ID: 1136453954

View in Genome Browser
Species Human (GRCh38)
Location 16:30370097-30370119
Sequence CGCCGCCGCCCCGGGGTTCC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 293
Summary {0: 1, 1: 0, 2: 0, 3: 33, 4: 259}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136453954_1136453970 12 Left 1136453954 16:30370097-30370119 CCGGGAACCCCGGGGCGGCGGCG 0: 1
1: 0
2: 0
3: 33
4: 259
Right 1136453970 16:30370132-30370154 GGGCGCCATGACGGCGCGGCGGG 0: 1
1: 0
2: 0
3: 8
4: 82
1136453954_1136453966 3 Left 1136453954 16:30370097-30370119 CCGGGAACCCCGGGGCGGCGGCG 0: 1
1: 0
2: 0
3: 33
4: 259
Right 1136453966 16:30370123-30370145 GGGCCGCGGGGGCGCCATGACGG 0: 1
1: 0
2: 0
3: 16
4: 172
1136453954_1136453975 23 Left 1136453954 16:30370097-30370119 CCGGGAACCCCGGGGCGGCGGCG 0: 1
1: 0
2: 0
3: 33
4: 259
Right 1136453975 16:30370143-30370165 CGGCGCGGCGGGGCCACCAGGGG 0: 1
1: 0
2: 1
3: 16
4: 200
1136453954_1136453971 13 Left 1136453954 16:30370097-30370119 CCGGGAACCCCGGGGCGGCGGCG 0: 1
1: 0
2: 0
3: 33
4: 259
Right 1136453971 16:30370133-30370155 GGCGCCATGACGGCGCGGCGGGG 0: 1
1: 0
2: 0
3: 6
4: 58
1136453954_1136453965 -8 Left 1136453954 16:30370097-30370119 CCGGGAACCCCGGGGCGGCGGCG 0: 1
1: 0
2: 0
3: 33
4: 259
Right 1136453965 16:30370112-30370134 CGGCGGCGAGGGGGCCGCGGGGG 0: 1
1: 3
2: 7
3: 138
4: 856
1136453954_1136453964 -9 Left 1136453954 16:30370097-30370119 CCGGGAACCCCGGGGCGGCGGCG 0: 1
1: 0
2: 0
3: 33
4: 259
Right 1136453964 16:30370111-30370133 GCGGCGGCGAGGGGGCCGCGGGG 0: 1
1: 2
2: 14
3: 117
4: 862
1136453954_1136453968 8 Left 1136453954 16:30370097-30370119 CCGGGAACCCCGGGGCGGCGGCG 0: 1
1: 0
2: 0
3: 33
4: 259
Right 1136453968 16:30370128-30370150 GCGGGGGCGCCATGACGGCGCGG 0: 1
1: 0
2: 0
3: 4
4: 95
1136453954_1136453973 21 Left 1136453954 16:30370097-30370119 CCGGGAACCCCGGGGCGGCGGCG 0: 1
1: 0
2: 0
3: 33
4: 259
Right 1136453973 16:30370141-30370163 GACGGCGCGGCGGGGCCACCAGG 0: 1
1: 0
2: 1
3: 19
4: 193
1136453954_1136453963 -10 Left 1136453954 16:30370097-30370119 CCGGGAACCCCGGGGCGGCGGCG 0: 1
1: 0
2: 0
3: 33
4: 259
Right 1136453963 16:30370110-30370132 GGCGGCGGCGAGGGGGCCGCGGG 0: 1
1: 6
2: 16
3: 166
4: 1191
1136453954_1136453969 11 Left 1136453954 16:30370097-30370119 CCGGGAACCCCGGGGCGGCGGCG 0: 1
1: 0
2: 0
3: 33
4: 259
Right 1136453969 16:30370131-30370153 GGGGCGCCATGACGGCGCGGCGG 0: 1
1: 0
2: 0
3: 6
4: 74
1136453954_1136453974 22 Left 1136453954 16:30370097-30370119 CCGGGAACCCCGGGGCGGCGGCG 0: 1
1: 0
2: 0
3: 33
4: 259
Right 1136453974 16:30370142-30370164 ACGGCGCGGCGGGGCCACCAGGG 0: 1
1: 0
2: 0
3: 14
4: 102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136453954 Original CRISPR CGCCGCCGCCCCGGGGTTCC CGG (reversed) Exonic
900150816 1:1178715-1178737 TGCGGCCGCCCCTGGGTGCCAGG - Intronic
900166694 1:1246833-1246855 CGCCGTCGCGCCGCCGTTCCGGG - Intergenic
900283766 1:1889994-1890016 CGCCGCCGCGCCGAGTTTCGGGG - Intronic
900349743 1:2228685-2228707 CGCCGCCGCCCCGCGCGCCCCGG - Exonic
900613900 1:3555771-3555793 CGCCGCTGGCCCGGCTTTCCAGG - Intronic
900710155 1:4108463-4108485 CGCCCCCGCCCCGGGGCACATGG - Intergenic
900796482 1:4711652-4711674 CGCCTCAGCCCCGCGGTGCCGGG + Intronic
901381603 1:8878391-8878413 CGCCCCCGCCCCGGGCCTCGGGG + Intronic
901443311 1:9292644-9292666 AGCCGCCGCCCTGGTGTTGCCGG - Intergenic
902336853 1:15758953-15758975 GGGCGCCGCGCCGGGGGTCCCGG - Intronic
902400616 1:16155041-16155063 CACCCCCGCCCCAGTGTTCCCGG - Intronic
902744347 1:18463498-18463520 GGCCGGCGTCCCGGGGCTCCTGG + Intergenic
903233755 1:21936992-21937014 TGGCGCCGGCCCGGGGTCCCCGG + Intronic
904701657 1:32361770-32361792 TGCCGCCGCCCCCGAGTCCCAGG - Exonic
904744470 1:32702630-32702652 CCCCGCCGCGCCGGGGCTCCGGG + Exonic
905569329 1:38991438-38991460 CGCCGCCGCTTCGGGGAGCCGGG - Exonic
905626220 1:39491932-39491954 CGCCGCCGCCCCTGGGCCCGGGG - Exonic
908534637 1:65066703-65066725 CGCCGCCGCCGCGGGGACTCCGG + Intergenic
909352749 1:74673660-74673682 CGCCGCCGCCCCTGGGCGCCCGG + Exonic
911664732 1:100539689-100539711 CGCCGCCGCCGCCGCCTTCCCGG + Exonic
920385747 1:205569318-205569340 CGCCCCCGCCCCGCGGCCCCCGG + Intronic
921189972 1:212700078-212700100 CGCCGGCGCCCCGCGCTTCGTGG + Intergenic
921909083 1:220528292-220528314 CGCCGCCGCCGCTGGGCCCCGGG + Intronic
922119093 1:222644508-222644530 CGCCGCTACCCCGGGGGACCCGG + Intronic
922705636 1:227788717-227788739 CGCCCCCGCCGCGGAGTCCCGGG + Intergenic
923171638 1:231422210-231422232 CGCCGCCGCCTCAGCGTCCCGGG + Exonic
1062822716 10:547152-547174 CGCTGCAGCACCGGGATTCCGGG - Intronic
1062971768 10:1653991-1654013 CACAGCTGCCCCGGGGGTCCTGG + Intronic
1063663887 10:8050657-8050679 CGCCGGGGCTCCGGGGCTCCGGG + Intergenic
1063929724 10:11017662-11017684 CTCCCCCGCCCGGGGGTCCCTGG - Intronic
1064167792 10:13001582-13001604 CGCCGCCGCCCCGTGCGCCCCGG - Exonic
1064208966 10:13347770-13347792 CGCCGCCGCCGCGCGGGGCCGGG - Intronic
1065025403 10:21535150-21535172 CGCGCCCTTCCCGGGGTTCCCGG + Intronic
1065101976 10:22340641-22340663 CGCCGCGGGGCCTGGGTTCCCGG + Intergenic
1067436931 10:46284901-46284923 CGCCGCCGCCCTCTGGCTCCTGG + Intergenic
1071546983 10:86536572-86536594 CGCCGCGGCTCCCGGGTCCCGGG - Intergenic
1071695287 10:87863508-87863530 CGCCGCCGCGCCGGGAGCCCGGG - Exonic
1074169678 10:110919828-110919850 CGCCGCCGCCGCCGCTTTCCTGG + Intronic
1075430428 10:122375224-122375246 CGCAGCTGCCCGGGGATTCCCGG + Intronic
1075693639 10:124418427-124418449 CCGAGGCGCCCCGGGGTTCCGGG - Intronic
1076721980 10:132396862-132396884 CCCCGCCGCCCCCGGGCTCGTGG + Intergenic
1077023389 11:429638-429660 CGCCGCAGCCACGGTGTTCCTGG - Exonic
1077360857 11:2139566-2139588 CGCCCCCCCCCCGGGGCCCCAGG - Intronic
1077544902 11:3165057-3165079 CGCCGCAGCCCCGCGGACCCTGG - Intronic
1078594675 11:12675278-12675300 CGCCGCCGCCCCCCGGCGCCGGG + Intronic
1078771803 11:14358722-14358744 CGCCGCCGCTCCGGCGCCCCGGG + Intronic
1079237108 11:18698877-18698899 CGCCGCCGCCATGGTGTCCCCGG + Exonic
1080540270 11:33257911-33257933 CGCCGCCACCCCGGGGTGGGGGG + Intronic
1080677118 11:34438685-34438707 CCCCGCCGGCCCGGGGTGCCCGG - Intergenic
1081636757 11:44726968-44726990 CGCCGGCGTCGCGGGGCTCCAGG + Intronic
1081773919 11:45665251-45665273 CGCCGCCACCCGCGGGTCCCCGG - Exonic
1081779943 11:45703245-45703267 CGCTGCCGCCCCTGCTTTCCTGG - Intergenic
1081870943 11:46382216-46382238 AGCCGCCTTCCTGGGGTTCCAGG - Intronic
1083596257 11:63919425-63919447 CCCTGCCGCCCCGGGGCTGCGGG + Intergenic
1083992974 11:66258011-66258033 CGCCCCCGCCCCGGGCCACCCGG - Intronic
1084527110 11:69704309-69704331 CGCAGCGGCCCCGAGGTTCTTGG + Exonic
1084588854 11:70078799-70078821 GGCCCCCGCCCTGGGGTCCCAGG - Intronic
1084888117 11:72223827-72223849 CCGCGCCGCCCCGGGGAGCCGGG - Intronic
1085640282 11:78188914-78188936 CGGCGCGGCCCCGGGGCTGCGGG - Exonic
1089729467 11:120511534-120511556 CGCCCCCGCGCCTGGGCTCCCGG + Intergenic
1091306402 11:134539011-134539033 GTCCGTCGCCCCGGGGTTCCAGG - Intergenic
1091688971 12:2583059-2583081 CTCCGCCGCCATGGGGTTCTAGG - Intronic
1093931137 12:24956095-24956117 CGCCCCCGCCCCGGGGAGCTGGG + Intergenic
1095271461 12:40224618-40224640 CGCCTCCGCTGCGGGGCTCCGGG + Intronic
1095810805 12:46372140-46372162 CTCCGCCGCCCCCAGATTCCTGG + Intronic
1095986852 12:48004731-48004753 CGCCGCAGCCCCGGGTTTGGGGG - Intergenic
1096250067 12:50025299-50025321 CGTGGCCGCCGCGGGGGTCCGGG - Intronic
1096622684 12:52874327-52874349 CGGCGCCGCCCTGGGGCCCCCGG - Intergenic
1096749950 12:53752162-53752184 CGCCGCCGCCGCCGCCTTCCAGG + Intergenic
1096983734 12:55743390-55743412 CGCCGCCGCCGCGGGGCCCTCGG - Exonic
1097058852 12:56267461-56267483 CGCGGGCGCCCTGGGGTCCCCGG + Intronic
1098943042 12:76559449-76559471 CGCCGCGGCGCCGGGGTCCGAGG + Exonic
1100468980 12:94873610-94873632 CGCCGTCGCCCCGGGGTGCGGGG - Intergenic
1102937585 12:116910917-116910939 CGCCGCCGCTCTAGGGTTCCGGG - Intergenic
1103464803 12:121133390-121133412 CGCCTCCTCCCTGGGGATCCAGG - Intronic
1103474811 12:121210435-121210457 AGCCGCCGCGCCGGGGCCCCGGG + Intronic
1105019969 12:132809437-132809459 CCCCCCCGCCCCCCGGTTCCCGG + Intronic
1106208409 13:27620509-27620531 CGCCGCCGCCGCGGATTTCCTGG + Intergenic
1107534149 13:41311601-41311623 CGCTGCCGCCCCCCGGTCCCCGG + Intronic
1107604025 13:42040805-42040827 CGCCGCTGCGCCGGGGCTCCTGG - Intronic
1113082727 13:106535187-106535209 CGCGGCGGACTCGGGGTTCCGGG + Intergenic
1114670847 14:24410153-24410175 CGCCGCAACCCCTGGTTTCCAGG - Exonic
1115398623 14:32935032-32935054 TGCCCCCGCCCCGGGGTGCTGGG + Intronic
1116905087 14:50396634-50396656 CGCCGCCTCCGCGGGGAGCCGGG - Intronic
1118186539 14:63543127-63543149 CGCCGCCGCCGCCGGGTCCGGGG - Exonic
1118339092 14:64879818-64879840 CGCCGCCACCCCCGGGCTCGGGG - Exonic
1120190467 14:81435899-81435921 CGGCGCCAACCCGGGGTTTCAGG + Intronic
1120346856 14:83301572-83301594 CGCTGCTGCCCCTGGCTTCCGGG + Intergenic
1127144081 15:56007186-56007208 CGCCGCCGCCGCCCGGATCCTGG - Intergenic
1127225115 15:56919377-56919399 CGCCGCCGCCCGGACGTCCCCGG - Intronic
1128028573 15:64460584-64460606 CGCCGCCGCCGCCGCGATCCGGG - Intergenic
1128075716 15:64824136-64824158 CGCGGCCGCCCCGCGGGCCCTGG + Exonic
1128078164 15:64841370-64841392 CGGCCCCGCCCAGAGGTTCCAGG + Intergenic
1129862542 15:78873501-78873523 CGCAACCACCCCGGGGCTCCAGG - Intronic
1130613430 15:85381159-85381181 CGGCGCCGACCCGGGGACCCGGG - Intronic
1131972250 15:97904323-97904345 AGGCGCCGCCTCGGGCTTCCTGG - Intergenic
1132527523 16:425141-425163 CTCCGCGGCCCAGGGGTTGCAGG - Intergenic
1133005989 16:2882340-2882362 TGCCACCGCCCCAGGGCTCCAGG - Intergenic
1133032924 16:3020307-3020329 CGCCCCCGCCCCCGCCTTCCGGG - Exonic
1133156586 16:3880509-3880531 CGCCGCCGCCGCCGGGCTCCGGG + Exonic
1133241331 16:4416181-4416203 CTGCGCCGCCTCGGGGGTCCCGG + Intronic
1136110997 16:28063578-28063600 CGCCCCCACCCCGGGGTTGGGGG - Intergenic
1136383987 16:29911411-29911433 GGCCACCTCCCCGGGGGTCCTGG + Intronic
1136409946 16:30070277-30070299 GGCCGCCTCCTCGGGGCTCCAGG + Exonic
1136453954 16:30370097-30370119 CGCCGCCGCCCCGGGGTTCCCGG - Exonic
1136534689 16:30892885-30892907 CGCCCCTGCCCCGACGTTCCCGG + Exonic
1136573181 16:31108770-31108792 CCCCAGCGCCCCGGGGTCCCGGG - Intronic
1139364833 16:66427048-66427070 CGCCGCCGCCGAGGGGGGCCGGG + Intergenic
1139528155 16:67528989-67529011 CGGCGCCGCCCGGTGGGTCCGGG + Intronic
1139615444 16:68085755-68085777 CGCCGCCGCCCCCGGGCTCGCGG + Exonic
1139750451 16:69106480-69106502 GGCGGCAGCCCCGGGCTTCCCGG + Intronic
1139949962 16:70663941-70663963 GGCCCCTGCCCCGGGGTACCCGG + Exonic
1140478564 16:75250912-75250934 GGCCGCCGGCGCGGGGTTCCGGG - Intronic
1141608590 16:85169273-85169295 CGCCGCCGCCGCCGCGTTCCGGG + Intergenic
1141608608 16:85169325-85169347 CGCCGCCGCCGGGGGGTGCTCGG + Intergenic
1141997353 16:87644052-87644074 CGCCTGAGCCCAGGGGTTCCTGG + Intronic
1142631623 17:1229571-1229593 CGCCTCCGCCCCGGGGAACTCGG + Intergenic
1142990018 17:3724149-3724171 CGCCGCCTCACCGGGCTGCCGGG - Exonic
1143007511 17:3846358-3846380 CGCCGCCGCCCCCTGGTGGCGGG + Intergenic
1143063359 17:4222216-4222238 CCCCGCCGCCCCGCGGACCCCGG + Intronic
1145796033 17:27655770-27655792 CGCCGACCCCTGGGGGTTCCGGG - Intergenic
1146720442 17:35119848-35119870 CGCTGCCGCTTCCGGGTTCCAGG + Intronic
1147599155 17:41734959-41734981 AGCTGCCGCGCCGGGGTTTCGGG + Intergenic
1148323638 17:46771484-46771506 CCCCGCCGCCCCCGCGTTCCCGG - Intronic
1148397733 17:47323819-47323841 CGCCACCGCCCAGGGGCTCCGGG - Intronic
1148579379 17:48733228-48733250 CGCCGCGCCCCCGGGGGTTCCGG + Intergenic
1149038366 17:52158871-52158893 TGCCTCCGCCCCCGGGTGCCGGG - Intronic
1149658880 17:58324379-58324401 CACCGCCGCCCCCGGGTAGCTGG + Intronic
1149678499 17:58487738-58487760 CGCCGCCGCCCGCGGGGCCCCGG - Exonic
1150124377 17:62627253-62627275 CGCCCCCGCCCCGGGCTGGCCGG + Intergenic
1150212072 17:63446860-63446882 CGCCGCCGCTCCGGGAGCCCTGG + Intergenic
1150236992 17:63601191-63601213 CACCGCAGCCCCGGGGCTCGGGG - Exonic
1150272304 17:63874269-63874291 CGCCTCCGCCCCAAGGTTCAGGG - Intronic
1150275851 17:63897166-63897188 CGCCTCCGCCCCAAGGTTCAGGG - Intergenic
1150675747 17:67245034-67245056 GGCCGCCGCGCCCGGGGTCCGGG + Intronic
1152107903 17:78341741-78341763 AGCTGCGGCCCCGGGCTTCCCGG - Intergenic
1152383192 17:79952781-79952803 CGACGCCGGCCTGCGGTTCCCGG - Exonic
1152753687 17:82078140-82078162 CGTGGCAGCCCCGGGCTTCCCGG - Intergenic
1153565651 18:6414891-6414913 CGCCGCTGCCCCGCGGTGCCCGG + Intronic
1155053865 18:22169207-22169229 CGCCCCTCCCCCGGGGTCCCTGG + Intergenic
1157701276 18:49762747-49762769 CGCCGCCCCACCGGGCCTCCCGG + Intergenic
1158954165 18:62523606-62523628 CGCCGCCGCCCCGGGGACTCGGG + Exonic
1158976592 18:62716004-62716026 CGCCGCCGGCCCCGGGTACGGGG - Exonic
1160150092 18:76392014-76392036 CAACGCCGCCCCTGGCTTCCGGG + Intronic
1160204661 18:76822751-76822773 CGCCCCCGCCCCGCCGCTCCCGG - Intronic
1160763565 19:797562-797584 CGCCGCCGCGCCGGCCTCCCCGG + Intronic
1160862161 19:1242022-1242044 GGCCGCCGCCCCCGGAGTCCAGG + Intronic
1160863905 19:1249029-1249051 CGCCCCCTCCCCGGGACTCCGGG + Intronic
1161215819 19:3094597-3094619 CGCCGCCGCCCCCCGGCCCCCGG - Exonic
1161224353 19:3136255-3136277 CACCGCCGAGCCGGGCTTCCTGG + Exonic
1161317380 19:3623937-3623959 CGCGGCCGCCCGGGGGCTCTGGG + Exonic
1161975966 19:7607876-7607898 ATCCCCCGCCCCGGGGTCCCAGG + Intronic
1162199414 19:9009880-9009902 AGTCGCCGCCGCAGGGTTCCAGG - Intergenic
1162535847 19:11262487-11262509 CGCCGCCGCCTCCCGGTTCTGGG + Intergenic
1162921616 19:13906462-13906484 CGCCTCTGCCCGGGGGTCCCGGG - Exonic
1163248591 19:16112173-16112195 CACCGCCGTTCGGGGGTTCCTGG + Intronic
1163634946 19:18433440-18433462 GGCCTCAGTCCCGGGGTTCCTGG + Intronic
1165858321 19:38893598-38893620 GGCCCCAGCCCTGGGGTTCCCGG + Intronic
1165952266 19:39481023-39481045 CGCCGCCCCTTGGGGGTTCCGGG + Intronic
1166100359 19:40567979-40568001 CTCCGCCGCCGCGGGGGTCGCGG - Exonic
1166304153 19:41928165-41928187 CTCTGCCTCCCCGGGGCTCCGGG - Intronic
1166367299 19:42284183-42284205 CGCCGCCGCCCCGCCTTTCCGGG - Intronic
1166528412 19:43527249-43527271 CGCCCCCGCCCCGCCCTTCCCGG - Intronic
1167074990 19:47243228-47243250 CGCCGCAGCCGCGGGGCTCCGGG + Intergenic
1167298153 19:48663868-48663890 CGCCCCTGCCCCGGGAATCCAGG + Intronic
1167437193 19:49486344-49486366 CAGCGCCGGCCCGGGGCTCCAGG - Intergenic
1168336282 19:55599408-55599430 CGGGGCCGCCCCGGGTCTCCAGG - Intronic
925081968 2:1077537-1077559 TGCCGCAGACCCGGGGTTCATGG - Intronic
925900888 2:8508753-8508775 GGAGGCCACCCCGGGGTTCCTGG - Intergenic
932567928 2:72921053-72921075 CGCCGCCGGCCAGGGGCTCAGGG - Intronic
932779061 2:74548923-74548945 CGCCGCCGTCCCCGGGCCCCCGG + Intronic
938317981 2:130343019-130343041 CTCCGGGGCTCCGGGGTTCCGGG + Intronic
942046557 2:172102439-172102461 CGCCGCCGCTCGGGGGCTGCTGG + Exonic
943639541 2:190343642-190343664 CGCTGCCGCCTCGGGGCTCCCGG - Exonic
946322083 2:218960144-218960166 CGCCGCCGTCGGGGGGATCCCGG - Exonic
946339936 2:219060470-219060492 CGCCGCTCCCCCGGGCTCCCCGG - Intergenic
948140476 2:235669506-235669528 CGCCGCCGCCGCCGCGCTCCCGG + Intronic
948368877 2:237475179-237475201 CTCCGAGGCCCCGGGGTCCCCGG + Intergenic
948467440 2:238159076-238159098 CGCCGCGGGCCTGGGGTCCCCGG + Exonic
948806063 2:240453807-240453829 CGTCGCCGCCCTGGGGGTCCCGG - Intronic
948916318 2:241036445-241036467 CGCCTCCCCTCCAGGGTTCCTGG - Intronic
1168757241 20:325965-325987 GGCCGCCGCCCCCGGGACCCGGG + Exonic
1169214736 20:3786519-3786541 CGCCGCCGCCCCGGGGCGGGGGG + Exonic
1171034964 20:21706953-21706975 GGCAGCCACCCCGGGGTCCCGGG + Exonic
1172640189 20:36436105-36436127 CGCCGCCGCCGCCGGGCACCTGG - Exonic
1173820082 20:46013990-46014012 CGCCTCTGCCCCTGGGTTGCAGG + Intronic
1176113320 20:63420518-63420540 CGTCGCCACGCTGGGGTTCCTGG - Intronic
1176207114 20:63895206-63895228 CGCCGCCGCCCGGGGTCTCCAGG + Exonic
1178922591 21:36748123-36748145 CGCCGCAGCCCCGGGAGGCCGGG - Exonic
1179511999 21:41879343-41879365 CGCCGCCGCCCCCCGGCTTCCGG - Exonic
1179891808 21:44339078-44339100 CGCGGCCGCCCCGGGGTGGGGGG - Intronic
1180960679 22:19761032-19761054 CGCCGCCGCCCCCGGCGCCCCGG + Exonic
1181085126 22:20436392-20436414 CGCCGCCGCCGCTGCATTCCTGG + Intronic
1184004305 22:41697341-41697363 CGCTGCCGGCCTGGGGGTCCTGG - Exonic
1184087050 22:42271195-42271217 AGCCCCCGCCCATGGGTTCCAGG + Intronic
1185278624 22:49960659-49960681 CGCCGCCGCCTCGCGGGCCCCGG + Exonic
1185313821 22:50170427-50170449 CGCCGCCGCCCCCGGGGTCAGGG - Intergenic
1185398526 22:50604480-50604502 CGCGGCCGCCTCGGGGTCCTGGG - Exonic
949260514 3:2098902-2098924 CGCCGCCGCCCCGGGCCCCTCGG + Intronic
950168026 3:10816206-10816228 CGCCGCCGCCCCGGGCGAGCTGG - Exonic
958714630 3:97764688-97764710 CCACGCCTCCCCGGGGGTCCTGG - Exonic
960691199 3:120348677-120348699 GCCCGGCGCCCCAGGGTTCCCGG + Intronic
961012973 3:123448363-123448385 CACCGCCCCCCCGGGTTTCTTGG + Exonic
961827181 3:129605310-129605332 CGCCACCGCCCGGGTGTACCTGG + Exonic
962301848 3:134250495-134250517 CGCCCCCGCCCCGCGGCCCCCGG - Exonic
965773809 3:172208653-172208675 CGCCGCCGGCCAGAGGTTTCTGG - Intronic
966887566 3:184385188-184385210 CGCCGAGGCCCTGGCGTTCCAGG - Exonic
967859604 3:194141297-194141319 CGGGGCGGCCCGGGGGTTCCAGG + Intergenic
968161635 3:196432020-196432042 CCCCGCCGGCCCGGGGACCCGGG - Intronic
968659635 4:1793702-1793724 CGCCGCCGCCCAGGGCTCCCGGG - Intronic
970202880 4:13627489-13627511 CGCCGCCGCCGCCGGGCCCCGGG - Exonic
971019103 4:22516186-22516208 CGCCTCCTCCCCGAGGTCCCGGG - Intergenic
971279941 4:25234410-25234432 CGGAGCCGCCCCGCGGTTTCAGG + Exonic
971757558 4:30721971-30721993 TGCCGCCGCCTCCGGGCTCCTGG - Exonic
976600717 4:86935295-86935317 CGCCGCCGCCGCGGACTTCTCGG + Intronic
977525760 4:98143498-98143520 CGCCTCCTCCCCAGGCTTCCGGG - Intergenic
978503499 4:109433668-109433690 CGCCGCGGGCGCGGGGATCCTGG - Intergenic
979455683 4:120923006-120923028 CGCCGCCGCGCCGGGGCTAGGGG - Intergenic
979523772 4:121696885-121696907 CGCCGCTCTCCCGGGGTTTCGGG - Exonic
982712211 4:158768951-158768973 CGCCGCCGCCGTGGGGCTGCGGG + Intergenic
985565333 5:612497-612519 CGCCGCCGCCCCGGGAAGCTCGG - Intronic
990955153 5:61332812-61332834 CGCCGCCGCCGCGGGGGCCGGGG + Exonic
994197448 5:96936006-96936028 CGGCGCCGCTCCGCCGTTCCGGG - Exonic
1002061110 5:176626644-176626666 CGCCCCCGCCCTCTGGTTCCCGG + Intronic
1002176605 5:177404453-177404475 CCCCTCCGCCCCAGGGCTCCGGG - Intronic
1002424523 5:179167342-179167364 CGCGGCCGCACCCGGGCTCCCGG + Intronic
1002838086 6:882393-882415 CGCCGACGCCCCCGGCTTTCGGG - Intergenic
1003065830 6:2903071-2903093 CACCGCCTCCCCGGGGCTCTTGG + Intronic
1003086342 6:3064167-3064189 CACCGCCTCCCCGGGGCTCTTGG - Intronic
1004690462 6:17988063-17988085 TGCTGCCGTCCCGGGGCTCCGGG - Intergenic
1006682179 6:35805282-35805304 GGCCAGCGCCCCGGGGTTCCGGG - Exonic
1006860841 6:37170672-37170694 CGCCTCCGGCCCGGGGATGCGGG + Intronic
1006878483 6:37318689-37318711 CACCCCCACCCAGGGGTTCCAGG - Intronic
1017446351 6:154510342-154510364 CCCCGCCGCCGCCGGGATCCCGG + Exonic
1018668170 6:166158533-166158555 CGCCGTCACCCCGGGCTCCCAGG - Exonic
1018727890 6:166627482-166627504 CAGCGCCGCCCTGTGGTTCCAGG + Intronic
1018774213 6:166998864-166998886 CGGCGCCCCCCCGGGGCTGCAGG + Intergenic
1019088295 6:169502082-169502104 GGCAGCCGCCCCGGGGCTGCGGG + Intronic
1019279265 7:192148-192170 CGCAGACGCCCCGCGGCTCCGGG + Intergenic
1019343726 7:519923-519945 CCCCGCCTCCCCCGGATTCCGGG + Intronic
1019504212 7:1382760-1382782 CCCCGCCGTCCTGGGGTCCCAGG - Intergenic
1019547579 7:1585893-1585915 CGCCGCCACCCCAGGGCTGCCGG - Intergenic
1020071212 7:5228164-5228186 CGCCGCCCTCCTGGGGGTCCAGG - Exonic
1020238462 7:6374458-6374480 CGCCGCCGCTCCCAGGTTCCGGG - Intergenic
1022363370 7:29685043-29685065 CGCCGCCGCGGGGAGGTTCCCGG - Intergenic
1022427934 7:30285486-30285508 CGCCGCCGCGGGGAGGTTCCCGG + Exonic
1022698012 7:32728696-32728718 CGCCGCCGCGGGGAGGTTCCCGG + Intergenic
1023435127 7:40134465-40134487 CGCCCCCGCCCGGGGTTCCCCGG + Exonic
1024797453 7:53036160-53036182 CCCCGCCGCCCAGGAGCTCCTGG + Exonic
1025069676 7:55887590-55887612 CGCCGCCGCCGCGGTGGACCCGG - Intronic
1026732753 7:72925568-72925590 CGCCGCCGCTCCGGAGGGCCAGG + Intronic
1026909470 7:74083900-74083922 CGCCGCCGGCCCGGGGAGGCGGG - Intronic
1029281556 7:99438941-99438963 CGCCGCCGCCCGAGGGATGCCGG - Intronic
1029713782 7:102314639-102314661 CGCTGCCGCCCGGGGATTCCAGG - Exonic
1029927012 7:104328809-104328831 CGCCGCCGCCGCGATGCTCCCGG + Exonic
1030739059 7:113086553-113086575 CGCCGCGGCCCCTGCGTTACTGG - Intronic
1033159088 7:138981253-138981275 CGCCGCGCCCCCGGCATTCCCGG + Exonic
1034278954 7:149838525-149838547 CGCGACCGCCCCGGGGACCCAGG - Exonic
1034306284 7:150047674-150047696 CGCCGCCGCCGCCGCGCTCCCGG + Intergenic
1034800563 7:154052979-154053001 CGCCGCCGCCGCCGCGCTCCCGG - Intronic
1035169534 7:157009939-157009961 CGCCGCCGCCGCTGGGGGCCTGG - Exonic
1038632941 8:29262941-29262963 CGCCTCCGCCCCGGCGGCCCAGG + Intronic
1044719853 8:95134300-95134322 CGCCGCCGCCGCGGGGGGACGGG + Intronic
1044967225 8:97585294-97585316 CACAGCCTCCCCTGGGTTCCAGG - Intergenic
1049762195 8:144336647-144336669 CGCCGCCGCCCCCGGGGGCATGG - Intergenic
1049988128 9:970876-970898 CGCCGCCGCCCCGGGGCCCTTGG + Intergenic
1053314294 9:37038134-37038156 AGCCGTCGCCTCGGGGTTTCAGG + Intergenic
1054731526 9:68705992-68706014 CACTGCGGCCCCGGGGATCCGGG - Intronic
1054835650 9:69672545-69672567 CGCCGCCGCCGCGGGCTCGCGGG - Intergenic
1057245424 9:93451353-93451375 CGCCTCCGCCCGGTGGTTCTCGG - Intronic
1057259764 9:93576983-93577005 CGCCGCCGCCGCCGCATTCCGGG + Intronic
1057489274 9:95508880-95508902 CGCCGCCGCCGCGGGGTCCGAGG + Intronic
1059633944 9:116154357-116154379 CGCCGCCGCCGGGCGGTGCCTGG + Exonic
1059769782 9:117414623-117414645 CGCCGCCGCCGCCGCGTCCCCGG - Exonic
1060811706 9:126614158-126614180 AGCCGCCGCCGCCGGGTTCCGGG + Intergenic
1060916963 9:127397517-127397539 CGCCGCCGCCTCCTGGTTCGGGG + Exonic
1061015869 9:127980632-127980654 CGCCCCCGCACCTGGGTGCCGGG + Intergenic
1061859451 9:133460448-133460470 CCCCCCCGCCCTGGGGTTTCTGG - Intronic
1061898091 9:133658842-133658864 CGCCCCCGCCCCGCTGCTCCCGG + Exonic
1062022491 9:134326142-134326164 CGCCGCCTCCTCGCGGCTCCCGG + Intronic
1062162466 9:135087822-135087844 CGCCGCCGCCCCGCGCGCCCCGG - Exonic
1187770154 X:22686508-22686530 CCCCTCCGCCTCGGGGTCCCTGG - Intergenic
1187915463 X:24149523-24149545 CGGCGCCGACACGGGGTGCCAGG + Intronic
1187915727 X:24150365-24150387 CGCCGCCGCGCCGGGCCTCCGGG - Intronic
1189323186 X:40098188-40098210 CGCCTCCGCGGCGGGGTTTCGGG + Intronic
1189325561 X:40109015-40109037 CGCCGCCGCCGCCGCGTTCCCGG - Intronic
1190308599 X:49101213-49101235 CGCCTCCGCCCCTGCGCTCCGGG - Intergenic
1192630804 X:72776902-72776924 CTCCGCCGCCCGGGTCTTCCCGG - Intergenic
1192650906 X:72943902-72943924 CTCCGCCGCCCGGGTCTTCCCGG + Intergenic
1194600350 X:95913197-95913219 AGCTGCCGCCTGGGGGTTCCTGG + Intergenic
1198750354 X:139932315-139932337 AGCTGCCGGCCCGGGGTGCCGGG - Intronic
1198807166 X:140504058-140504080 CGCCGCCGCCTCGGGCTACGGGG - Exonic
1199793819 X:151177424-151177446 CGCCGCGGCCCTGGGGCTCCAGG + Intronic