAGAGGACCTGG - Intergenic
1141859937 16:86709670-86709692 CAGTGAAGCTGGAGAGAAGCAGG + Intergenic
1141997000 16:87641976-87641998 CTGTGGAGGAGGGGTGGGGCTGG + Intronic
1142153731 16:88523841-88523863 CTGTGCGGGTGGGGAGGGGCAGG - Intronic
1142188291 16:88705302-88705324 CTGAGGTGGTGGAGTGGAGGGGG - Intronic
1142285562 16:89170139-89170161 GGGTGGAAGCGGAGAGGAGCTGG + Intergenic
1142373159 16:89694120-89694142 CTGGGCTGGGGGAGAGGAGCCGG + Intronic
1142696074 17:1634649-1634671 CTGTGGAGGCGCAGAGGCTCTGG + Exonic
1142733868 17:1882148-1882170 CAGTGGTGGCGGAGAGGAGCTGG - Intronic
1143557831 17:7673571-7673593 CTTTGGCTGGGGAGAGGAGCTGG + Exonic
1143594690 17:7907270-7907292 CTGTGGAGCGGGAGGGGAGGGGG + Intronic
1143692088 17:8577096-8577118 CTGGGTAGGTGGCGGGGAGCAGG + Intronic
1143818965 17:9544018-9544040 CGGTGGAGGGGCAGAGGGGCAGG - Intronic
1144058734 17:11562775-11562797 CAGTGGAGGTGGGGAGGAACGGG - Exonic
1144463669 17:15479276-15479298 CTGGGGAAGTGGAAAGGATCTGG + Intronic
1144674691 17:17154237-17154259 CTTTGGAGATGGAGGGCAGCAGG + Intronic
1144777470 17:17791985-17792007 CTGCTGAGGTGGGGAGGAACTGG + Intronic
1144874526 17:18390469-18390491 GGGTGGAGGTGGTGAGGGGCAGG - Intergenic
1144979349 17:19158948-19158970 ATGTGGAAGTGCAGAGGAGAAGG - Exonic
1144988873 17:19219284-19219306 ATGTGGAAGTGCAGAGGAGAAGG + Exonic
1145023905 17:19453356-19453378 CTGTGGCTGTGGACAGGAGCTGG + Intergenic
1145084511 17:19925450-19925472 TTGTGGAGGTGGGGAGTAGGAGG - Intronic
1145157705 17:20553952-20553974 GGGTGGAGGTGGTGAGGGGCAGG + Intergenic
1146667121 17:34712619-34712641 CTTAGGAAGTGGAGTGGAGCAGG - Intergenic
1146700980 17:34960079-34960101 CAGTGGAGATGGAGAGAAGGTGG - Intronic
1147133173 17:38420539-38420561 CTGTGATGGTGGTGAGGAGAGGG + Intergenic
1147137912 17:38444682-38444704 CTGAGGAGGTGCAGTGGAGAAGG + Intronic
1147210892 17:38871779-38871801 CTGGGCAGGAGGAGAGGAGGGGG + Intronic
1147250833 17:39151666-39151688 CGGTGGGGGTGGGGGGGAGCTGG + Intronic
1147797282 17:43053584-43053606 CCCAGGAGGTGGAGTGGAGCTGG + Intronic
1147878327 17:43637499-43637521 CTGTGGAGGTGGTCAGGGGCTGG + Intergenic
1148393424 17:47289966-47289988 TTGTGGTGGTGGAGGGGAGGTGG + Intronic
1148614629 17:48991043-48991065 CAGTTGAGGGGCAGAGGAGCAGG + Intergenic
1148690025 17:49521741-49521763 TTGTGGGGCTGGAAAGGAGCTGG + Intergenic
1148736277 17:49866808-49866830 CAGTGGAGGTGGTGAGGCACTGG + Intergenic
1148786781 17:50149593-50149615 CGGTGGAGGTGGAGGAGAGCGGG - Exonic
1149097976 17:52867950-52867972 CTGGGGAGGTGGAGGGGATTGGG - Intronic
1149306084 17:55347726-55347748 CTGGGGGGCTGGAGAGGAGTGGG - Intergenic
1149394564 17:56226410-56226432 CTGTGAAGGTGGTTAGGAGTGGG - Intronic
1149575369 17:57708089-57708111 CTGTGGAGGAGGCGGGGAGCAGG - Intergenic
1149650327 17:58272543-58272565 CAAAGGAGGTTGAGAGGAGCTGG + Intronic
1149848634 17:60022005-60022027 GGGTGGAGGTGGTGAGGGGCAGG + Intergenic
1149861535 17:60124519-60124541 GGGTGGAGGTGGTGAGGGGCAGG - Intergenic
1150229667 17:63543259-63543281 CTGAGGAGGGGGAGAGGGGATGG - Intronic
1150433788 17:65139076-65139098 CTGGGGTGGAGGAGGGGAGCTGG - Intronic
1150501330 17:65653608-65653630 CAGAGGAGGTGGGCAGGAGCTGG + Intronic
1150569112 17:66370153-66370175 CTGTGGAGGTTGAGGGGATGTGG - Intronic
1150602526 17:66663181-66663203 CTTTGAGGCTGGAGAGGAGCAGG - Intronic
1151145233 17:72034405-72034427 CTGTGGATGGGGAGAGGAGGGGG - Intergenic
1151239107 17:72744025-72744047 ATGGGGAGGTGGAGAGAGGCAGG - Intronic
1151358174 17:73572422-73572444 ATGTGGGGGTGGATGGGAGCTGG - Intronic
1151425715 17:74029851-74029873 CTGTGGGGGTGGAAAGCAGCTGG + Intergenic
1152024552 17:77800282-77800304 CTGCGGAGGTGGGGCGGGGCGGG + Intergenic
1152236666 17:79142600-79142622 GTGTGGAGGTGGGGAGGGGCTGG + Intronic
1152285445 17:79410053-79410075 GAGTGGCAGTGGAGAGGAGCAGG - Intronic
1152624728 17:81383024-81383046 CTGTGCAGGTGAGCAGGAGCGGG + Intergenic
1152847921 17:82613991-82614013 CTGTGGAGGTGGAGGGTGGCTGG - Intronic
1152863009 17:82706638-82706660 CTGGGGAGATGGAGAAGACCTGG - Intergenic
1153280851 18:3412490-3412512 CCTGGGAGGTGAAGAGGAGCAGG + Intronic
1153370485 18:4309898-4309920 CTCTAGAGGTGGAGAAGAGATGG - Intronic
1153659978 18:7317724-7317746 GTTTGTAGCTGGAGAGGAGCTGG - Intergenic
1154145358 18:11862136-11862158 CTGTGGCAGTGGAGAAGAGAGGG + Intronic
1154445312 18:14431131-14431153 CTCTGGGGGTGAGGAGGAGCTGG - Intergenic
1154498634 18:14981335-14981357 GAATGGAGGTGGGGAGGAGCAGG - Intergenic
1155053929 18:22169394-22169416 CGCTGGAGGTGAAGAGGAGGAGG - Intergenic
1155582329 18:27323844-27323866 CTGGGGAGATGCAGAGAAGCTGG - Intergenic
1156202685 18:34852480-34852502 GGGTGGTGGTGGAGATGAGCTGG - Intronic
1156315913 18:35968520-35968542 CTGTGGTGGTGCAGAGAAGCGGG + Intergenic
1156406911 18:36791441-36791463 AGGTGGAGGTGGACTGGAGCTGG + Intronic
1156462949 18:37331861-37331883 AGGTGGAGGTGGGGAGGATCTGG + Intronic
1157217806 18:45800191-45800213 CTGTGGAGGTGGAGCCAAGATGG - Intergenic
1158303219 18:56076035-56076057 CTCTGGAAGTGGTCAGGAGCAGG + Intergenic
1159537953 18:69738853-69738875 CTGTGGAGGTCAGGAGGAGGAGG + Intronic
1159612161 18:70538137-70538159 ATGTGGTGGTGCAGAGGAGATGG + Intergenic
1159961285 18:74557529-74557551 GAGTGGGGGTGGGGAGGAGCTGG - Intronic
1160026038 18:75217058-75217080 CTGTGGTGGTGGAGAGGCCTGGG + Intronic
1160389564 18:78519721-78519743 CTGTGGAGCTGGGGAGGTGTGGG - Intergenic
1160504838 18:79421244-79421266 CTGTGCAGAGGGAGAGGAGCTGG - Intronic
1160510029 18:79448251-79448273 CTCTGCAGGAGGAGAGGGGCAGG + Intronic
1160575203 18:79849184-79849206 CTGTGGAGGTTGAGGGGTCCAGG - Intergenic
1160799211 19:960069-960091 CTGTGAGGGTGGAGAGGGGATGG - Intronic
1160874494 19:1290823-1290845 CTGCGGAGGAGCAGACGAGCCGG + Intronic
1161104189 19:2435112-2435134 TGGTGGAGGTGGACAGCAGCCGG - Exonic
1161218830 19:3108467-3108489 GTGTGGAAGTGGGGAGGTGCCGG + Intronic
1161250273 19:3276314-3276336 CTGCAGGGGTGGGGAGGAGCTGG + Intronic
1161255501 19:3306812-3306834 GTGAGGGGGTGGAGAGGAGGCGG - Intergenic
1161302395 19:3548920-3548942 ATCTGGGGGTGGGGAGGAGCTGG + Intronic
1161427608 19:4212518-4212540 GTGGGAAGGTGGGGAGGAGCCGG + Intronic
1161471189 19:4457469-4457491 CAGGGGAGGGGGAGAGGCGCCGG - Intronic
1161478214 19:4497960-4497982 CCGTGAAGGTGGAGCGGACCCGG + Exonic
1161543983 19:4868675-4868697 TTTGGGAGGTGGAGAGGGGCGGG - Intergenic
1161625556 19:5324538-5324560 CAATGGAGGAGGAGAGGAGAAGG + Intronic
1161649880 19:5477945-5477967 GTGAGGAGGGGGAGAGGAGGGGG - Intergenic
1161994386 19:7703596-7703618 CTGTGGGGATGGGGAGAAGCAGG - Intergenic
1162024250 19:7884651-7884673 ATGGGGAGGGGGAGAGGAGGAGG + Intergenic
1162054116 19:8052663-8052685 GAGTGCAGGTGGAGAGGAGGAGG + Intronic
1162140169 19:8580717-8580739 CTGGGGGGATGGAGAGGGGCTGG - Exonic
1162718738 19:12649303-12649325 CTATCGAGGTGGGGAGGTGCAGG + Intronic
1162780923 19:13006745-13006767 CTTTGGGGGTGGAGAGAATCTGG - Intronic
1162785483 19:13032123-13032145 CAGTGGAGGGGGAGGGGGGCAGG + Intronic
1162982490 19:14248614-14248636 CTGGGGAGGGGGAGAGGGGATGG - Intergenic
1163028933 19:14530934-14530956 AGGTGGAGGTGGAGAGGAATGGG - Intronic
1163092857 19:15033339-15033361 CTCTGGAGGTGGAGAGGCAAAGG - Intergenic
1163115170 19:15184862-15184884 CAGAGGAGATGGAGAGGAGGAGG + Intronic
1163464694 19:17460529-17460551 CTGAGGAGGTGAGGAGGGGCAGG - Exonic
1163469984 19:17490573-17490595 GTGGGGAGGTGGGGAGGGGCAGG - Intronic
1163664003 19:18594623-18594645 CTGGGGAGGTGGGGGGGAGGGGG + Intronic
1163702001 19:18790748-18790770 CCGAGAAGGTGGAGAGGAGATGG - Intronic
1163722641 19:18905544-18905566 CAGTGCGGGTGGAGAGGGGCAGG + Intronic
1164583907 19:29453522-29453544 CTGAGGAGGTGGGAAGGAACTGG + Intergenic
1164716056 19:30391104-30391126 CTGGGAAGGTGGTTAGGAGCAGG + Intronic
1164971780 19:32539069-32539091 CTAGGGAGATGCAGAGGAGCTGG + Intergenic
1165151612 19:33763928-33763950 CTGTGGATGGTGAAAGGAGCTGG + Intronic
1165762470 19:38329737-38329759 CTGGAGAGGTGGAGCAGAGCGGG + Intergenic
1165792894 19:38502720-38502742 CTCTGCAGGTGGAGCGGGGCAGG + Exonic
1166126089 19:40716244-40716266 CTCTGAAGGGGGAGAGGAGGTGG - Intronic
1166266832 19:41689662-41689684 CTGAGGAGGAGGAAAGGAGAGGG - Intronic
1166532854 19:43552937-43552959 GGGTGGAGGAGGAGAGAAGCTGG - Intronic
1166763944 19:45241515-45241537 CTTAGGAGATGGAGAAGAGCAGG - Intronic
1166872473 19:45879238-45879260 CTGTGCAGGGGGAGTGGAGGTGG - Intergenic
1167217024 19:48171533-48171555 CTGCGGAGGAGGAGACGAGTTGG + Intronic
1167575657 19:50316288-50316310 CTGGGGAGGGGGAGGGGAGGAGG + Intronic
1167615370 19:50530099-50530121 CTGTGGGGATGGAGAGGAAATGG - Intronic
1167723600 19:51195994-51196016 CTGTTGAGGGGGAAAGCAGCTGG - Intergenic
1168063981 19:53909257-53909279 CTGCGGAGGAGGGGAGGGGCGGG - Intergenic
1168272159 19:55255853-55255875 CTGTGGAAGCGGCGTGGAGCAGG - Intronic
1202647012 1_KI270706v1_random:152494-152516 CTTCGGAGGAGGAGAGGGGCGGG - Intergenic
1202703202 1_KI270713v1_random:3504-3526 GAGTGGGGGTGGAGAGGGGCAGG + Intergenic
924978318 2:197683-197705 CTGTTGACGTGGAGACGCGCGGG + Intergenic
924978329 2:197735-197757 CTGTTGACGTGGAGACGCGCGGG + Intergenic
924978340 2:197787-197809 CTGTTGACGTGGAGACGCGCGGG + Intergenic
924978350 2:197839-197861 CTGTTGACGTGGAGACGCGCGGG + Intergenic
924978361 2:197891-197913 CTGTTGACGTGGAGACGCGCGGG + Intergenic
924978372 2:197943-197965 CTGTTGACGTGGAGACGCGCGGG + Intergenic
924978383 2:197995-198017 CTGTTGACGTGGAGACGCGCGGG + Intergenic
924978394 2:198047-198069 CTGTTGACGTGGAGACGCGCGGG + Intergenic
924978405 2:198099-198121 CTGTTGACGTGGAGACGCGCGGG + Intergenic
924978415 2:198151-198173 CTGTTGACGTGGAGACGCGCGGG + Intergenic
924978425 2:198203-198225 CTGTTGACGTGGAGACGCGCGGG + Intergenic
924978436 2:198255-198277 CTGTTGACGTGGAGACGCGCGGG + Intergenic
924978447 2:198307-198329 CTGTTGACGTGGAGACGCGCGGG + Intergenic
924978458 2:198359-198381 CTGTTGACGTGGAGACGCGCGGG + Intergenic
924978469 2:198411-198433 CTGTTGACGTGGAGACGCGCGGG + Intergenic
924978480 2:198463-198485 CTGTTGACGTGGAGACGCGCGGG + Intergenic
925420658 2:3708131-3708153 CGGTGGGGGTGCAGAGGAGCTGG + Intronic
926299985 2:11595661-11595683 CTGGAAAGGTGGAGAGGAACAGG - Intronic
926398289 2:12468348-12468370 CTTTGCAGGTGGAGAGGACAAGG + Intergenic
927506386 2:23617646-23617668 CGCTGGAGGTGCACAGGAGCTGG - Intronic
927571887 2:24167211-24167233 CAGCGTGGGTGGAGAGGAGCTGG + Intronic
927684361 2:25160565-25160587 TTTTGGAGGTGGACCGGAGCCGG + Intergenic
927783090 2:25954890-25954912 CAGTGGCTTTGGAGAGGAGCAGG - Intronic
927976425 2:27342085-27342107 CTGTCCAGGTGGAGAAGAGGTGG - Exonic
928096260 2:28406912-28406934 CTGAGGAGGTGGGGAGGGGAGGG + Intronic
928858360 2:35827386-35827408 CTGGGGAGGAAGAGAGGAACTGG + Intergenic
928922453 2:36539659-36539681 CCGTGGAGGTGGGGAGAAGTGGG + Intronic
929121146 2:38484917-38484939 CTGGGGAGGAGGGGAGCAGCAGG + Intergenic
929763310 2:44823908-44823930 CTTGGGAGGTGGAGAGGTGGAGG + Intergenic
930057834 2:47265519-47265541 GTGTGGAGGAGGAGGGGAGAGGG - Intergenic
930188060 2:48429659-48429681 TTGTGGAGGTGATGGGGAGCAGG + Intergenic
930218920 2:48726016-48726038 CTGTGGTGGGGGAGAGGGGTGGG - Intronic
930715357 2:54588717-54588739 CTGTAGAGATGGAGAGTAGCAGG + Intronic
930759870 2:55022358-55022380 ATGTTGAGGAGTAGAGGAGCTGG - Intronic
931587051 2:63840865-63840887 GTGTGGAGGTGGCAAGGGGCGGG - Intergenic
931807361 2:65820172-65820194 TAGTAGAGGTGGAGAGAAGCAGG - Intergenic
932331454 2:70900521-70900543 CTGAGGAGGAGGAGTCGAGCGGG + Intergenic
932683763 2:73850304-73850326 CTGTCGGGATGGAGTGGAGCAGG + Intronic
932902198 2:75712569-75712591 CTGTGGAAGGGGACCGGAGCGGG - Intergenic
933321153 2:80777267-80777289 CTGAGGAGGTGGAGAGAAGCTGG + Intergenic
933811182 2:86033661-86033683 CTGGGGAGTTGGGGAGGAGTCGG - Exonic
933945411 2:87281985-87282007 GTGTGGAGTTGGAGATGAGGAGG + Intergenic
934501261 2:94861871-94861893 CTGCGGAGGAGGAGAGCTGCGGG + Intergenic
934879264 2:97959313-97959335 CTGGGGAGGTGGGGAAGAGCTGG + Intronic
935198539 2:100835857-100835879 CTGTGGAGGGGAAGAGGGGCAGG - Intronic
935327307 2:101948547-101948569 CTGTGGAGGTGGAGAGTGGATGG + Intergenic
935585404 2:104796320-104796342 TTGTGGAGATGGAAAGGAACTGG + Intergenic
935710428 2:105893376-105893398 CTTTAGAGGAGGGGAGGAGCAGG + Exonic
935984708 2:108661484-108661506 TTGTGAAGATGGACAGGAGCAGG + Intronic
936019441 2:108983737-108983759 CTTTGGAGTTGGAGAGAAGGTGG - Intronic
936049102 2:109209609-109209631 CTGTGTAGGTGGGGAGGAAAGGG + Intronic
936137142 2:109905135-109905157 TTGTGAAGATGGACAGGAGCAGG + Intergenic
936207555 2:110466350-110466372 TTGTGAAGATGGACAGGAGCAGG - Intronic
936334799 2:111579605-111579627 GTGTGGAGTTGGAGATGAGGAGG - Intergenic
936474201 2:112825272-112825294 CTGTGTACCTGGAGAGGAGAAGG - Intergenic
936514608 2:113173891-113173913 CTGGGGAGGCGGCGGGGAGCAGG + Intronic
936766872 2:115861534-115861556 CAGTGGAGATGGAGAGAAGTAGG + Intergenic
937859648 2:126697651-126697673 CCGTGGTGGGGGAGATGAGCTGG + Intergenic
937954916 2:127416767-127416789 GGGTGGAGGTGGAGAGGAGGTGG - Intergenic
938176992 2:129142812-129142834 CGGTGGGAGTGGAGTGGAGCAGG - Intergenic
938391886 2:130913197-130913219 TTGTGGAGTTGGAGGGAAGCAGG + Intronic
940906284 2:159172877-159172899 CGGTGGAGCTGGAGAGCTGCTGG + Intronic
941771373 2:169349418-169349440 CTGTGCATGGGGAGAGGAGAAGG + Intronic
941979673 2:171441231-171441253 CTGTGCAGGAGGGGAGAAGCAGG - Intronic
942413261 2:175733572-175733594 GTGTGGAGGTGGTGAGGTGATGG + Intergenic
942613062 2:177762091-177762113 CTGTGAGGATGGACAGGAGCAGG + Intronic
943060345 2:183037389-183037411 TTTTGAAGGTGGAGAGGAGGGGG - Intronic
943530148 2:189069157-189069179 TTGTGGAGGTTCAGAGGAGAGGG - Intronic
943720939 2:191202970-191202992 GTTTGGGGGTGGAGAGCAGCTGG + Intergenic
944679817 2:202066880-202066902 CTATGGAGGGTGACAGGAGCAGG - Intergenic
944708963 2:202318763-202318785 CAGTGCAGGTAGAGAAGAGCTGG + Intergenic
945141443 2:206690885-206690907 CTGTGGAGGAGGAATGAAGCTGG + Intronic
945179517 2:207077471-207077493 AGGTGCAGGTGGAGAGGAGATGG + Exonic
945219505 2:207469397-207469419 GTGTGGAGGATGAGAGGAGTCGG - Intergenic
945931953 2:215864317-215864339 GAGGGGTGGTGGAGAGGAGCAGG - Intergenic
946192241 2:218013703-218013725 CTGTGGCTGAGGAGAGGTGCGGG - Intergenic
947101029 2:226621503-226621525 ATGGGGAGGTGGAGAGAAACAGG - Intergenic
947190964 2:227504141-227504163 CTGGAGAGGTGGAGGGGAGGCGG + Intronic
947228322 2:227860855-227860877 AAGAGGAGGTGGAGAGGATCTGG + Intergenic
947286347 2:228519762-228519784 CTGTGGTGGTGGGGTGGAGGTGG - Intergenic
947403052 2:229747978-229748000 CAGTTGAGGTGTAGAGAAGCTGG - Intergenic
947590713 2:231383499-231383521 AGCTGGAGGTGGAGAGGGGCAGG - Intergenic
947636568 2:231683401-231683423 CTGGGGAGGAGGGGAGGAGTAGG + Intergenic
947732186 2:232437406-232437428 GTGTGGAAGGGGAGGGGAGCTGG + Intergenic
947909127 2:233790230-233790252 CAATGCAGGTGGAGGGGAGCAGG - Intronic
947926335 2:233925577-233925599 CCGGGGAGGTGGAGACCAGCAGG + Intronic
948169565 2:235890092-235890114 CTGTGTAGGTTGAGAGAAGGAGG + Intronic
948373959 2:237508755-237508777 TGGTGGAGGTGGAGAAGAACTGG - Intronic
948492724 2:238323843-238323865 GTGTGGTGGTTGAGAGGAACAGG + Intronic
948584390 2:239009799-239009821 CAGAGGAGCTGGAGAGGAGACGG + Intergenic
948733158 2:239979966-239979988 ATGTGGGGGTGTAGGGGAGCAGG - Intronic
948733172 2:239980008-239980030 ATGTGGGGGTGTAGGGGAGCAGG - Intronic
948754191 2:240149731-240149753 CTGTGAAGGAGGCAAGGAGCTGG - Intergenic
948798530 2:240419528-240419550 TCGTGGGTGTGGAGAGGAGCTGG - Intergenic
948813566 2:240498473-240498495 CTGTGGGGGTGGAGCTGAGGGGG + Intronic
948813578 2:240498508-240498530 CTGTGGGGGTGGAGCTGAGGGGG + Intronic
948838340 2:240636946-240636968 CTGAGGAGGGGGAGATGAGCAGG - Intergenic
948842173 2:240657169-240657191 CTGGGGAGCTGGGGAGGAGGGGG + Intergenic
948929440 2:241122700-241122722 CTGTGGGGGGGGAGTGGCGCCGG - Intronic
1168760467 20:346990-347012 CTCTGGAAGGGGACAGGAGCCGG + Intronic
1168793496 20:595928-595950 GGGTGGGGGTGGGGAGGAGCGGG + Intergenic
1168875016 20:1165332-1165354 CTTGGGAAGTGGAGAGGAGCTGG - Exonic
1169430241 20:5530038-5530060 CTGGGGTGGTGGAGAAGACCTGG - Intergenic
1170012484 20:11741181-11741203 CTGGGGAGGAGGAGAGGCCCTGG - Intergenic
1170793817 20:19529482-19529504 TTGTGGAGATGGAGAGGAGATGG - Intronic
1171037735 20:21729357-21729379 CTGGGGTGCTGGGGAGGAGCGGG + Intergenic
1171892468 20:30728669-30728691 CCGTGGAGGAGGAGAGCTGCGGG + Intergenic
1172528971 20:35617623-35617645 CTTTGGAGGGGGTGGGGAGCAGG + Intronic
1172589255 20:36105930-36105952 CTGGGGAGGAGGGGAGGAGAGGG - Intronic
1172595127 20:36145861-36145883 CTGAGGAGATAGAAAGGAGCTGG - Intronic
1172697437 20:36832301-36832323 CCCCGCAGGTGGAGAGGAGCTGG - Intronic
1172723457 20:37016924-37016946 CAGGGGAGGGGGAGAGGAGGGGG + Intronic
1172766899 20:37355843-37355865 CCATGGAGGTGGGGAGCAGCAGG + Intronic
1173197540 20:40928255-40928277 CTGTGGGAGTGCAGAGGAGAGGG - Intergenic
1173648060 20:44646022-44646044 CTGGGGAGGTGGAGAGGAGCAGG - Intronic
1173849167 20:46207146-46207168 ATGTGGAGGCAGTGAGGAGCTGG - Intronic
1173930867 20:46817227-46817249 CTGGGGAGGGGGAAAGGAGTAGG + Intergenic
1173993953 20:47323722-47323744 CAGTGGAGGTGGGGTGGGGCTGG - Intronic
1174050630 20:47765027-47765049 ATTTGGAGGTGGAGAGAAGATGG - Intronic
1174070791 20:47897682-47897704 TTGTGGACCTGGGGAGGAGCCGG + Intergenic
1174077223 20:47946253-47946275 CTGTGGGGGTGGCAGGGAGCAGG + Intergenic
1174100672 20:48124091-48124113 CTGTAGACCTGGGGAGGAGCTGG - Intergenic
1174147911 20:48464951-48464973 GTGAGGAGGTGGAGGGGAGGGGG - Intergenic
1174149293 20:48474850-48474872 CTGGGGACCTGCAGAGGAGCTGG - Intergenic
1174153275 20:48500974-48500996 CTGTGGACCTGGGGAGGAGCCGG - Intergenic
1174444684 20:50582722-50582744 GGGTGGAGGTGGAGTGGAGGAGG - Exonic
1174768348 20:53274410-53274432 CTGTGGAGGCTCAGAGGAGGGGG - Intronic
1174772844 20:53317499-53317521 CTGGGGTGGGGGAGAGGAGGAGG - Intronic
1174800171 20:53556965-53556987 CTGAGGAGGTGGTGGTGAGCTGG - Intergenic
1175223801 20:57433289-57433311 CTGTGGAGCTGCAGAGGGGGAGG - Intergenic
1175321944 20:58094445-58094467 CTGGGGATGTGGAGATGAGTGGG + Intergenic
1175619029 20:60427688-60427710 CTGGGGATGTAGTGAGGAGCAGG - Intergenic
1175691180 20:61067104-61067126 CTGGGTGGGTGGGGAGGAGCAGG + Intergenic
1176115242 20:63429296-63429318 CTGAGGAGGCGGAGTGGAGGGGG - Intronic
1176142882 20:63553043-63553065 CCGTGGGGGTGGAGATGAGGAGG + Intronic
1176217290 20:63954235-63954257 CTGTGGAAGTGGGGAGCAGAGGG - Intronic
1176253459 20:64138162-64138184 CTGTGGGGGTGGGGAGGGCCGGG + Intergenic
1176604857 21:8820280-8820302 CTTCGGAGGAGGAGAGGGGCGGG + Intergenic
1176714510 21:10338696-10338718 CTGGGGAGGTGGAGAGGGTCGGG + Intergenic
1177011806 21:15739457-15739479 GTGTGGTGGTGGAGGGGTGCTGG + Intronic
1177027425 21:15936644-15936666 CTGGGGTGGGTGAGAGGAGCAGG - Intergenic
1177425571 21:20918444-20918466 CTGAGGAGGCAGAGAAGAGCAGG + Intergenic
1177605055 21:23367250-23367272 ATGGGGAGCTGGAGAGGAGATGG + Intergenic
1177821520 21:26035455-26035477 CTGCGGAGGTAGGGAGGAGCTGG + Intronic
1178491837 21:33057507-33057529 CTGGGGATGCGGAGAGGAGAGGG - Intergenic
1179419828 21:41226686-41226708 CAGTGGAGGTGGGCTGGAGCAGG + Intronic
1179545949 21:42112273-42112295 CTGGGGAGGTGCAGAACAGCTGG - Intronic
1179714324 21:43279931-43279953 AGGTGGAGGTGGAGGGGAGGTGG + Intergenic
1179714381 21:43280084-43280106 AGGTGGAGGTGGAGGGGAGGTGG + Intergenic
1179714404 21:43280129-43280151 AGGTGGAGGTGGAGGGGAGGTGG + Intergenic
1179714452 21:43280232-43280254 AGGTGGAGGTGGAGGGGAGGTGG + Intergenic
1179714618 21:43280611-43280633 CAGTGGAGGTGGAGGGGACGGGG + Intergenic
1179761439 21:43532329-43532351 TGGTGGAGGAGGAGAGGAGGGGG - Intronic
1179899397 21:44381187-44381209 CTGCGGACGAGGAGAGAAGCAGG + Intronic
1180347147 22:11711885-11711907 CTTCGGAGGAGGAGAGGGGCGGG + Intergenic
1180354895 22:11829975-11829997 CTTCGGAGGAGGAGAGGGGCGGG + Intergenic
1180383356 22:12162356-12162378 CTTCGGAGGAGGAGAGGGGCGGG - Intergenic
1180786063 22:18548491-18548513 CTGTGGTGGTGGGGCTGAGCCGG + Intergenic
1181130163 22:20726542-20726564 CTGTGGAGGTGGAGCAGAGTTGG + Intronic
1181131345 22:20734216-20734238 CTGTGGTGGTGGGGCTGAGCCGG + Intronic
1181242985 22:21488045-21488067 CTGTGGTGGTGGGGCTGAGCCGG + Intergenic
1181343675 22:22201698-22201720 CTGTGCAGTGAGAGAGGAGCAGG - Intergenic
1181570654 22:23766351-23766373 CTGGGGATGTGGGGAGGGGCAGG - Intronic
1181591746 22:23889661-23889683 CTGGGGAGGTGGGCTGGAGCTGG - Intronic
1182534262 22:30988496-30988518 CTTTGGAGTTGGAGAGAAGATGG + Intergenic
1183237459 22:36630285-36630307 CTGTGGGCGTGGACAGGAGATGG + Intronic
1183345888 22:37307484-37307506 CTATGGGGGTGGGGAAGAGCAGG - Intronic
1183564202 22:38601472-38601494 CTGTGGTCATGGTGAGGAGCTGG + Intronic
1183645577 22:39124222-39124244 CTGTGAAGCTGGAGGGGAGGGGG - Intronic
1183777161 22:39973791-39973813 CTGTGGCTGGTGAGAGGAGCTGG - Intergenic
1183987623 22:41578158-41578180 CTGAGGAGGTGGCAATGAGCTGG + Intronic
1184115171 22:42417918-42417940 CTGTGGGGGTGGGGAGGCACAGG - Intronic
1184274837 22:43404322-43404344 CTGGGGAGGTACAGTGGAGCCGG - Intergenic
1184802451 22:46769840-46769862 CTGTGGGGTTGGAGAGGATCGGG + Intronic
1184894830 22:47400834-47400856 CTGTGGAGGTCGGGAGGGGTCGG - Intergenic
1184972558 22:48036818-48036840 GGGTGGAGGCAGAGAGGAGCAGG - Intergenic
1185295030 22:50048994-50049016 CAGTGTGGGTGGAGGGGAGCTGG + Intronic
1185347743 22:50317785-50317807 CTGTGTGGCAGGAGAGGAGCTGG - Intronic
949125191 3:438745-438767 TTGTGGAGGTCAAGAAGAGCTGG - Intergenic
949159298 3:860726-860748 CTGGAGACATGGAGAGGAGCGGG - Intergenic
949926839 3:9048347-9048369 CTGGGGAGCTGGAGATGAGCTGG - Intronic
949935091 3:9110264-9110286 CTGTGGAGATGAAGAGGAGCAGG + Intronic
950021558 3:9791486-9791508 CTGTGGAGCTGGAGAGGACAGGG + Exonic
950195506 3:11006537-11006559 GTGGGGAGGAGGAGAGGAGAGGG - Intronic
950230913 3:11275061-11275083 CAGTGGAGATGGAGAGGAGTGGG + Intronic
950365455 3:12480339-12480361 CTTAGGAGGAGGAGAGGAGGAGG - Intergenic
950676033 3:14555070-14555092 GAGTGGGGGTGGGGAGGAGCTGG - Intergenic
950792939 3:15487795-15487817 AAGTGGAGGTGCAGAGGAGATGG - Intronic
951580788 3:24160347-24160369 CTGTGGTGGTGCAGAGGATGGGG + Intronic
952755136 3:36859116-36859138 GTGGGGAGCTGGAGAGGAGGCGG - Intronic
953024603 3:39137604-39137626 CTGAGGACCTGGAGAAGAGCTGG + Exonic
953420822 3:42751867-42751889 CTGTGGAGGAGGGGAGGCCCAGG + Intronic
953604356 3:44401144-44401166 CTCTGGTGGGGGAGAGGAGAGGG + Intronic
953924931 3:46978014-46978036 CAGTGGAGGTGGAGAGGGGGCGG - Intronic
954224526 3:49173464-49173486 CTGGGGTGGGGGAGAGGAGTAGG + Intronic
954298628 3:49687531-49687553 AAGTGGGGGTGGAGAGGGGCAGG - Intronic
954433403 3:50483318-50483340 CTGAGGAGCTGGGGAGGGGCAGG + Intronic
954647570 3:52140797-52140819 CTGTGGAGGTGGTGGGGAGCGGG + Intronic
955281240 3:57596959-57596981 CTGTGGTGGGGGAGGGGCGCCGG - Intronic
955721533 3:61886556-61886578 CAGTGGAGGTGGCAAGGGGCAGG - Intronic
955748595 3:62165097-62165119 CTCTGGACATGGAGAAGAGCTGG + Intronic
956081405 3:65560617-65560639 ATCTGGAGGGGGAGAGGAGTGGG - Intronic
956174673 3:66461871-66461893 GTTTGGAGGTGGAGAGGAACAGG + Intronic
956491592 3:69778053-69778075 CTGTGGAGATGGAGAGGAGGTGG + Intronic
957715584 3:83926388-83926410 CTGCGGAGGAGGAGAGGGGGTGG - Intergenic
958470669 3:94513828-94513850 CTGTGGAGGAGTAGCAGAGCTGG - Intergenic
959024556 3:101225771-101225793 CTTTGGAGGGGGAGAGGAGGAGG - Exonic
960418347 3:117412755-117412777 ATGAGGAGGAGGAGAGGAGAAGG - Intergenic
960847750 3:122020641-122020663 CTGTGGAGTTTGAGATGAGCAGG + Intronic
960925346 3:122790444-122790466 CTTTGGAGGCTGAGAGGAGAAGG - Intronic
961073527 3:123961094-123961116 CTGTGGGGATGGAGAGGGACAGG - Intronic
961098059 3:124174705-124174727 CTCTGTAGGGGGAGAGGAGTTGG - Intronic
961310041 3:125990726-125990748 CTGTGGGGATGGAGAGGGACAGG + Intergenic
961381103 3:126497091-126497113 CTGTGGAGGAGGAGGCGGGCAGG - Intronic
961384651 3:126516676-126516698 GTGTGGGGGTGGAGGGGAGTTGG - Intronic
961530170 3:127535855-127535877 CTGTGGTGAGAGAGAGGAGCAGG - Intergenic
961536267 3:127572906-127572928 CTGGGGAGGTGAAGAGAAACAGG - Intergenic
961568652 3:127782802-127782824 ATGTGGAGTTGCAGAGGAACGGG - Intronic
961867749 3:129966395-129966417 CTGTGGGGCTGGCGTGGAGCTGG - Intergenic
962338650 3:134562305-134562327 CTGTGGAGAGAGAGAGGAGCAGG + Exonic
962931350 3:140040506-140040528 CTTGGGAGGTGGAGAGAAGAAGG + Intronic
962976781 3:140452618-140452640 CTGGGGAGCTGGACAGTAGCTGG + Intronic
963606449 3:147415581-147415603 GTGTGGAGGTGCAGAGCAGGTGG + Exonic
964538860 3:157756936-157756958 GTGTGGATGTGGAAAGGTGCTGG - Intergenic
966504464 3:180684017-180684039 CAGTGGAGATGGAGAGCAGTAGG - Intronic
966711858 3:182980255-182980277 CCGAGGAGGCGGAGCGGAGCCGG - Intronic
967228724 3:187317852-187317874 CTCTGGAGGTGGGTAGGAACAGG + Intergenic
967540885 3:190666481-190666503 ATGTGGAGGGGAAAAGGAGCAGG - Intergenic
968702342 4:2062976-2062998 CAGGGGAGGAGGAGAGGTGCAGG - Intronic
968815481 4:2819561-2819583 CAGTGGAGTTGGATGGGAGCAGG - Intronic
969186668 4:5479515-5479537 CAGTGGAGGTGGAGTGGAGATGG + Intronic
969328774 4:6460937-6460959 GGGTGGAGTGGGAGAGGAGCTGG - Intronic
969446341 4:7246860-7246882 GTGGGGAGGTGGAGAGTTGCTGG - Intronic
970479452 4:16458561-16458583 ATGGGGAGCTGGAGAGGAGATGG + Intergenic
970545132 4:17121676-17121698 CTGTGCATGTGTGGAGGAGCAGG + Intergenic
971193926 4:24453831-24453853 ATGTGGAGGTGGGGTGGAGGAGG - Intergenic
973091313 4:46140684-46140706 CTTTGGAGGTGAGGAGGAGCGGG - Intergenic
973115371 4:46451158-46451180 ATGTGGAGGTAGTGAGGAGAAGG + Intronic
973373266 4:49270657-49270679 CTTCGGAGGAGGAGAGGGGCAGG - Intergenic
973387740 4:49524551-49524573 CTTCGGAGGAGGAGAGGGGCAGG + Intergenic
975799313 4:78042874-78042896 CTGTGGATGTTGGAAGGAGCAGG - Intergenic
975897161 4:79106735-79106757 CTGTGGTGGTGGGCGGGAGCAGG + Intergenic
975908032 4:79238967-79238989 TTGTTGAGTTGGACAGGAGCTGG + Intronic
976071535 4:81245786-81245808 TGTTGGAGGTGGAGAGGAGGAGG + Intergenic
976351445 4:84064530-84064552 CTGGAGAGGTGGACAGCAGCAGG + Intergenic
977682134 4:99808490-99808512 CTGTGGAAGTGGAGGGGAAGAGG + Intergenic
978228322 4:106366011-106366033 CTGTGAATAAGGAGAGGAGCTGG - Intergenic
979669388 4:123346314-123346336 CTGGGGGGGTGGAGAGGGGTTGG + Intergenic
979984156 4:127294576-127294598 CTGTTGAGCTGGATAGGAGGTGG + Intergenic
980140106 4:128905316-128905338 CAGTGGAGATGGAGAGAAGTGGG - Intronic
980270566 4:130578839-130578861 CTGAGGAGCTGGGGAGAAGCAGG - Intergenic
981351238 4:143732098-143732120 TGGTGGAGGTGGAGGGGAGCAGG - Intergenic
981917539 4:150051424-150051446 CAGTGGAGGTAGAGAGAAGTGGG - Intergenic
982232603 4:153222864-153222886 AGGAGGAGGCGGAGAGGAGCGGG + Intronic
983370727 4:166854675-166854697 TTTTGGAGGTGGAGAGAGGCTGG + Intronic
985164418 4:187077731-187077753 CTGCATAGGTGGAGAGAAGCTGG + Intergenic
985269906 4:188184041-188184063 ATGGGGAGGTGGAGAGGGGATGG - Intergenic
985485628 5:146668-146690 CTGTGGGGGAGGAGAGGAGGGGG - Intronic
985506092 5:281294-281316 CTGAAGACCTGGAGAGGAGCTGG + Intronic
985641020 5:1063606-1063628 AGGTGGAGGTGGGGAGGAGAAGG - Intronic
985652646 5:1114030-1114052 CTGTGGACCTTCAGAGGAGCTGG + Intergenic
985965155 5:3333884-3333906 CTGTGAAGGTGCAGGGGCGCTGG + Intergenic
986074936 5:4326816-4326838 CAGTAGAGGTGGAGGGCAGCAGG - Intergenic
986576106 5:9214379-9214401 CTGCAGAGGTGCAGAGGATCAGG + Intronic
990140406 5:52696828-52696850 CTATGGAGATGGAGAGGATGGGG - Intergenic
991493605 5:67207267-67207289 CTGTGTGGGTGCAGTGGAGCTGG + Intergenic
991973641 5:72164716-72164738 CTGAGGATATGCAGAGGAGCTGG - Intronic
992810773 5:80386296-80386318 GTGTGGTGGTGGAGAGGGGCAGG + Intergenic
993495096 5:88599974-88599996 CAGGGAAGGTGGAGAGGAGTGGG + Intergenic
994438153 5:99764072-99764094 CTGTGGAAGGAGAGAGAAGCAGG - Intergenic
994607112 5:101982009-101982031 CGGTAGAGATGGAGATGAGCAGG + Intergenic
996139508 5:119888708-119888730 CTGTGGAGTTGGAGAGTAGTGGG + Intergenic
997158053 5:131579340-131579362 GTGTGGAAGGGGACAGGAGCAGG + Intronic
997215778 5:132109324-132109346 CTGTTGTGGTGGGGGGGAGCGGG + Intergenic
997609644 5:135206657-135206679 CAGTGGAGGAAGAGAGCAGCAGG - Intronic
998136262 5:139676201-139676223 CTGTGGAGGAGGTGGGGAGGAGG - Intronic
998136273 5:139676237-139676259 CTGTGGAGGAGGTGGGGAGGAGG - Intronic
998169887 5:139866460-139866482 ATGGGAAGTTGGAGAGGAGCTGG + Intronic
998399230 5:141839498-141839520 GGCTGGAGGTGGGGAGGAGCTGG + Intergenic
998883232 5:146666644-146666666 CTATGAAAGTGGAGAGGAGATGG - Intronic
999054301 5:148557255-148557277 CTGGGGAGATGGAGAGAAGTGGG + Intronic
999404328 5:151293747-151293769 ATATGGAGGGGGAGAGGAGGAGG + Intronic
999471204 5:151857002-151857024 CCTTGGAGGTGCAGATGAGCTGG + Intronic
1000064714 5:157684566-157684588 CTGTGGCCCTGGAGAGGAGGAGG - Intergenic
1000210727 5:159104406-159104428 GGGTTGAGGTGGAGAGGAGCAGG + Intergenic
1002080091 5:176732623-176732645 CTGAGGAAGTGGAGGGGTGCAGG - Intergenic
1002197675 5:177510038-177510060 CTCGTGAGGTGGAGAGGAGCAGG - Intronic
1002300664 5:178255772-178255794 CTGTGCAGGTGGTGGGGAGCGGG - Intronic
1002309730 5:178307054-178307076 CTGTGGAGGGGGAGATGCGTGGG + Intronic
1002660527 5:180788370-180788392 CTGTGAGGGTGGAGAGGAAGAGG - Intergenic
1002805173 6:567009-567031 CAGTGGAGTTGGAGAGCAGTTGG - Intronic
1003545155 6:7052348-7052370 CTGTGAGGGTGGAGAGGGGGCGG + Intergenic
1003901485 6:10659607-10659629 GTGAGGAGGGGGAGAGGAGAGGG + Intergenic
1003968689 6:11278076-11278098 CTGAGGCTGTGGAGAGAAGCAGG - Intronic
1004030196 6:11860726-11860748 CTGTAGAGGGGGACAGGGGCAGG - Intergenic
1004955363 6:20722920-20722942 AAGTGGAGGTGGAGAGGGGATGG - Intronic
1005191664 6:23230404-23230426 TTGTGAAGAGGGAGAGGAGCAGG + Intergenic
1005475747 6:26205955-26205977 CTGTGGCAGTGAAGGGGAGCTGG - Intergenic
1006108647 6:31731004-31731026 CTGAGGATGGGGAGAGGAGAGGG + Intronic
1006373587 6:33659672-33659694 CTGTGGAGGTGGAGGGAGGCTGG - Intronic
1006417959 6:33916025-33916047 GTGTGGAGGTATAGAGGAGCTGG + Intergenic
1006576539 6:35050678-35050700 CTGTGCAGATGGGGAGAAGCCGG - Intronic
1006824097 6:36921447-36921469 CTGTGGAGATGGAGGGGAGAGGG + Intronic
1007102787 6:39261555-39261577 GTGTGGTGGTGGAAAGGAACGGG + Intergenic
1007558055 6:42782970-42782992 CTGGGGAGGGGGAGGGGAGAGGG + Intronic
1007742289 6:44020267-44020289 CTGGGGTGATGGGGAGGAGCAGG + Intergenic
1008065155 6:47039890-47039912 ATGTGGAGGTTGAGGTGAGCCGG + Intronic
1008206425 6:48664687-48664709 CTGTGGGGGTGGGGAAAAGCTGG + Intergenic
1008626934 6:53326268-53326290 ATGTGGAGGTGGATAGAAGGAGG - Intronic
1009822438 6:68820630-68820652 CGGTGGAGGGAGAGAGAAGCGGG - Intronic
1010288593 6:74108975-74108997 GTCTGGTGGAGGAGAGGAGCAGG + Intergenic
1010725414 6:79327273-79327295 GTGTGGTGGTGGTGAGTAGCAGG + Intergenic
1010735306 6:79437198-79437220 CCGTGGAGGAGGAGAGGAGCAGG + Intergenic
1010770829 6:79828008-79828030 CTGTGCAGGTGTAGGGGAGCGGG + Intergenic
1011084232 6:83521512-83521534 CTGTCGAAGAGGAGAGGAGGGGG - Intronic
1011249921 6:85360295-85360317 CTGAGGAGCTGGAGAGAAGTTGG + Intergenic
1011335474 6:86254865-86254887 CTGTGTGGCTGGAGAGGAGATGG + Intergenic
1012446679 6:99314208-99314230 TTGTGGTGATGGAGAGGGGCGGG - Intronic
1012545705 6:100417086-100417108 GTCTGGAGGTGGAGTGGAGGAGG - Intronic
1013710409 6:112890625-112890647 CTGGGGAGTTAGAGTGGAGCGGG - Intergenic
1015824342 6:137295810-137295832 GTGTGGAGGAGGAGTGGTGCAGG - Intergenic
1016471548 6:144379907-144379929 CTGTGGAGGAGTGGAGGAGAAGG + Intronic
1016912598 6:149214158-149214180 CAGTGAAGATGGAGAAGAGCAGG - Intergenic
1016923190 6:149317008-149317030 CTGCGGCGGCCGAGAGGAGCAGG - Intronic
1017009844 6:150055827-150055849 CTGGGGACCTGGGGAGGAGCTGG - Intergenic
1017103303 6:150866418-150866440 CAGGGGAGGGGGCGAGGAGCAGG + Intronic
1017588569 6:155953692-155953714 CTGTGGAAGTGGAGGGGAGCTGG + Intergenic
1017768505 6:157626577-157626599 CTGTGCATGTGGAGGGGAGGGGG - Intronic
1019042446 6:169118413-169118435 CTGTGGGGGTGGAGTGGGGATGG - Intergenic
1019599562 7:1874456-1874478 CTCTGGTGGAGGAGAGGAGGCGG + Intronic
1019651184 7:2159454-2159476 CTGTGAAGGAGGAGAGCACCAGG - Intronic
1019711606 7:2520500-2520522 CTCTGGAGCTGGACAGGAGGCGG - Intronic
1019767961 7:2865385-2865407 CCGGGGAGGTGGGGAGGTGCCGG - Intergenic
1020076587 7:5262753-5262775 CTGTGGTGGTGGGGTGGAGGGGG - Intergenic
1020267046 7:6567879-6567901 CTGTTGAGGGGAAGAGCAGCAGG - Intergenic
1020361209 7:7328690-7328712 CTCTGGAGTTTGAGACGAGCCGG - Intergenic
1020654394 7:10912171-10912193 CAGTGGAGGTGGAGAGAAGAGGG - Intergenic
1020899804 7:13990442-13990464 CTGTGGCTGTGGGGAGGAGGAGG + Intronic
1021667400 7:22998649-22998671 CTGTGGAGATGGAGAGCAGATGG - Intronic
1021926078 7:25534930-25534952 CGGTGGCTGGGGAGAGGAGCAGG + Intergenic
1022394064 7:29969986-29970008 CAGTGGAGGTGGAGAGGAGTGGG - Intronic
1022575516 7:31493286-31493308 TTGTGGAGTTAGAGAAGAGCAGG + Intergenic
1022729620 7:33010221-33010243 CTGTGGAACTGGAGAGAAGTGGG - Intergenic
1022922727 7:35032883-35032905 CTGTGGAGATGGAGAGAAATTGG - Intronic
1022961525 7:35430651-35430673 CTGAGGAGGCGGGGAGGAGGTGG - Intergenic
1023591339 7:41783635-41783657 CTGTAGATGTGGAGAGAAGACGG + Intergenic
1025233753 7:57219922-57219944 CTGTAGACCTGGGGAGGAGCCGG + Intergenic
1025261448 7:57421734-57421756 CTGGGGAGGTGGAGGTGAGAGGG + Intergenic
1025738774 7:64178929-64178951 CTGGGGAGGTGGAGGTGAGAGGG + Intronic
1026052742 7:66960780-66960802 ATGGGGAGGTGAAGAGGAGCAGG + Intergenic
1026273100 7:68853386-68853408 ATGTGGGGGTGGAGGGGAGGGGG - Intergenic
1026877987 7:73890633-73890655 CTTTGTCGGTGGAGAGGAGACGG - Intergenic
1027249927 7:76392682-76392704 CTCTGGAGGTTGAGCGGAGTAGG + Intronic
1028268520 7:88759086-88759108 CTGTGGTGGAGGAGATGGGCAGG - Intergenic
1028775648 7:94673240-94673262 CTGGGGAGGAGGAAAGGAGTAGG - Intergenic
1028881961 7:95890429-95890451 CGGTGGAGGGTGAGAGGAGGAGG + Intronic
1029188392 7:98755324-98755346 CTGTGGAGATGCAGAAGGGCAGG + Intergenic
1030124116 7:106138532-106138554 CTGTGGAGAGGGAGATGAGAGGG + Intergenic
1030338176 7:108347917-108347939 GTATGGGGGTGGAGAGGAGGCGG - Intronic
1030537909 7:110791895-110791917 ATGATGAGGTGGAGAGAAGCAGG + Intronic
1031066693 7:117113320-117113342 CTGGGAAGGTGGATAGCAGCAGG + Intronic
1031680522 7:124667900-124667922 CTTTGGGAGGGGAGAGGAGCAGG - Intergenic
1032166953 7:129552999-129553021 GTGTGGGGATGGAGAGGAGGTGG - Intergenic
1033735452 7:144217415-144217437 CTGTGGCAGTGGAGAGGATATGG + Intergenic
1033747602 7:144333554-144333576 CTGTGGCAGTGGAGAGGATATGG - Intergenic
1034213772 7:149387370-149387392 CTGTGGAGGTGGGGCGTGGCAGG - Intergenic
1034255936 7:149724712-149724734 CTGTGAAGATGGAGAACAGCTGG + Exonic
1034277751 7:149831044-149831066 CTGTGGGGGTGGGGAGGCACAGG - Intergenic
1034288437 7:149907239-149907261 CTGTGGGGGTGTGGAGAAGCAGG - Intergenic
1034345266 7:150381924-150381946 CCGGGAAGTTGGAGAGGAGCAGG + Intronic
1034469203 7:151246649-151246671 CTGTGGAGACTGAGAGGAGGCGG + Intronic
1034490403 7:151390181-151390203 CTGCGGAGCAGGGGAGGAGCTGG + Intronic
1034569534 7:151944279-151944301 CTGTGGGGCTGGGGAGGAGGGGG - Intergenic
1034662695 7:152785741-152785763 CTGTGGGGGTGTGGAGAAGCAGG + Intronic
1034885289 7:154794213-154794235 CTGTGGGGGTGGAGGGGAGACGG + Intronic
1035128041 7:156624710-156624732 CTGTGGAGAGGGAGAGGTTCAGG + Intergenic
1035251408 7:157599900-157599922 GTGGGCAGGTGGAGAGGGGCAGG - Intronic
1035251464 7:157600090-157600112 GTGGGCAGGTGGAGAGGGGCAGG - Intronic
1035390804 7:158503332-158503354 CTGTGAGGGTAGAGAGAAGCTGG - Intronic
1035391680 7:158508550-158508572 GTGGGGAGCTGGAGAGGAGCAGG + Intronic
1035693020 8:1572218-1572240 CTGATGAGATGGAGAGGAGAGGG + Intronic
1037354879 8:18007838-18007860 TTTTGGTGGGGGAGAGGAGCAGG + Intronic
1037386409 8:18347422-18347444 GTGTGCAGGTGGAGGGGAGATGG + Intergenic
1037588541 8:20294683-20294705 CTTTGGGGGTGGCGGGGAGCAGG + Intronic
1037747551 8:21659043-21659065 CAGTGGAGCTGGAGTGGAGAGGG - Intergenic
1038411320 8:27361833-27361855 GTGTGGGTGTGGAGCGGAGCAGG - Intronic
1038415248 8:27390170-27390192 CTGTGCAGGAGCAGAGGAGAGGG + Intronic
1039009168 8:33074372-33074394 CTGTGCTGGTGGGGTGGAGCAGG - Intergenic
1039391013 8:37180768-37180790 CCGTCAAGGTGGAGGGGAGCAGG + Intergenic
1039398162 8:37245144-37245166 TGGTGGAGATGGAGAGCAGCAGG + Intergenic
1039948497 8:42150264-42150286 CCATGGAGGTGGTGAGGAGGAGG - Intergenic
1039965216 8:42279053-42279075 GAGTAGAGGTGGAGGGGAGCAGG + Intronic
1040514155 8:48120778-48120800 CTGTGCAGGTGGGGAGGGGCTGG - Intergenic
1041056086 8:53987940-53987962 CTGTTAAGGGGGAGAGGAGGAGG - Intronic
1041750946 8:61260514-61260536 ATGGAGAGGTGGAGAGGAGATGG - Intronic
1041973427 8:63769212-63769234 TTGTGGTGGTGCAGGGGAGCTGG - Intergenic
1042376644 8:68059871-68059893 CTCTGAAGATGGAGAGGACCTGG - Intronic
1042483191 8:69325749-69325771 CTGAAGAGCTGTAGAGGAGCCGG + Intergenic
1042692252 8:71513737-71513759 GTGAGGAGCTGGAGAGGAGGTGG - Intronic
1042775517 8:72426531-72426553 CAGTGGAGGTGGAGAAGTGAAGG - Intergenic
1043639702 8:82436254-82436276 CCCAGGAGGTGGAGAGGAGGTGG + Intergenic
1044352865 8:91186797-91186819 GTGTGGGGGTGGTGAGGAGGTGG + Intronic
1045673970 8:104588594-104588616 CTCGGGTGGTGGAGAGGGGCTGG - Intronic
1046091980 8:109513813-109513835 CAGTGGAGGTGGTGAGAAGTGGG - Intronic
1046776832 8:118173321-118173343 TTATGGAGGTGGAGAGCAGAAGG + Intergenic
1047741446 8:127810090-127810112 CTCTGGAAAGGGAGAGGAGCAGG + Intergenic
1047744003 8:127830352-127830374 CTTGGCAGGTGGAGAGGGGCAGG + Intergenic
1048023069 8:130558698-130558720 CTTTGGAGGTTCAGAGAAGCGGG + Intergenic
1048702596 8:137109695-137109717 CTGAGGAGATGGACATGAGCAGG - Intergenic
1049151603 8:141038590-141038612 CTGGGGAGGAGGAGAGCAGCGGG - Intergenic
1049238162 8:141523088-141523110 CTGGGGAGGTGGAAAGAACCTGG - Intergenic
1049238454 8:141524570-141524592 CTGTGGAGGTAGACAGTTGCGGG + Intergenic
1049304486 8:141893708-141893730 CTGAGGGGGTGGGGAGGAGCTGG - Intergenic
1049310488 8:141931381-141931403 CTGAGGAGGAGGTGAGGAGGGGG + Intergenic
1049376639 8:142292474-142292496 CTGTGGAGGTGGTGGGTGGCGGG + Intronic
1049424509 8:142532136-142532158 CTGTGTAGGAGGAGGGGAGGAGG + Intronic
1049425376 8:142535734-142535756 CTGTGGGCGAGCAGAGGAGCTGG - Intronic
1049466110 8:142752006-142752028 CAGTAGAGATGGAGAGGAGTGGG - Intronic
1049602937 8:143516318-143516340 ATGTGGTGGTGGCCAGGAGCAGG + Intronic
1049808992 8:144554894-144554916 CTGTGGTGCTGGGGAGGAACTGG - Intronic
1051349306 9:16184122-16184144 GTGTGGAGGTGGAGGTGAGGAGG + Intergenic
1052111919 9:24596434-24596456 TTATGGGGGTGGAGAGGATCAGG - Intergenic
1052402012 9:28012265-28012287 ATGTGAAGGTGGAGAGGAGCTGG + Intronic
1052508589 9:29384905-29384927 CTGGAGAGGTGGAGAGGATGTGG + Intergenic
1053238829 9:36479459-36479481 ATGTGGGGGTGGAGAGAAGCAGG + Intronic
1053281120 9:36820306-36820328 CAGCAGAGGAGGAGAGGAGCTGG - Intergenic
1053423572 9:37996646-37996668 CTGGGGAGGTGGGGACCAGCAGG - Intronic
1053434279 9:38065258-38065280 GGGTGGAGGTGGAGGGGTGCTGG + Intronic
1053441694 9:38121418-38121440 GTGTGGAGGTGGACAGGGACAGG + Intergenic
1055346934 9:75349760-75349782 CAGTGGAGGTGGCGAGGGGTGGG + Intergenic
1055915604 9:81397093-81397115 CCGTGGAGGTGGCAGGGAGCTGG - Intergenic
1056581152 9:87888721-87888743 CTGTGGTGGTGGGGACCAGCTGG - Exonic
1056775714 9:89511108-89511130 CTCTGAAGGTGGAGATGAGGTGG - Intergenic
1057152757 9:92809103-92809125 CTTTGGAGGAGGAGCGGGGCGGG + Intergenic
1057268843 9:93635919-93635941 CTGGGGAGGTGGGGAGGAGACGG + Intronic
1057575691 9:96240602-96240624 GTGGCGAGGTGGAGAGAAGCCGG - Intronic
1057596183 9:96417882-96417904 GTGCGGCGGTGGAGGGGAGCCGG - Exonic
1057684693 9:97221775-97221797 CTTCGGAGGAGGAGAGGAGCGGG - Intergenic
1057875114 9:98747776-98747798 GTGTGGAGGTGGACAGGGGTTGG - Intronic
1057904907 9:98975798-98975820 CTGTGGATGTTTAGAGGAGGGGG + Intronic
1057918318 9:99074771-99074793 CTGAGGAGGTGGAGAGCAGGTGG - Intergenic
1058435587 9:104959785-104959807 TTGTGGAGGTGGAAAGCACCAGG - Intergenic
1058592720 9:106582737-106582759 CTGTGGAGGTGCTGAGGGTCTGG - Intergenic
1059104661 9:111501252-111501274 CTGTGGAGCTGGCTGGGAGCAGG + Intergenic
1059429536 9:114241506-114241528 CTGTGGGGGTGGGGAGCACCTGG + Intronic
1059763353 9:117360502-117360524 CTGGGGATATGGAGATGAGCAGG + Intronic
1059956496 9:119521484-119521506 CTGTGGAAGTCCAGAGGAGGCGG - Intronic
1060202630 9:121660532-121660554 GAGGGCAGGTGGAGAGGAGCTGG + Intronic
1061029692 9:128073196-128073218 GTGTTAAGGAGGAGAGGAGCAGG - Intronic
1061271281 9:129544840-129544862 CTGGGGAGGTGGAGAGTAGGAGG - Intergenic
1061304556 9:129724811-129724833 GGGTGAAGGTGGAGAGGAACAGG + Intergenic
1061391744 9:130320686-130320708 CTGGGGAGGGAGAGGGGAGCAGG + Intronic
1061644250 9:131987336-131987358 CTGTAGATGTGGAGATGAGAAGG + Intronic
1061726274 9:132583561-132583583 CAGTGCTGGTGGACAGGAGCAGG + Intronic
1062016938 9:134295780-134295802 CGGTGGAGATAGAGGGGAGCTGG - Intergenic
1062016946 9:134295807-134295829 CGGTGGAGATAGAGGGGAGCTGG - Intergenic
1062016954 9:134295834-134295856 CGGTGGAGATAGAGGGGAGCTGG - Intergenic
1062111183 9:134782895-134782917 AAGAGGAGGTGAAGAGGAGCTGG - Intronic
1062147383 9:134997182-134997204 CTGTGAAGATGGCGGGGAGCAGG + Intergenic
1062147392 9:134997219-134997241 CTGTGAAGATGGCGGGGAGCAGG + Intergenic
1062272026 9:135714151-135714173 CTGGGGACGGGGAGGGGAGCTGG + Intronic
1062326652 9:136015572-136015594 CTTTGGGGGTGGACAGGAACAGG + Intronic
1062448038 9:136603972-136603994 CTGGGGATGAGGAGAGGAGGAGG + Intergenic
1062486288 9:136778035-136778057 CTGGAGACTTGGAGAGGAGCTGG - Intergenic
1062502275 9:136856658-136856680 CTCTGGAGGGGGAGGGGAGAAGG + Intronic
1062504406 9:136865891-136865913 GACTGGAGGAGGAGAGGAGCAGG - Intronic
1203696978 Un_GL000214v1:108660-108682 CTTCGGAGGAGGAGAGGGGCGGG - Intergenic
1203552235 Un_KI270743v1:172369-172391 CTTCGGAGGAGGAGAGGGGCAGG + Intergenic
1186441478 X:9590845-9590867 CTGTGGGGGTGGGGAGGATGGGG + Intronic
1186621303 X:11243224-11243246 GTGAGTAGGTGGAGGGGAGCAGG - Intronic
1186630154 X:11340008-11340030 CTGTGGAGATGGAGAAGGGATGG - Intronic
1186888701 X:13938966-13938988 CTGGGGAGGTTGGGGGGAGCGGG + Intergenic
1187929515 X:24281067-24281089 CCGTGGGGGTGGTGAGAAGCGGG + Intergenic
1188272544 X:28158440-28158462 AGGTGAAGTTGGAGAGGAGCTGG - Intergenic
1190884625 X:54520713-54520735 CTGTGGGGGTGCAGGGGAACTGG + Intergenic
1190898402 X:54643806-54643828 TTGTGGAGGTAGAGAGTAGTAGG - Intergenic
1191059507 X:56279694-56279716 CAGTGGAGATGGAGAGAAGGAGG + Intronic
1192265010 X:69531847-69531869 CTGGGGAGGGGAAGAGGTGCTGG + Exonic
1195224015 X:102773610-102773632 CTGTGGAGATAGAGAGTAGAAGG - Intergenic
1195408561 X:104544056-104544078 CAGTGGAGATGGAGAGAAGTAGG - Intergenic
1195775815 X:108405104-108405126 CTGAGGAGGTGCAGAGGATAAGG - Intronic
1196852355 X:119949501-119949523 CTGTGGAGGTGGAGTGGGGCAGG - Intergenic
1198595240 X:138228984-138229006 GTGTGGAGGTGAAGAGGTGTGGG - Intergenic
1198684308 X:139211572-139211594 CTGTGGGGGTGGGGGGTAGCGGG - Intronic
1199599776 X:149535056-149535078 ATGAGGAGGAGGAGAGGAGAAGG - Intergenic
1199650863 X:149945191-149945213 ATGAGGAGGAGGAGAGGAGAAGG + Intergenic
1199686702 X:150271591-150271613 CAGTGGAGGTGGAGACAAGTGGG + Intergenic
1199771887 X:150980411-150980433 CTGGGGGGATGGGGAGGAGCAGG + Intergenic
1200080010 X:153571656-153571678 CTCCGGAGGTGGGGAGGAGGGGG - Intronic
1201690482 Y:16759320-16759342 TTCTGTAGGTGGAGAGGAGAAGG - Intergenic