ID: 1136455433

View in Genome Browser
Species Human (GRCh38)
Location 16:30377531-30377553
Sequence TGAAGGAAGTAGAGTGACCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 270
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 245}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136455433 Original CRISPR TGAAGGAAGTAGAGTGACCT GGG Intronic
903666044 1:25008357-25008379 TGCAGAAAGCTGAGTGACCTTGG - Intergenic
903820205 1:26096066-26096088 TAAAGGAAATAGAGTGAAATGGG - Intergenic
904158512 1:28504780-28504802 GGAAGGAAGTGGTGTGATCTCGG - Intergenic
904500881 1:30912233-30912255 TGAATGAATTAGAGTCACCGAGG + Intergenic
904751982 1:32746599-32746621 TAAATGAAGCTGAGTGACCTCGG - Intronic
905225615 1:36477080-36477102 TTGAGGAAGTACAGGGACCTTGG - Intronic
910513273 1:88030094-88030116 TGGAGGGAGTAGAGTGAATTTGG + Intergenic
914198394 1:145462873-145462895 TGAAGGTGATAGTGTGACCTCGG - Intergenic
914477499 1:148036001-148036023 TGAAGGTGATAGTGTGACCTCGG - Intergenic
915531274 1:156503526-156503548 GGAAGGAAGGTGAGTCACCTGGG + Intergenic
916997678 1:170318256-170318278 TCAAGGAAATAGAGTGAAGTAGG - Intergenic
919820226 1:201468013-201468035 GGAAGGAAGTAGAGGGAGGTTGG - Intronic
920030133 1:203032480-203032502 TGGAGTAAGTAGTGTGATCTTGG + Intronic
921429089 1:215042416-215042438 TGGAGGAAGTAGAGTGTCATAGG + Intronic
923581800 1:235224285-235224307 TGAAGGAAGAAGAATAACTTAGG - Intronic
1062873198 10:924601-924623 TGAAGGAACTAGTGTGAACAAGG - Intronic
1063209595 10:3867622-3867644 TGACTGAAGTAGAGTCACATTGG + Intergenic
1063364157 10:5479818-5479840 AGAAGGAAGCCGAGTGGCCTGGG + Intergenic
1064808706 10:19167761-19167783 TGAAGTTAGAAGAGTAACCTGGG - Intronic
1066435322 10:35392350-35392372 TGAAGGATGTAGAGTGACCCAGG + Intronic
1067997405 10:51289575-51289597 TGTAGGCAGCAGAGTCACCTAGG + Intronic
1068250743 10:54436294-54436316 TGAAGAAAGTAAAGTTACCCTGG + Intronic
1068586282 10:58802876-58802898 TGAAGGAAGTATATTGTCCAAGG - Intronic
1068722575 10:60262536-60262558 TTAAGGAAGTAAAATGACCTTGG - Intronic
1070403890 10:76077558-76077580 GGAAGGAAGTAGAGTTTCCAAGG + Intronic
1071841686 10:89478096-89478118 TAAAGGAAGTGGAGTGCCTTGGG + Intronic
1073428523 10:103471177-103471199 TGGAGGAAGGAGGGAGACCTTGG - Intergenic
1077030748 11:465537-465559 AGGAGAAAGTATAGTGACCTTGG + Intronic
1078262101 11:9719322-9719344 TGGAGGCAGTGGAGTGATCTTGG - Intronic
1080727010 11:34908496-34908518 TGAAGGTAGAAGAGAGAGCTGGG - Intronic
1081794087 11:45807862-45807884 GGAATGAAGTAGAGAGCCCTGGG - Intronic
1082792564 11:57356845-57356867 TGATGCAATTAGAGTGATCTTGG + Intronic
1083043938 11:59715190-59715212 GAAAGGAAAGAGAGTGACCTAGG - Intronic
1084772467 11:71352697-71352719 TGAAGGAAATAAAGTGTTCTGGG - Intergenic
1087171948 11:95058170-95058192 TGAAGAAAGTATAGTGAATTTGG - Intergenic
1087230017 11:95650598-95650620 TGAAGTAAATATAATGACCTGGG + Intergenic
1087392539 11:97556302-97556324 GGAAGGAATTAGGGTAACCTGGG + Intergenic
1087507810 11:99049414-99049436 TGAAGGAATTAGGGTAACCATGG - Intronic
1091549907 12:1529829-1529851 CCAAGGAAGTAGAGTGACCCGGG - Intergenic
1091935737 12:4433250-4433272 TGAAGGAAGTAGAGAGGCTTTGG - Intronic
1093212139 12:16320627-16320649 TGAAGGAACAAGAATGAGCTTGG - Intergenic
1093326166 12:17777517-17777539 TAAAGGAAGAAGATTGACCTAGG - Intergenic
1094456140 12:30635708-30635730 TGAAGCAGGTAGATTGAACTAGG + Intronic
1095282729 12:40374848-40374870 TGAAGAAGGCAGAGTGAGCTTGG + Intergenic
1099673491 12:85726376-85726398 TGTAAGAAATAGAGGGACCTGGG - Intergenic
1100094200 12:91011271-91011293 TGACTGAAGTAGAGTGACTGAGG - Intergenic
1100348865 12:93759590-93759612 CAAAGGAAGAAGAGTGAGCTGGG - Intronic
1101105154 12:101433352-101433374 GGAATGAAGTAGTGTGATCTTGG + Intergenic
1103898680 12:124291852-124291874 GGAAGAAAGAAAAGTGACCTGGG - Intronic
1109260822 13:60143516-60143538 TGAAGGAAGCAGAATAACATTGG - Intronic
1112429636 13:99339332-99339354 GGAAGGAAATAAAGTGACATGGG - Intronic
1113353401 13:109552703-109552725 TGAAGGAAGTATATTGAAATTGG + Intergenic
1113976288 13:114230187-114230209 AGAAGGAAGAACAGTGAGCTGGG - Intergenic
1118102478 14:62622549-62622571 TCTAGGAAGTAAGGTGACCTTGG + Intergenic
1118443183 14:65830006-65830028 TGAAGAACATACAGTGACCTGGG + Intergenic
1120300438 14:82699587-82699609 AGAAGGATGTAGAAGGACCTAGG + Intergenic
1121102416 14:91259091-91259113 TGACGGAAGTAGCATGACCCAGG + Intergenic
1121865443 14:97358588-97358610 TGAAGGAGAAAGAGTTACCTAGG - Intergenic
1127083958 15:55407898-55407920 TGAAGGAAGAAGGGTGGCCCAGG + Intronic
1129090185 15:73141680-73141702 TCAAAGAAGTAGAGTGACATAGG - Intronic
1131626279 15:94123986-94124008 TGAGGGAAGGAGAGGAACCTGGG + Intergenic
1131854316 15:96577117-96577139 GGAAGGAAGCAGAGTGACCGTGG + Intergenic
1132084110 15:98892474-98892496 GGAATGAAGTAGTGTGATCTTGG - Intronic
1133053174 16:3130272-3130294 TGAAGAAAGTAAAGTGAACCTGG - Intronic
1133851031 16:9503831-9503853 AGAAGGAAGTGGAGTGACAAGGG - Intergenic
1134193591 16:12141267-12141289 TGCAGGAAGTAGGCTGATCTTGG + Intronic
1135428945 16:22365532-22365554 GAAGAGAAGTAGAGTGACCTGGG - Intronic
1136455433 16:30377531-30377553 TGAAGGAAGTAGAGTGACCTGGG + Intronic
1137268568 16:46887514-46887536 TGTAGGGAGTAGGGTGACTTGGG + Intronic
1138039786 16:53650746-53650768 AGAAGGAAGGAGGGTGACTTAGG - Intronic
1138046249 16:53728701-53728723 TGAAGGAAGGAGAGGGCCCTGGG + Intronic
1140166919 16:72562380-72562402 GGAAGGCAGTAGTGTGATCTCGG + Intergenic
1140423565 16:74841565-74841587 GGAGTGCAGTAGAGTGACCTTGG - Intergenic
1140880870 16:79197052-79197074 AGTAGGAAGTATAGTTACCTTGG + Intronic
1141090331 16:81125874-81125896 TGAAGGTGGTGGAGGGACCTGGG + Intergenic
1203141125 16_KI270728v1_random:1767379-1767401 TGAAGAAAGTAGAGGGGCCAGGG - Intergenic
1143872655 17:9968427-9968449 TGATGGACTTAGAGTGAGCTGGG - Intronic
1145767437 17:27468599-27468621 TCTAGGAAGCAGAGTGACCCAGG + Intronic
1145780738 17:27561187-27561209 AGAAGGAAGTACAAGGACCTGGG - Intronic
1146233411 17:31133705-31133727 TGAATGCAGTAGTGTGATCTGGG + Intronic
1146404514 17:32525756-32525778 AGAAGAAAGTAGAGAGAACTGGG + Intronic
1149206107 17:54250453-54250475 TGAAGTCAGAAGAGAGACCTGGG + Intergenic
1149297708 17:55275499-55275521 TAAAGGCAATATAGTGACCTTGG + Intronic
1149625887 17:58080601-58080623 TGAAGGAAGCAAAGAGCCCTGGG + Intergenic
1151339243 17:73459165-73459187 TGGAGGAACCAGAGGGACCTTGG - Intronic
1151829195 17:76539791-76539813 TGACTGCAGTAGAGTGACCCAGG - Intronic
1152095067 17:78267944-78267966 AGGAGGAAGCAGCGTGACCTTGG + Intergenic
1153433974 18:5048981-5049003 TCCAGGAAGGAGTGTGACCTTGG - Intergenic
1155328132 18:24686592-24686614 TGAAGGTGGTAGAAAGACCTTGG - Intergenic
1156539976 18:37899938-37899960 TCAATGAAGTAGTGTGACCTGGG + Intergenic
1158279684 18:55810402-55810424 TATAGCAAGTAGAGTGAACTGGG - Intergenic
1158805596 18:60968265-60968287 TGAAGGAAGTACAATGACACTGG + Intergenic
1158957174 18:62551255-62551277 TGAAGGAAATCAAGTGAGCTGGG + Intronic
1161676833 19:5655609-5655631 TTAAGGAAGGAGAGGGACCTTGG + Intronic
1161800925 19:6416410-6416432 AGAAGGAAGGAGAGTAACCAAGG + Intronic
1163938961 19:20475699-20475721 TTAAGGATGTAGAGACACCTTGG + Intergenic
1164088467 19:21926190-21926212 TGAATGACATAGGGTGACCTGGG - Intergenic
1165461857 19:35948602-35948624 GGAAGGGAAGAGAGTGACCTTGG + Intergenic
1167997599 19:53418852-53418874 GGAGTGAAGTAGAGTGATCTCGG - Intronic
925845688 2:8031366-8031388 TGAAGGAAATACAGAGAGCTGGG + Intergenic
926264528 2:11302959-11302981 TGATGGAAGTAGAAAGACCAAGG - Intronic
926770510 2:16369126-16369148 TGAAGGAAGTGCAGTGCCTTTGG + Intergenic
927730949 2:25471224-25471246 TGAAGGACCTGGAGTGACATGGG + Intronic
929227552 2:39526154-39526176 TGAAGGAAGGTGAGTGACCCTGG - Intergenic
929911300 2:46091462-46091484 TGAGGGGAGTAGAGGGGCCTGGG + Intronic
930596235 2:53391514-53391536 TGAAGGAATCAGAGAGACCGAGG - Intergenic
931273796 2:60726344-60726366 GGAGTGAAGTGGAGTGACCTTGG + Intergenic
932300190 2:70661543-70661565 AGAAGGAAGGAAACTGACCTAGG - Exonic
933713614 2:85344846-85344868 TGAAGGAAGCAGAGTGGCCAGGG - Intronic
935930530 2:108119619-108119641 TGTAGGAAGCACAGTGACCGTGG - Intergenic
938032497 2:128007395-128007417 TGAAGGAACTTGAGCGTCCTTGG + Intronic
939282147 2:140077826-140077848 TGAAGGAATAATAGTGCCCTGGG + Intergenic
939566294 2:143789991-143790013 TGAAGGATGTACAATGGCCTGGG + Intergenic
941577606 2:167253505-167253527 TGAAGCAAATACAGTGTCCTTGG + Intronic
941872445 2:170399982-170400004 TGAAGCAAGCAGAATGACGTGGG - Intronic
942974521 2:181999472-181999494 AGTAGGAAGTACATTGACCTTGG - Intronic
943289532 2:186051038-186051060 TGAAGTAAATGAAGTGACCTCGG + Intergenic
943689509 2:190854976-190854998 TGAAAGAGGTTGAGTGGCCTTGG + Intergenic
943820070 2:192311146-192311168 AGAAGGAAATAGAGTGATATTGG - Intergenic
944056925 2:195531981-195532003 GGCAGGAATTAGAGTGACGTGGG - Intergenic
944330055 2:198454786-198454808 TGAGGAAAGTATAGTGACCAAGG - Intronic
946921778 2:224587428-224587450 TAAAGGAAGTAGTATAACCTTGG - Intergenic
947601776 2:231455530-231455552 TGATGGAAATAAAGTTACCTTGG - Exonic
1169805668 20:9556907-9556929 AGAAGGAAGAAGAGTGAGGTTGG + Intronic
1171018986 20:21568020-21568042 TGAAGGAGGTAGAGGGACCATGG - Intergenic
1171285087 20:23930341-23930363 GAAAGGGAGGAGAGTGACCTGGG + Intergenic
1172631949 20:36384528-36384550 TTAGAGAAGTTGAGTGACCTGGG + Intronic
1175816301 20:61884808-61884830 TGGAGGAAGGAGAGAGCCCTGGG + Intronic
1177727879 21:24992153-24992175 TCAAGGAAGTTGAGTTTCCTGGG - Intergenic
1178622981 21:34192660-34192682 TCAAAGAAGCAGAGTCACCTGGG + Intergenic
1180594945 22:16966999-16967021 TGAAGCTATCAGAGTGACCTTGG + Intronic
1182043040 22:27253320-27253342 AGGAGGAAGGAGAGTGGCCTAGG - Intergenic
1183622574 22:38983001-38983023 TAAAAGATGAAGAGTGACCTTGG - Intronic
1183629032 22:39022066-39022088 TAAAAGATGAAGAGTGACCTTGG - Intronic
1185322995 22:50210438-50210460 TGTAGGAAGTAGAGAGTCCAGGG + Intronic
1185377947 22:50490870-50490892 TGAAGAAAGTAGATTGTCCCAGG + Intergenic
949317254 3:2770440-2770462 TGAAGGAAGCTGAGGGCCCTTGG - Intronic
949498819 3:4658534-4658556 GGAAGGGAGTAGAGGGAACTAGG - Intronic
951527181 3:23664712-23664734 TGGTGGAAGGAGACTGACCTGGG - Intergenic
951937791 3:28041002-28041024 GGAATGCAGTGGAGTGACCTTGG - Intergenic
952753360 3:36843716-36843738 TGAAGGAATCAGAGACACCTAGG + Intronic
953061318 3:39430482-39430504 GGAAGGAAGGAAAGTGACCTGGG + Intergenic
953089384 3:39708488-39708510 TCAAGGAAGTTGAGCAACCTAGG + Intergenic
953885784 3:46713666-46713688 TGAAGGAAGTAGACAGTTCTAGG + Intronic
955764760 3:62330555-62330577 TGAATGAAGTTTAGTTACCTTGG + Intronic
955938630 3:64127342-64127364 TGCAGGAGGGAGAGTGACCGTGG - Intronic
956303833 3:67802904-67802926 TGAATGAAGTGGCGTGATCTTGG + Intergenic
956353993 3:68370235-68370257 GGAATGAAGTGGCGTGACCTTGG - Intronic
956971287 3:74529870-74529892 TCATGGAAGGAGAGTGATCTTGG + Intergenic
956971299 3:74530033-74530055 TCATGGAAGGAGAGTGATCTTGG + Intergenic
958968320 3:100583759-100583781 TGAATGACTTACAGTGACCTGGG - Intergenic
959678878 3:109069614-109069636 TGAAGAAAGATGAGTTACCTGGG + Exonic
959961042 3:112298347-112298369 AAAAGGAAATAGAGTGACGTTGG - Intergenic
961056213 3:123790836-123790858 TGGAGGCAGTGGAGGGACCTAGG - Intronic
961508112 3:127384974-127384996 TGAATGAAGTCGAGTGTCTTAGG - Intergenic
962149692 3:132879793-132879815 AGCAGGAAGCAGAGTGACATAGG - Intergenic
962959063 3:140293240-140293262 TGAGGGATGTAGAGTGACAGAGG + Intronic
963264775 3:143229064-143229086 TGAAGGAAGAAGTGTGGCTTTGG + Intergenic
964264055 3:154874227-154874249 AGAAAGAAGGAAAGTGACCTAGG + Intergenic
965033622 3:163405888-163405910 TGGAGGACGTACAATGACCTAGG + Intergenic
965625469 3:170680001-170680023 TGAGGGAAGCTGAGTGACTTTGG - Intronic
965728064 3:171740881-171740903 TGACACAAGTTGAGTGACCTTGG - Intronic
966028423 3:175315125-175315147 TGATGGGAGTTGACTGACCTTGG + Intronic
966069779 3:175861602-175861624 TGAAGTAAGAAGAGTGGCTTTGG + Intergenic
968524176 4:1047523-1047545 TGGAGGGAGTAGAGAGCCCTGGG - Intergenic
969231378 4:5834075-5834097 AGAAGGAAGTAGACTGAGCTGGG - Intronic
969436121 4:7190590-7190612 TGAAGGAAGGAGAGGGAGGTAGG - Intergenic
970575149 4:17419852-17419874 TGAAGGCAGAAGAGTGAGGTGGG - Intergenic
970840767 4:20465778-20465800 TCATGGAAGTAGAGTGGGCTGGG - Intronic
972391844 4:38621427-38621449 TGAGGAAAGTAGACTGACCTGGG - Intergenic
974225816 4:59042227-59042249 TCAAGAAAATAGAGTCACCTTGG - Intergenic
974522235 4:62996588-62996610 TTGAGGAAGGAGAATGACCTTGG - Intergenic
975383168 4:73726248-73726270 AGAAGGAAGTTGAGTGTCCTTGG + Intergenic
975452563 4:74546385-74546407 TAAACAAAGTAGAGTGACATGGG - Intergenic
977103607 4:92850785-92850807 TGAAGGAAGTAAATTGCTCTTGG - Intronic
979161664 4:117469140-117469162 TGGAGCAGGTAGAGTGAGCTAGG + Intergenic
979287165 4:118939382-118939404 TGAAGGATGAAGAGGGAACTTGG + Intronic
981756425 4:148145464-148145486 GAAAGGAAGTAAAGTAACCTTGG - Intronic
985365866 4:189232034-189232056 GGAAATAAGCAGAGTGACCTTGG + Intergenic
985531808 5:438317-438339 TAAAGGAAATAAAGTGACTTTGG - Intergenic
985761492 5:1751481-1751503 TGGAGGAAGGAGAGGGACCGGGG - Intergenic
986337027 5:6762939-6762961 AGAAGGAAGTACTGAGACCTGGG + Intergenic
989098447 5:37802621-37802643 AGAAGGGAGTAGTGTGGCCTTGG - Intergenic
992221016 5:74573437-74573459 TGAAAGAAGTAGTGTGAGCTCGG + Intergenic
994898076 5:105731133-105731155 TAAAGGAAGTAGAATCACTTAGG + Intergenic
996188545 5:120510620-120510642 TGAAGGAAATAGAATGCACTGGG + Intronic
996402894 5:123082692-123082714 TGGAGGAAGAAAAGTCACCTGGG + Intergenic
997305464 5:132832544-132832566 GGAATGAAGTAGCGTGATCTCGG - Intergenic
997660293 5:135583946-135583968 TGAAGGAAGTTGAAGGACCAAGG + Intergenic
997865893 5:137462425-137462447 TGCAGGAATTAGTCTGACCTTGG - Intronic
998280262 5:140800000-140800022 TGAAGGGAGAAAAGTAACCTAGG - Intronic
999178119 5:149646543-149646565 TGAAGGAAGGAGAGAGAGTTGGG + Intergenic
1000004568 5:157171045-157171067 TGATGAAAGTAGAGTGAATTAGG + Intronic
1000998341 5:167981218-167981240 TGAATGAAGCAGACTGCCCTGGG - Intronic
1003236025 6:4295749-4295771 TAAATGTAGTAGAGTGAACTTGG + Intergenic
1004581876 6:16962310-16962332 TGAAAGAAGTAGACTGGGCTAGG - Intergenic
1004839904 6:19570928-19570950 TGAGGGAAATTGAGTTACCTTGG - Intergenic
1006406548 6:33848910-33848932 TGAAGAATGAAGAGTGACCCCGG - Intergenic
1007305006 6:40897073-40897095 TGAAGCCAGGAGAGAGACCTGGG - Intergenic
1014601352 6:123417152-123417174 TGCAGGACTGAGAGTGACCTTGG - Intronic
1015851739 6:137581141-137581163 TGAAGCAAGAAGGCTGACCTAGG - Intergenic
1016428469 6:143958489-143958511 TGGAGGAAGTGGAGTGAGCTTGG - Intronic
1017306358 6:152922778-152922800 TGAATGGGGAAGAGTGACCTTGG + Intergenic
1017619058 6:156276130-156276152 TGAAGGAAGAACAGTGAGGTGGG + Intergenic
1017809064 6:157971025-157971047 TGAAGGAGGTAGAGGGAAATAGG + Intergenic
1018889431 6:167972663-167972685 TGAAGGAAGGAGTGTGTCTTAGG + Intergenic
1019020686 6:168915113-168915135 TGATGGAAGTTGTGAGACCTTGG + Intergenic
1019630334 7:2045719-2045741 TGAAGGAAGGAGAGTGGGGTGGG + Intronic
1020051229 7:5083060-5083082 TGGAGGAAGTAGAGGGACCGGGG - Intergenic
1020306203 7:6837004-6837026 TGGAGGCAGTGGTGTGACCTCGG - Intergenic
1020383275 7:7568729-7568751 GGACGGAAGTTGAGAGACCTTGG + Intronic
1020673815 7:11154901-11154923 TCAAGAAATTAGAGTGACATAGG + Intronic
1022009630 7:26297615-26297637 AGAAGGAAGGAGGATGACCTGGG - Intronic
1022071310 7:26917770-26917792 TGAAAGAATTAGAGGAACCTTGG + Intronic
1023453013 7:40308290-40308312 TGTAGAGAGTACAGTGACCTGGG + Intronic
1026255909 7:68710903-68710925 GGAATGTAGTAGCGTGACCTTGG - Intergenic
1027338519 7:77180645-77180667 GGAATGCAGTAGAGTGATCTCGG - Intronic
1027795460 7:82687589-82687611 TGTAGGAAGTTGAGAGGCCTGGG + Intergenic
1028219501 7:88180082-88180104 AGAAGGAATTAGTGAGACCTGGG + Intronic
1029428117 7:100510102-100510124 AGAGGGCAGTAGAGTGATCTCGG - Intergenic
1030053078 7:105556360-105556382 TGTAAGAAGTTGAGTGAGCTGGG - Intronic
1030210322 7:106989556-106989578 TGAAGGAATCAGAGAGACCGAGG + Intergenic
1031101600 7:117487104-117487126 TGAGAGAAGTAGAGTCACATAGG - Intronic
1031923031 7:127615138-127615160 AGAAGGAAGGAGAGTGTCCCTGG + Intronic
1033490501 7:141838633-141838655 TGGAGGAAGAAGAGTGAGATTGG + Intronic
1033555391 7:142484406-142484428 AGAAGGAAGTTGAGTGACCAAGG - Intergenic
1034944294 7:155251954-155251976 TGACAGAGGTAGTGTGACCTAGG + Intergenic
1035943800 8:3935707-3935729 TGAAGGAGGTAGAGAGATGTGGG - Intronic
1036675932 8:10833281-10833303 TGAAGGAAGTAGGATGACGGAGG + Intronic
1037125251 8:15340530-15340552 GGAAGGAAGAAGAGGGACATGGG - Intergenic
1041347184 8:56911604-56911626 AGAAGGAAGTAAGGTAACCTGGG + Intergenic
1044730066 8:95222470-95222492 TGAAGGAAGCAGAGTGAATCAGG + Intergenic
1045082815 8:98647104-98647126 AGAAGGGAGCAGAGTGATCTAGG - Intronic
1045915698 8:107467585-107467607 TAAAAGAAGTAGAATGTCCTTGG + Intronic
1046434565 8:114170259-114170281 TGAAGAAATTAGAGTGATTTAGG + Intergenic
1047209634 8:122831003-122831025 TTAAGGATGTAGAGTCGCCTTGG + Intronic
1047240842 8:123086546-123086568 TGGAGGAGGAAGAGTGACCGGGG - Intronic
1047281543 8:123450390-123450412 GGAAGGAAGTAGAGTGGTTTGGG + Intronic
1047518567 8:125576585-125576607 TGGAGTAAGCAGTGTGACCTTGG + Intergenic
1051099263 9:13502501-13502523 TGAAGGAAGGAGACTGTCCAGGG + Intergenic
1051980546 9:23010063-23010085 TGAAGAAAATGGAGAGACCTAGG - Intergenic
1053393246 9:37751298-37751320 TGGAGGAAGAAGAGTGCCCAGGG + Intronic
1056171437 9:83988905-83988927 TGAATGCAGTGGTGTGACCTTGG + Intronic
1056906657 9:90656617-90656639 TTAAGGAAGTAGACTGTCCAAGG + Intergenic
1058955231 9:109940716-109940738 GGGAGGAAGTTGAGTGTCCTGGG + Intronic
1059836313 9:118157987-118158009 TGAAAGAAGTAGGATTACCTGGG - Intergenic
1060020843 9:120129860-120129882 TGAAGGAAGTAGATGGACCCAGG + Intergenic
1060533095 9:124360356-124360378 TGGAAGATGCAGAGTGACCTAGG + Intronic
1060850211 9:126868876-126868898 TAAAGCAAGTAGAGTGAGCCAGG + Intronic
1061712061 9:132494975-132494997 TGTGGGAAGCAGAGTGCCCTTGG - Intronic
1061816553 9:133200756-133200778 GGAAGAAAGTGAAGTGACCTGGG + Intergenic
1062199533 9:135294554-135294576 TGAAGGAAGTAGTGGGACCAGGG - Intergenic
1185620635 X:1451007-1451029 TGGAGAAAGCAGAGTGACCCGGG - Intronic
1188266975 X:28088838-28088860 TCTAGGAACTAGAGTAACCTAGG - Intergenic
1188580454 X:31705515-31705537 TGGAAGAAGCACAGTGACCTAGG - Intronic
1190263404 X:48813862-48813884 AGCAGGAAGTGGAGAGACCTGGG - Intronic
1190858326 X:54318825-54318847 TGGAGTGAGTAGTGTGACCTCGG + Intronic
1191996998 X:67106213-67106235 GGAATGCAGTAGTGTGACCTTGG - Intergenic
1192263770 X:69524873-69524895 TGGAGGAAGAAGAGTGATGTGGG - Intronic
1194402311 X:93453665-93453687 TGAAGGAAATAGAGAAACTTAGG + Intergenic
1195893721 X:109724323-109724345 GGAATGCAGTGGAGTGACCTTGG + Intronic
1196146404 X:112322253-112322275 TGGTGGAAGAAGAATGACCTTGG - Intergenic
1196885356 X:120239575-120239597 GCAAGGAAGTAAAGTGACATTGG + Intergenic
1199989886 X:152981069-152981091 TGAGGGAAGAATAGTCACCTGGG + Intergenic
1199997401 X:153034187-153034209 CAAAGGAAGGAGAGTGGCCTAGG - Intergenic
1200322815 X:155207331-155207353 TGAAGGAGGTATATTCACCTAGG + Intronic
1200376449 X:155785700-155785722 TGAAAGAAGTAGAGTTTCCAGGG - Intergenic
1201130215 Y:10946692-10946714 TGAATGGAGTAGAGTGGACTAGG - Intergenic
1201278595 Y:12321417-12321439 TTAAGGAATCAGAGAGACCTAGG - Intergenic
1201358653 Y:13122275-13122297 TTAAGGAATCAGAGAGACCTAGG - Intergenic