ID: 1136454015

View in Genome Browser
Species Human (GRCh38)
Location 16:30370252-30370274
Sequence GGCGAGGCCAGCCGAGAAAG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1208
Summary {0: 1, 1: 0, 2: 0, 3: 37, 4: 1170}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136453995_1136454015 22 Left 1136453995 16:30370207-30370229 CCCCCGCCGGGGAGGCCGCAGAA 0: 1
1: 0
2: 0
3: 12
4: 149
Right 1136454015 16:30370252-30370274 GGCGAGGCCAGCCGAGAAAGGGG 0: 1
1: 0
2: 0
3: 37
4: 1170
1136454005_1136454015 -5 Left 1136454005 16:30370234-30370256 CCGCCCCTCGGGCCTCCCGGCGA 0: 1
1: 0
2: 0
3: 9
4: 159
Right 1136454015 16:30370252-30370274 GGCGAGGCCAGCCGAGAAAGGGG 0: 1
1: 0
2: 0
3: 37
4: 1170
1136454007_1136454015 -8 Left 1136454007 16:30370237-30370259 CCCCTCGGGCCTCCCGGCGAGGC 0: 1
1: 0
2: 0
3: 11
4: 120
Right 1136454015 16:30370252-30370274 GGCGAGGCCAGCCGAGAAAGGGG 0: 1
1: 0
2: 0
3: 37
4: 1170
1136454001_1136454015 7 Left 1136454001 16:30370222-30370244 CCGCAGAAGGCGCCGCCCCTCGG 0: 1
1: 0
2: 0
3: 3
4: 106
Right 1136454015 16:30370252-30370274 GGCGAGGCCAGCCGAGAAAGGGG 0: 1
1: 0
2: 0
3: 37
4: 1170
1136453996_1136454015 21 Left 1136453996 16:30370208-30370230 CCCCGCCGGGGAGGCCGCAGAAG 0: 1
1: 0
2: 0
3: 10
4: 129
Right 1136454015 16:30370252-30370274 GGCGAGGCCAGCCGAGAAAGGGG 0: 1
1: 0
2: 0
3: 37
4: 1170
1136454000_1136454015 16 Left 1136454000 16:30370213-30370235 CCGGGGAGGCCGCAGAAGGCGCC 0: 1
1: 0
2: 0
3: 16
4: 224
Right 1136454015 16:30370252-30370274 GGCGAGGCCAGCCGAGAAAGGGG 0: 1
1: 0
2: 0
3: 37
4: 1170
1136454008_1136454015 -9 Left 1136454008 16:30370238-30370260 CCCTCGGGCCTCCCGGCGAGGCC 0: 1
1: 0
2: 0
3: 14
4: 117
Right 1136454015 16:30370252-30370274 GGCGAGGCCAGCCGAGAAAGGGG 0: 1
1: 0
2: 0
3: 37
4: 1170
1136453997_1136454015 20 Left 1136453997 16:30370209-30370231 CCCGCCGGGGAGGCCGCAGAAGG 0: 1
1: 1
2: 3
3: 34
4: 210
Right 1136454015 16:30370252-30370274 GGCGAGGCCAGCCGAGAAAGGGG 0: 1
1: 0
2: 0
3: 37
4: 1170
1136453999_1136454015 19 Left 1136453999 16:30370210-30370232 CCGCCGGGGAGGCCGCAGAAGGC 0: 1
1: 1
2: 3
3: 15
4: 202
Right 1136454015 16:30370252-30370274 GGCGAGGCCAGCCGAGAAAGGGG 0: 1
1: 0
2: 0
3: 37
4: 1170
1136454009_1136454015 -10 Left 1136454009 16:30370239-30370261 CCTCGGGCCTCCCGGCGAGGCCA 0: 1
1: 0
2: 1
3: 11
4: 150
Right 1136454015 16:30370252-30370274 GGCGAGGCCAGCCGAGAAAGGGG 0: 1
1: 0
2: 0
3: 37
4: 1170
1136453994_1136454015 23 Left 1136453994 16:30370206-30370228 CCCCCCGCCGGGGAGGCCGCAGA 0: 1
1: 0
2: 2
3: 13
4: 161
Right 1136454015 16:30370252-30370274 GGCGAGGCCAGCCGAGAAAGGGG 0: 1
1: 0
2: 0
3: 37
4: 1170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136454015 Original CRISPR GGCGAGGCCAGCCGAGAAAG GGG Exonic