ID: 1136458381

View in Genome Browser
Species Human (GRCh38)
Location 16:30395257-30395279
Sequence GGCCGGCGGCCCGAACTCGG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 86
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 79}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136458381_1136458387 -2 Left 1136458381 16:30395257-30395279 CCACCGAGTTCGGGCCGCCGGCC 0: 1
1: 0
2: 0
3: 6
4: 79
Right 1136458387 16:30395278-30395300 CCTCGGCTTAGAGTAGCCCCTGG 0: 1
1: 0
2: 0
3: 5
4: 58
1136458381_1136458388 -1 Left 1136458381 16:30395257-30395279 CCACCGAGTTCGGGCCGCCGGCC 0: 1
1: 0
2: 0
3: 6
4: 79
Right 1136458388 16:30395279-30395301 CTCGGCTTAGAGTAGCCCCTGGG 0: 1
1: 0
2: 0
3: 2
4: 59
1136458381_1136458392 20 Left 1136458381 16:30395257-30395279 CCACCGAGTTCGGGCCGCCGGCC 0: 1
1: 0
2: 0
3: 6
4: 79
Right 1136458392 16:30395300-30395322 GGCCGCACGCTGCCGCCCGCCGG 0: 1
1: 0
2: 1
3: 21
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136458381 Original CRISPR GGCCGGCGGCCCGAACTCGG TGG (reversed) Exonic
905173929 1:36124940-36124962 GGCCGGCGCCTCGGACTCCGGGG - Intronic
907464688 1:54627284-54627306 GGCCGGCGAGCCGAGCTCTGAGG + Intronic
913109115 1:115642059-115642081 CGCCGGCCGCCCGAGCTCCGCGG - Exonic
922169528 1:223143146-223143168 GGCCGGGGGCCCTAAGTCGTAGG - Intronic
923171445 1:231421477-231421499 CGCCGGCGGCCAGGGCTCGGCGG - Exonic
1063418233 10:5890290-5890312 GGCCGGCGGCGCGGGCCCGGCGG + Intronic
1066672807 10:37857923-37857945 GGGCGGCGGCTAGACCTCGGCGG - Intronic
1071309480 10:84328896-84328918 GGGCGGAGGCCCGAACTCCCGGG + Intronic
1072729010 10:97832216-97832238 GGCCGGCAGCCCAGACTGGGAGG + Intergenic
1073287902 10:102399456-102399478 GGCCTGCGGCTCGCACTGGGGGG - Exonic
1078266712 11:9760322-9760344 GGCCGGAGGCCCAACCTCTGAGG + Intergenic
1084681753 11:70670452-70670474 GGCTGGCTGCCCGCACCCGGCGG - Intronic
1085205795 11:74731291-74731313 GGCCGGCGCCCCCTGCTCGGTGG + Intronic
1096627612 12:52905000-52905022 GGCAGGCGGGCCGAACCAGGCGG + Exonic
1097261054 12:57720533-57720555 GGCTGGGGGCCAGGACTCGGGGG - Intronic
1097676109 12:62603588-62603610 GGGCGGCGGGCCGACGTCGGCGG + Exonic
1100315570 12:93441749-93441771 GGCCCGCGGCCCGCTCTGGGAGG - Intronic
1100581418 12:95943347-95943369 TGCCGGTGGCCCGAGCCCGGTGG + Exonic
1101150223 12:101877212-101877234 CGCCGGCGGCGGGACCTCGGAGG + Intergenic
1102678062 12:114672020-114672042 GGCCGCCAGCCCGGCCTCGGTGG - Exonic
1106157509 13:27171830-27171852 GGCCGGCGGCCGGCAGGCGGGGG - Exonic
1108541993 13:51453378-51453400 GGCCGGCGGCCCTGACGCGCAGG - Intronic
1112573957 13:100619009-100619031 GGCCGGCCGCCCCATCTGGGAGG - Intronic
1116495122 14:45551387-45551409 GCCCGGCAGCTCGAACTGGGTGG - Intergenic
1117156821 14:52950636-52950658 GGCCGGCGCTGCGAATTCGGTGG - Intronic
1122138901 14:99650447-99650469 GGCCGGCGGCTCTAACAGGGAGG + Intronic
1122620942 14:103057418-103057440 GGCGGGCCGCCCGAGCTGGGAGG - Exonic
1136458381 16:30395257-30395279 GGCCGGCGGCCCGAACTCGGTGG - Exonic
1140221482 16:73047715-73047737 GGCCGGCTGCGCGGACCCGGAGG + Intronic
1142420078 16:89964584-89964606 GGCCTGGGCCCCGCACTCGGGGG + Intronic
1142859040 17:2749755-2749777 GGCCGGCGGCGCGCGGTCGGGGG + Intergenic
1144923097 17:18781095-18781117 GGCGAGCGGCCCGGACACGGCGG - Exonic
1148323681 17:46771637-46771659 GCCCGGCGGCCCGGGCCCGGCGG - Intronic
1149490970 17:57085137-57085159 GGCCGGCGGCGCGCACGCGCAGG + Intronic
1153605364 18:6827382-6827404 GGCCAGCCGCCCCATCTCGGAGG - Intronic
1157464207 18:47930538-47930560 GGCCGGCGGCCCGGGCGCGCGGG + Exonic
1161108769 19:2456905-2456927 CGACGGCGGCCCGGGCTCGGCGG + Exonic
1161308098 19:3578298-3578320 GGCCGGCGGGACCCACTCGGGGG + Intronic
1162470984 19:10871882-10871904 GCGCGCCGGCCCGGACTCGGCGG + Exonic
1166310401 19:41959179-41959201 GGCCGGGGGCCCGGACTCCCGGG + Intronic
1166986062 19:46660657-46660679 GGCCCGCCGCCGGAACTCCGGGG + Intronic
1167129053 19:47572719-47572741 GGCCCGCGGCGCGAGCTGGGGGG + Intergenic
1167428741 19:49442697-49442719 GGACGGAGGCCAGAACTCGGTGG - Intergenic
1167428820 19:49442933-49442955 GGGCGGAGGCCAGAGCTCGGTGG - Intergenic
1167793072 19:51692585-51692607 GGCCGGGGGCCCGGACTCCTGGG + Intergenic
936389015 2:112055218-112055240 GGCTGGCAGCCCGAGCGCGGAGG - Exonic
949004304 2:241636855-241636877 CGCGGCCGGCCCGAACGCGGGGG - Intronic
1173849765 20:46210399-46210421 GGAGGGCGGCCGGAACTCGGGGG + Exonic
1174804767 20:53594734-53594756 GGCCCGCGGCCCGAACCCCTGGG + Intronic
1175775604 20:61651611-61651633 GGCAGGCGGCCCCACCTCGCAGG + Intronic
1176733273 21:10521166-10521188 GGCCCGCGGCCCGAACCCCTGGG - Intergenic
1183411790 22:37659169-37659191 GGCCGGGGACCCGAGCGCGGGGG + Exonic
1183535741 22:38399279-38399301 GGCCCGCGGCCCGAACTCCTGGG + Intergenic
1185375669 22:50481731-50481753 GCCCGGCGCCCCGACCGCGGAGG + Exonic
950541141 3:13614010-13614032 GGCCCTCGGCCCGCACGCGGAGG - Exonic
956946665 3:74231254-74231276 GGCTGGAGGCACGATCTCGGTGG + Intergenic
957203437 3:77164996-77165018 GCCCGGCGGCCCTTACTGGGAGG + Intronic
958650432 3:96930634-96930656 GGCCGGAGACCCGAACTGGGAGG + Intronic
959076373 3:101753553-101753575 AGCCGGAAGCCCGAACTGGGTGG - Intronic
961654127 3:128432387-128432409 GACCAGCGGCCGGAACTGGGAGG + Intergenic
964228911 3:154439217-154439239 GCCCGGAAGCTCGAACTCGGTGG - Intergenic
969426541 4:7127775-7127797 GACCTGCGGCCCGAACGCGGGGG + Intergenic
985528736 5:421392-421414 GGAGGGCGGCCCGGACTCAGAGG + Intronic
988532576 5:32039898-32039920 GCCCGGCGGCCCCATCTGGGAGG + Intronic
992939955 5:81751550-81751572 GGCGGGCGCCCCGAAGTCTGGGG - Intronic
1002897929 6:1389952-1389974 CGGCGGCGGCCCGCCCTCGGTGG - Exonic
1006263317 6:32894831-32894853 GGCGGGAGGCGCGAACACGGAGG - Intergenic
1006665245 6:35688766-35688788 GGCCGGCCGCCCCATCTCCGTGG + Intronic
1007423727 6:41734501-41734523 GGTGGGCGGCACGGACTCGGGGG + Intronic
1007652907 6:43434204-43434226 AGCCGGGGGCCGGAACTGGGGGG + Intronic
1012475879 6:99614161-99614183 GGCCAGCGACCCCAGCTCGGCGG - Exonic
1019594661 7:1852883-1852905 GGACAGCGGCCCGTCCTCGGAGG - Intronic
1023016347 7:35971612-35971634 GGCCGGCCTCCCGAAGGCGGCGG - Intergenic
1033185817 7:139226092-139226114 GGCCGGCCGCCCCATCTGGGAGG + Intergenic
1036454045 8:8892879-8892901 GGCCGGCAGCACGAGCTGGGGGG + Exonic
1036786749 8:11692864-11692886 GGCGGGCGGCGCAAACTCGGCGG - Intronic
1041780966 8:61578179-61578201 GGCAGGCGGGCCGAACCAGGCGG - Intronic
1042489545 8:69381648-69381670 GGCCGGAGGCCCCAGCTTGGAGG - Intergenic
1061038686 9:128127573-128127595 GGCGGGCGGCCCGAGCCCCGTGG - Exonic
1061710217 9:132482309-132482331 GGCTGCCGGCCCGGCCTCGGTGG + Exonic
1062325006 9:136008696-136008718 GGGCGGCGGCCCGGGCTCAGAGG - Exonic
1062596418 9:137301933-137301955 GGCCCGCGGCCCGCGCCCGGCGG - Exonic
1187464405 X:19515015-19515037 GGCCGGCGGCCCGGAGGCTGGGG - Exonic
1196684080 X:118495926-118495948 GGCGGGCGGGCGGACCTCGGCGG - Exonic
1197299156 X:124757142-124757164 GGCCGGAAGCTCGAACTGGGTGG - Intronic
1200141672 X:153905679-153905701 TGCTGGCGGCCCTAGCTCGGCGG + Exonic