ID: 1136458600

View in Genome Browser
Species Human (GRCh38)
Location 16:30396016-30396038
Sequence CTCCCGGCCTGGCGCACAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 384
Summary {0: 1, 1: 0, 2: 1, 3: 51, 4: 331}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136458600_1136458607 11 Left 1136458600 16:30396016-30396038 CCAACTGTGCGCCAGGCCGGGAG 0: 1
1: 0
2: 1
3: 51
4: 331
Right 1136458607 16:30396050-30396072 GGCCTCTGTCCCCTCCCTCACGG 0: 1
1: 11
2: 9
3: 44
4: 538
1136458600_1136458605 -10 Left 1136458600 16:30396016-30396038 CCAACTGTGCGCCAGGCCGGGAG 0: 1
1: 0
2: 1
3: 51
4: 331
Right 1136458605 16:30396029-30396051 AGGCCGGGAGGGGCTCTTCACGG 0: 1
1: 0
2: 2
3: 24
4: 197

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136458600 Original CRISPR CTCCCGGCCTGGCGCACAGT TGG (reversed) Intronic
901351275 1:8599060-8599082 CTCCCAGCCTGGCGGACAGCGGG + Intronic
901434641 1:9239699-9239721 CCTCCTGCCTGGCGCACAGAAGG + Intronic
901689902 1:10965988-10966010 CTCAGGGCCTGGCACACAGTAGG - Intronic
901754610 1:11434033-11434055 CTTCCGGCCTGGCACACAGGAGG - Intergenic
901776338 1:11563008-11563030 TTTGAGGCCTGGCGCACAGTAGG - Intergenic
901875414 1:12164575-12164597 CTCCAGGGCTGGCACACAGTAGG + Intergenic
902572646 1:17356564-17356586 CACAGTGCCTGGCGCACAGTAGG - Intronic
902640677 1:17764326-17764348 CTCCATGCCTGGCACATAGTTGG + Intronic
902719274 1:18293211-18293233 CCCAGGGCCTGGCACACAGTGGG + Intronic
902719728 1:18295943-18295965 CCCAGGGCCTGGCACACAGTGGG + Intronic
902766130 1:18616660-18616682 CTCCAGGGCTGGCACACTGTGGG + Intergenic
902804578 1:18852915-18852937 CCCCAGGCCTGGCACATAGTAGG + Intronic
903369716 1:22827350-22827372 CTCCCAACCTGGCTCACAGCAGG + Intronic
903381835 1:22902631-22902653 CCCAGGGCCTGGCACACAGTGGG - Intronic
903495838 1:23766551-23766573 CACCCGGGCTGGTGCGCAGTGGG - Intergenic
903555740 1:24191937-24191959 CTCAGGGCCTGGCACATAGTAGG + Intergenic
903610713 1:24609982-24610004 TTCTCTGCCTGGCACACAGTAGG - Intergenic
904164599 1:28545745-28545767 CTCCCGGGCTGGAGTGCAGTGGG + Intergenic
904285656 1:29451903-29451925 CTCAGGGCCTGGCATACAGTAGG - Intergenic
904399552 1:30247244-30247266 CACCGGGCCTGGCACATAGTAGG + Intergenic
904419765 1:30384122-30384144 CTCAGGGCCTGGCATACAGTAGG + Intergenic
905043189 1:34976914-34976936 CTCCCTGCCTGGAGCACCGCTGG - Intergenic
905242147 1:36588268-36588290 CTCAGGGCCTGGCACACAGTAGG + Intergenic
906212547 1:44020152-44020174 CTCAGGGCCTGGCACACAGTGGG - Intronic
906471867 1:46137756-46137778 CCCAAGGCCTGGCACACAGTGGG + Intronic
907269037 1:53279863-53279885 CTTCAGGCCTGGCACACAGTAGG + Intronic
907458453 1:54591238-54591260 CGCCAGGCCTGGCCCACAGCCGG - Intronic
907906396 1:58785982-58786004 CTCAGTGCCTGGCTCACAGTAGG - Intergenic
909340227 1:74523634-74523656 CTCAGGGCCTGGCATACAGTAGG - Intronic
912510987 1:110190060-110190082 CACCAGGCCTGGCCCACAGCAGG + Intronic
912868525 1:113281470-113281492 CTCACAGCCTGGCACAGAGTGGG + Intergenic
914772719 1:150704693-150704715 CTCCCAGGCTGGAGCGCAGTGGG - Intronic
917954150 1:180075527-180075549 CACCCAGGCTGGAGCACAGTGGG - Intronic
919854640 1:201696895-201696917 CACCATGCCTGGCGCACACTCGG + Intronic
919905142 1:202073282-202073304 CTCACTGCCTGGCACACAGTAGG - Intergenic
920200035 1:204254167-204254189 CTCCCGGCCCTGCTCAGAGTTGG + Intronic
920330793 1:205206621-205206643 CGCCCAGGCTGGAGCACAGTGGG + Intronic
920362878 1:205431375-205431397 CTCCCGGCCTGGCACAAAGCAGG - Intronic
921285272 1:213603817-213603839 CGCCCGGGCTGGAGTACAGTGGG - Intergenic
921516198 1:216095611-216095633 CTCCCTGGCTGGTGCACAGCAGG - Intronic
923115967 1:230938311-230938333 CTCAAGGCCTGGCACACAGTAGG - Intronic
924857054 1:247884254-247884276 CTCCCGGGCTGGTGTACAATGGG + Intergenic
1063412891 10:5850273-5850295 CTCCACGCCTGGCACACAGCAGG + Intergenic
1065620129 10:27572354-27572376 CGCCCAGACTGGAGCACAGTGGG + Intergenic
1066025347 10:31352627-31352649 CTGCTGGCGTGGAGCACAGTTGG + Intronic
1067230356 10:44403010-44403032 CTCCCTGCCTGCCACACACTGGG - Intergenic
1067316668 10:45173043-45173065 CTCACTGCCTAGCACACAGTTGG - Intergenic
1067494285 10:46748016-46748038 CTCCCAGCCTGGCGGACAGCAGG + Intergenic
1067513028 10:46911312-46911334 CTCCCGGCCTGGCAAGCAGAGGG + Intergenic
1067600374 10:47592381-47592403 CTCCCAGCCTGGCGGACAGCAGG - Intergenic
1067836684 10:49645828-49645850 CTCCAAGCCTGGCCCACAGCTGG - Intronic
1069869437 10:71524239-71524261 CTCAGGGCCTGGCGCACGGTGGG + Intronic
1070836581 10:79450873-79450895 CACCCAGGCTGGAGCACAGTGGG - Intergenic
1071495973 10:86167915-86167937 CACCAGGCCAGGCTCACAGTGGG + Intronic
1071651908 10:87400253-87400275 CTCCCAGCCTGGCAGACAGCAGG - Intergenic
1072538629 10:96381674-96381696 GTCCCAGCCTGGAGCACTGTGGG - Intronic
1072664065 10:97381282-97381304 CTGCAGGCCTGGCCCACAGTAGG + Intronic
1073436154 10:103517399-103517421 CTCAGGGCCTGGTACACAGTAGG - Intronic
1074318805 10:112382108-112382130 CACACTGCCTGGCACACAGTAGG + Intronic
1075583792 10:123642993-123643015 CTCAGGACCTGGCCCACAGTGGG + Intergenic
1075591393 10:123694050-123694072 CACAGGGCCTGGCACACAGTAGG - Exonic
1075877880 10:125823048-125823070 CACCCGGCCTGGCACACAGCGGG + Exonic
1076133512 10:128029364-128029386 CCACAGGCCTGGCTCACAGTGGG - Intronic
1076218870 10:128717278-128717300 CCCCTGCCCTGGGGCACAGTTGG + Intergenic
1076494590 10:130888812-130888834 CTCTCAGCCTGGCACACAGTAGG - Intergenic
1076613404 10:131740817-131740839 TTCCCAGGCTGGAGCACAGTGGG + Intergenic
1077532603 11:3104174-3104196 CTCCCGGCATGGCGCGCACCTGG + Exonic
1078257438 11:9670792-9670814 CACCCAGGCTGGAGCACAGTGGG + Intronic
1078760161 11:14245307-14245329 GTGCAGGGCTGGCGCACAGTAGG - Intronic
1079005018 11:16785447-16785469 CACAGGGCCTGGCACACAGTGGG - Intronic
1079084893 11:17438240-17438262 CCCCAGGCCTGGCACACAGAAGG + Intronic
1079248261 11:18769160-18769182 CTCCAGGCCTTGCTCACAGGAGG - Intronic
1080332174 11:31152321-31152343 CTCCCAGCCTGACTTACAGTTGG - Intronic
1081605636 11:44525669-44525691 ATCCCAGCCTGGCACATAGTAGG + Intergenic
1081646221 11:44792488-44792510 CTGACTGCCTGGCACACAGTAGG + Intronic
1081729494 11:45360043-45360065 TGCAGGGCCTGGCGCACAGTAGG - Intergenic
1081759595 11:45567998-45568020 CTGCGGGCCTGGCACATAGTAGG + Intergenic
1083179713 11:60977334-60977356 CTCCCTGCCTGGACCACAGATGG + Intronic
1083184425 11:61008897-61008919 CTCCAGGCTTGGCGCCCAGTAGG - Intronic
1083184759 11:61011002-61011024 CCCAAGGCCTGGCACACAGTAGG + Intronic
1084105623 11:66978412-66978434 CTCTGGGCCTGGCACATAGTAGG + Intergenic
1084697867 11:70767009-70767031 GTCCGTGCCTGGCACACAGTAGG - Intronic
1084742162 11:71146838-71146860 CTTCAGGTCTGGCACACAGTAGG + Intronic
1084855597 11:71983642-71983664 CACAGGGCCTGGCACACAGTAGG - Intronic
1085260673 11:75203014-75203036 CCCCAGGCCTGGCACACAGTGGG - Intronic
1085311610 11:75520285-75520307 GTCCAGGCCTGGCACACAGGTGG - Intronic
1085524969 11:77158855-77158877 CTCCCAGCCTGGCACATAGTGGG - Intronic
1086523388 11:87697456-87697478 CTCCTGGCCTGGCAGTCAGTTGG + Intergenic
1087717217 11:101622225-101622247 CACCCAGGCTGGAGCACAGTTGG - Intronic
1089085947 11:115816767-115816789 CTCCCAGGCTGGAGTACAGTGGG - Intergenic
1089361046 11:117886871-117886893 CTCCAGGCCTGGCACATAGTAGG - Intergenic
1089453224 11:118610850-118610872 GCCCCGGCCTTGCGCACAGAGGG + Intronic
1089759711 11:120714428-120714450 CTCAGTGCCTGGCACACAGTAGG - Intronic
1089819634 11:121213053-121213075 CTCCTGGCCTGGCAGACAGAAGG - Intergenic
1089921665 11:122214945-122214967 CACACAGCCTGGCACACAGTAGG - Intergenic
1090238345 11:125165349-125165371 CTCCCGGCCGGGCGCTCCGCGGG + Intronic
1090661267 11:128883549-128883571 CTCTCTGCCTAGCGCACAGCTGG - Intergenic
1092291309 12:7160875-7160897 CACAGGGCCTGGCACACAGTAGG + Intergenic
1092615281 12:10211254-10211276 CTCCCAGGCTGGAGTACAGTGGG + Intergenic
1094318507 12:29158981-29159003 CACCCTGCCTGGCACATAGTAGG - Intronic
1096085946 12:48865223-48865245 CTCCCGGCCAGGTGAACAGAGGG + Intronic
1096105526 12:48995176-48995198 CACACTGCCTGGCACACAGTAGG - Exonic
1098092884 12:66922868-66922890 CTCTGAGCCTGGCACACAGTGGG + Intergenic
1101330632 12:103755156-103755178 CTCTGTGCCTGGCACACAGTAGG - Intronic
1101955417 12:109208255-109208277 CTCCCAGGCTGGAGTACAGTGGG + Intronic
1101999059 12:109545327-109545349 CACCCAGCCTGGGGCACAGGAGG - Intergenic
1102379708 12:112454168-112454190 CTCCCAGGCTGAAGCACAGTTGG + Intronic
1102813361 12:115842973-115842995 CACCTCGCCTGGCACACAGTAGG - Intergenic
1102859752 12:116325553-116325575 CACAGGGCCTGGCACACAGTAGG - Intergenic
1103530873 12:121600742-121600764 CATCAGGCCTGGCACACAGTAGG - Intergenic
1106085138 13:26535083-26535105 CACCAGGCCTGGTGCATAGTAGG + Intergenic
1106138928 13:26994527-26994549 ATCAGGGCCTGGCACACAGTCGG + Intergenic
1106229028 13:27807592-27807614 CCCAGGGCCTGGCACACAGTGGG + Intergenic
1112315549 13:98359284-98359306 CCCACTGCCTGGCACACAGTGGG + Intronic
1115331431 14:32202282-32202304 CACCAGTCCTGTCGCACAGTGGG + Intergenic
1117734423 14:58754638-58754660 CTCCCTCCCAGGCTCACAGTGGG - Intergenic
1119121760 14:72085811-72085833 CTCCCTGGCTGGAGTACAGTGGG - Intronic
1122300439 14:100728256-100728278 CTACCAGCCTGGCACACAGTAGG - Intronic
1122917494 14:104865687-104865709 CTCCCGGCCTGGCGCAGACCAGG - Intronic
1122938180 14:104969544-104969566 CTCAGAGCCTGGCACACAGTAGG + Intronic
1126102660 15:45129316-45129338 CTCCCGGCCTGGTACAGAGAAGG + Intronic
1128464099 15:67894274-67894296 CCCCCAGGCTGGAGCACAGTAGG - Intergenic
1128553742 15:68615988-68616010 CAGCAGGTCTGGCGCACAGTAGG - Intronic
1128588669 15:68875140-68875162 CACCGGGCCTGGTGCACAGAAGG + Intronic
1129109216 15:73327980-73328002 CCCCATGCCTGGCACACAGTAGG - Intronic
1129598684 15:76984455-76984477 CTCCCAGCCTGGCACAGAGTGGG + Intergenic
1129685633 15:77684787-77684809 CCCTGGGCCTGGCACACAGTAGG - Intronic
1129704179 15:77785170-77785192 CTCAGGGCCTGGCACACAGTGGG + Intronic
1129706301 15:77796518-77796540 CACATGGCCTGGCTCACAGTAGG + Intronic
1129888551 15:79055897-79055919 CTTTTGGCCTGGCACACAGTAGG - Intronic
1130369092 15:83268347-83268369 TTCTGGGCCTGGCACACAGTGGG - Intronic
1130564905 15:84985682-84985704 CCCCAGGCCTGATGCACAGTAGG + Intronic
1130656061 15:85792949-85792971 CTCAGGGCCTGGCACACAGCAGG + Intronic
1132238335 15:100238429-100238451 AGCCGGGCCTGGCACACAGTAGG + Intronic
1132872763 16:2123078-2123100 CCCCAGGCCTGGTTCACAGTGGG - Intronic
1133496781 16:6325900-6325922 CTCCATGCCTGGCTTACAGTTGG + Intronic
1133600878 16:7339272-7339294 TTCACAGCCTGGCACACAGTAGG - Intronic
1133612994 16:7450698-7450720 ATCCATGCCTGGCGCCCAGTAGG - Intronic
1134005712 16:10817992-10818014 CCCCAGACCTGGCACACAGTAGG + Intronic
1134017372 16:10898566-10898588 CTCTGGGCCTGGCACACAGTGGG - Intronic
1134017385 16:10898598-10898620 CCCAAGGCCTGGCACACAGTGGG + Intronic
1134551850 16:15142257-15142279 CCCCAGGCCTGGTTCACAGTGGG - Intergenic
1135747822 16:25032180-25032202 CTCCAAGCCTGGCTCACAGCAGG - Intergenic
1136023028 16:27451994-27452016 GTCCCAGCCTGGCACATAGTAGG + Exonic
1136393127 16:29977776-29977798 CTCCCGGCCCGGCCCCCAGCTGG - Exonic
1136458600 16:30396016-30396038 CTCCCGGCCTGGCGCACAGTTGG - Intronic
1137577972 16:49616134-49616156 CTTACTGCCTGGCACACAGTAGG + Intronic
1137589552 16:49685307-49685329 GTCCATGCCTGGCACACAGTAGG - Intronic
1138180811 16:54939001-54939023 TTCCCAGCCTGGCGCACAGAAGG - Intergenic
1139483880 16:67245702-67245724 CTCCCAGGCTGGAGTACAGTGGG - Intronic
1141764554 16:86049883-86049905 CACTGGGCCTGGCGCACAGGAGG - Intergenic
1141855045 16:86675016-86675038 CTCCATGCCTGGCACATAGTAGG + Intergenic
1142382453 16:89740748-89740770 GCCCCTGCCTGGCCCACAGTGGG + Intronic
1142670956 17:1487228-1487250 CCCACGGCCTGGCTCTCAGTAGG - Intronic
1142965816 17:3580359-3580381 CGCCGGGCCTGGCACATAGTGGG - Intronic
1143047704 17:4095449-4095471 CATCAGGCCTGGCACACAGTAGG + Intronic
1143634760 17:8158224-8158246 CACCCAGGCTGGAGCACAGTGGG + Intronic
1144724500 17:17495040-17495062 CTCCCGGCCTGGGGCGCACCGGG + Exonic
1144759399 17:17698820-17698842 CTCAGTGCCTGGCACACAGTAGG - Intronic
1144944815 17:18964464-18964486 CCCAGGGCCTGGCACACAGTAGG - Intronic
1146491330 17:33284977-33284999 CTCAGTGCCTGGCACACAGTAGG + Intronic
1147218728 17:38915696-38915718 CTCTAGGCCTGGCTCAGAGTAGG - Intronic
1148540476 17:48476539-48476561 CTCAGGGCCTGGCTTACAGTAGG - Intergenic
1148602972 17:48908293-48908315 CTCCCGTCCTGGAGGACCGTAGG + Intergenic
1148773009 17:50077691-50077713 CTCAGGGGCTGGCACACAGTTGG - Intronic
1148967962 17:51453291-51453313 CTCAGGGCCTGGCATACAGTAGG + Intergenic
1149455097 17:56781397-56781419 ATTCGCGCCTGGCGCACAGTGGG + Intergenic
1150755350 17:67907142-67907164 CACCCAGGCTGGAGCACAGTGGG - Intronic
1150791402 17:68202600-68202622 CACCCAGGCTGGAGCACAGTGGG - Intergenic
1151895367 17:76976871-76976893 CTCCCTCCCTGGCTCACAGAAGG + Intergenic
1152348279 17:79768258-79768280 CACAGGGCCTGGCACACAGTGGG + Intergenic
1152743945 17:82030796-82030818 CTCCCGGCCTGTCTCACTTTGGG - Exonic
1152856692 17:82668636-82668658 CTCCAGTCGTGGAGCACAGTTGG - Intronic
1154477388 18:14776225-14776247 CTCACTGCCTAGCACACAGTTGG - Intronic
1154482010 18:14839110-14839132 CTCACTGCCTAGCACACAGTTGG - Intronic
1155919949 18:31593599-31593621 CCCCCAGCCTTGCACACAGTAGG - Intronic
1156408437 18:36805308-36805330 CTCCATGCCTGGCGCATAGTAGG - Intronic
1157464615 18:47932052-47932074 CTCCCTGCCTGTGTCACAGTGGG - Intergenic
1157602177 18:48901078-48901100 ATGCAGGCCTGGCTCACAGTAGG - Intergenic
1158451948 18:57574611-57574633 CTCCTGGCCTGGCTCACTTTGGG - Intronic
1160737809 19:672290-672312 CCCAGGGCCTGGCACACAGTGGG + Intergenic
1160942015 19:1624692-1624714 CTCACGGACGTGCGCACAGTGGG + Intronic
1161138042 19:2632140-2632162 CTCCTGGCCTGGCGCTGTGTGGG + Intronic
1161286344 19:3470286-3470308 ATCCAAGCCTGGCACACAGTCGG + Intergenic
1161399277 19:4060220-4060242 CTCCCAGGGTGGCGCATAGTAGG + Intronic
1161497656 19:4596418-4596440 CTGTCGGGCTGGCGCACACTTGG + Intergenic
1161625054 19:5321588-5321610 CTCTGGGCCTGGCACACAGTGGG - Intronic
1161956731 19:7500263-7500285 CTGTAGGCCTGGCACACAGTAGG - Intronic
1162538388 19:11277715-11277737 CACACAGCCTGGCACACAGTAGG + Intergenic
1162791397 19:13064877-13064899 CTCAGGGCCTGGCTCATAGTTGG - Intronic
1162858142 19:13485018-13485040 CTCAGTGCCTGGCACACAGTTGG + Intronic
1163037575 19:14579843-14579865 CTCGGGACCTGGCACACAGTAGG - Intergenic
1165830660 19:38728772-38728794 TTCCCGGCCTGGGGCACTGGGGG + Intronic
1166228360 19:41411218-41411240 CCCCCAGCCAGGCACACAGTAGG - Intronic
1167194679 19:48019953-48019975 CTCAGTGCCTGGCTCACAGTGGG - Intronic
1167556819 19:50201944-50201966 CTCAGTGCCTGGCACACAGTAGG - Intronic
1167560235 19:50222634-50222656 CTCCATGCCTGGCGCTCAGTAGG + Intronic
1167736154 19:51295778-51295800 CCCGCGGCCTGGCACACAGGAGG - Intergenic
1168516888 19:57016536-57016558 ATCCCAGCCTGGCACACAGTAGG + Intergenic
1168705320 19:58467334-58467356 CTCCTGGGCTGCCGCACGGTGGG - Exonic
926334142 2:11850471-11850493 CTCGGGGGCTGGTGCACAGTAGG + Intergenic
926735071 2:16067696-16067718 CTCCCTGTCCAGCGCACAGTAGG - Intergenic
927091301 2:19714833-19714855 CTCCAGGTCTGGCACACAGTGGG - Intergenic
928200500 2:29244975-29244997 CTCAGTGCCTGGCACACAGTAGG + Intronic
928256057 2:29723515-29723537 CTCCATGCCTGGCACACAGCAGG + Intronic
928633531 2:33218435-33218457 CGCCCAGGCTGGAGCACAGTGGG + Intronic
930994876 2:57704411-57704433 CACCCAGGCTGGAGCACAGTGGG + Intergenic
933294139 2:80470644-80470666 CACACAGCCTAGCGCACAGTAGG - Intronic
933943263 2:87262910-87262932 CACCTGGCCTGGCACACAGGAGG - Intergenic
936336951 2:111598651-111598673 CACCTGGCCTGGCACACAGGAGG + Intergenic
937098923 2:119253882-119253904 CCCAGGGCCTGGCACACAGTAGG + Intronic
937249446 2:120514346-120514368 CTCACGGCCTGGCACACAGTAGG + Intergenic
942085813 2:172442691-172442713 CACAGTGCCTGGCGCACAGTAGG + Intronic
942748734 2:179264691-179264713 CTCCCCGCCTGACGCACGGAGGG - Exonic
947611249 2:231526353-231526375 CCCCTGGCCTGGTGCACAGAGGG + Intronic
948212795 2:236207593-236207615 CTCCCGGCTGGGCACAGAGTAGG - Intronic
948546023 2:238729513-238729535 CTCCAGGACTAGCACACAGTAGG - Intergenic
948959595 2:241322563-241322585 CTCCCGGGCTGAAGTACAGTGGG - Intronic
1168756560 20:322466-322488 TTCACTGCCTGGTGCACAGTAGG + Intergenic
1168798534 20:628671-628693 CACAGGGCCTGGCACACAGTAGG + Intergenic
1168862038 20:1052537-1052559 CTCAGTGCCTGGCACACAGTGGG - Intergenic
1168924883 20:1571309-1571331 CACAGTGCCTGGCGCACAGTAGG + Intronic
1170029408 20:11929454-11929476 CTCCAAACCTGGCACACAGTAGG - Intergenic
1170530871 20:17290218-17290240 ATCACTGCCTGGCACACAGTAGG + Intronic
1171103321 20:22407486-22407508 CCACCGCCCTGGCACACAGTAGG - Intergenic
1171123975 20:22586186-22586208 ATCCCGCCCTGGCGCTCACTCGG - Intergenic
1172146312 20:32760829-32760851 CGCCCTGCCTGGCGCCCAGCAGG - Intergenic
1172421834 20:34825117-34825139 CTCCAGGCCTGGGGAACAGGCGG - Intronic
1172838415 20:37887608-37887630 CTCCAGCCCTAGTGCACAGTCGG - Intergenic
1172981628 20:38947007-38947029 CTCACGGCTTGGCACATAGTAGG + Intronic
1173494833 20:43511084-43511106 CTCCCAGGCTGGAGTACAGTGGG + Intronic
1173839375 20:46147382-46147404 CTCAGGGCCTGGCACACAGTAGG - Intergenic
1174200347 20:48802710-48802732 CCCCATGCCTGGCACACAGTAGG + Intronic
1175147572 20:56908401-56908423 CTCCAGGCCTGGCTAACAGGTGG - Intergenic
1175226764 20:57449208-57449230 CTCCCTCCCTTGCTCACAGTGGG + Intergenic
1175871656 20:62212119-62212141 CACCATGCCTGGCACACAGTAGG + Intergenic
1175965644 20:62658844-62658866 CGCCCGGCCTGACTCAGAGTGGG - Intronic
1176027908 20:62995459-62995481 CTCCCGGCCTGGCCCACTCCAGG + Intergenic
1176091698 20:63321201-63321223 CCCCCGTCCTGCCGCAGAGTTGG + Intronic
1176992998 21:15521383-15521405 CTCCATGCCTGGCTCACACTTGG - Intergenic
1177868083 21:26536906-26536928 ATCTGGGCCTGGCACACAGTAGG - Intronic
1178350921 21:31872906-31872928 CTCCCTGTCTGGCGCTCAGGTGG + Intergenic
1178884665 21:36475788-36475810 CACCCAGGCTGGAGCACAGTAGG + Intronic
1179369213 21:40789010-40789032 CTCATTGCCTGGCGCATAGTCGG + Intronic
1180177839 21:46098741-46098763 CTCCCGGCCTGGAGCCCACCAGG + Intronic
1181884265 22:26007200-26007222 CCCCAGGGCTGGCTCACAGTTGG + Intronic
1181991525 22:26840515-26840537 CTCTGGGCCTGGCACACAGGAGG - Intergenic
1182463649 22:30500791-30500813 CCCTCAGCCTGGCGCATAGTAGG - Intronic
1183363407 22:37394596-37394618 CTCCCGCCCCGGCACACAGTAGG + Intronic
1183715668 22:39532265-39532287 CTCCGCGCCTGGCACACAGTAGG + Intronic
1183924989 22:41199429-41199451 CACCGGGCCTGGTGCACGGTAGG - Intergenic
1184101825 22:42344796-42344818 CTCTGGGCCTGGCCCACAGTAGG + Intergenic
1184132183 22:42523433-42523455 CTCCCGGGCTGGTGTGCAGTGGG + Intergenic
1184296060 22:43526326-43526348 CCCCCAGCCTGGCACACAGCAGG - Intergenic
1184397891 22:44255578-44255600 CTGCCAGCCTGGACCACAGTAGG - Intronic
1184449353 22:44573793-44573815 CACAGGGCCTGGCACACAGTTGG + Intergenic
1184850857 22:47119535-47119557 CACCCGGGCTGGTGTACAGTGGG + Intronic
949795899 3:7850759-7850781 CTCCCAGCATGAAGCACAGTTGG + Intergenic
949839202 3:8301903-8301925 CTCAGTGCCAGGCGCACAGTAGG + Intergenic
949877277 3:8634530-8634552 CTCCAGCCCTGGCACACAGAGGG + Intronic
950122206 3:10489347-10489369 CCCACTGCCTGGCACACAGTAGG + Intronic
950506836 3:13400275-13400297 GCCCAGGCCTGGCGCACAGCAGG + Intronic
950580631 3:13859682-13859704 CTCAGGGCCTGGCACAGAGTAGG + Intronic
950585163 3:13887084-13887106 CTACCAGCCTGGCGCACAGAGGG - Intergenic
950648323 3:14391765-14391787 CTCAGTGCCTGGCACACAGTAGG + Intergenic
950656858 3:14441866-14441888 CGCCATGCCTGGCACACAGTAGG - Intronic
952852744 3:37742226-37742248 CTCCAGTCCTGGCTCACAGGAGG + Intronic
953055721 3:39385690-39385712 CTCGGAGCCTGGTGCACAGTAGG - Intronic
953241106 3:41150230-41150252 CTCAGTGCCTGGCGCACAGTGGG + Intergenic
953660223 3:44886518-44886540 CTCATGGCATGGCACACAGTAGG - Intronic
954277082 3:49549396-49549418 CTCCAGGCCTGGCACTGAGTAGG + Intergenic
954420191 3:50414819-50414841 CCGCCGGCCTGGCGCAGACTTGG - Intronic
954622876 3:52005791-52005813 CTCCCACCCTGGCGCAGAGGAGG + Intergenic
960048491 3:113219359-113219381 CACAAGGCCTGGCACACAGTAGG - Intronic
962375337 3:134854177-134854199 CACAGGGCCTGGCTCACAGTAGG + Intronic
962475517 3:135751861-135751883 CTCAGTGCCTGGCCCACAGTAGG + Intergenic
963481666 3:145882663-145882685 CTCTCAGCCTGGAGCTCAGTGGG + Intergenic
963741441 3:149085998-149086020 CACAATGCCTGGCGCACAGTGGG + Intronic
966945413 3:184774027-184774049 ATCCCCGCCTGGCACACAGTGGG - Intergenic
967805533 3:193711657-193711679 CTCCCGGCCTGGCTGTCAGCTGG - Intergenic
967824747 3:193869366-193869388 CTCCAGGCCTGGCTCAGGGTGGG - Intergenic
968814204 4:2813247-2813269 GGCCCAGCTTGGCGCACAGTGGG - Intronic
968900723 4:3430603-3430625 CTCCCAGCCTGGCGAGCAGTGGG + Exonic
968962020 4:3750507-3750529 CCCAGGGCCTGGCACACAGTAGG - Intergenic
969521722 4:7681906-7681928 CTTCTGGCCTGGCACACAGGAGG + Intronic
969605809 4:8201773-8201795 CTCCGGGCCTGGCACACAGCTGG - Intronic
970436505 4:16040739-16040761 CACCGGGCCTGGCACACAGTGGG + Intronic
973290965 4:48469984-48470006 CTCAGGGCCTGGAACACAGTAGG + Intergenic
974009878 4:56596930-56596952 ATCACTGCCTGGCTCACAGTAGG - Intronic
975910385 4:79259505-79259527 CTCCCTGCCTGGCTCACCCTTGG + Intronic
976234698 4:82884026-82884048 CACCCAGGCTGGAGCACAGTGGG + Intronic
977607185 4:98995463-98995485 CTCCCGGCGGCGCGCACATTGGG - Intergenic
984401181 4:179267149-179267171 CTTCCAGGCTGGAGCACAGTGGG + Intergenic
984820524 4:183877719-183877741 CTCCCAGGCTGGAGTACAGTGGG + Intronic
988217248 5:28290919-28290941 CTCCTAGCCTGGCACATAGTAGG + Intergenic
991038278 5:62150053-62150075 CTCCCTTCCTGGCTCACAGATGG + Intergenic
991899921 5:71450530-71450552 CCCTGTGCCTGGCGCACAGTGGG - Intergenic
992365331 5:76084226-76084248 CGCCTGGCCTGGCGCACAGCAGG - Intronic
992467356 5:77019927-77019949 CACCAGGCCTAGCACACAGTTGG + Intergenic
996052285 5:118948185-118948207 CACCGTGCCTGGCCCACAGTTGG - Intronic
998509703 5:142701440-142701462 TTACAGGCCTGGCACACAGTGGG + Intergenic
998963265 5:147510144-147510166 CTCCCGGGCTGACGCAGCGTCGG + Intergenic
1001240600 5:170067100-170067122 CACCCAGCCTGGCACATAGTAGG - Intronic
1001691696 5:173638165-173638187 CTGCTGGCCTGGCACACAGTAGG + Intergenic
1001741501 5:174056611-174056633 CACCGTGCCTGGCTCACAGTAGG + Intronic
1003311520 6:4973536-4973558 TACCACGCCTGGCGCACAGTGGG - Intergenic
1003558286 6:7160018-7160040 CTCAGTGCCTGGCACACAGTAGG - Intronic
1005047509 6:21656003-21656025 TTCCCAGCCTGGCTCACAGGTGG - Intergenic
1005243639 6:23857501-23857523 CTCCTAGCCAGGCACACAGTTGG - Intergenic
1006179950 6:32148760-32148782 CTCCAGGCCTCGCCCACAGACGG - Exonic
1006889339 6:37412255-37412277 CACCCAGGCTGGAGCACAGTGGG + Intergenic
1006940495 6:37748858-37748880 CTCCTGGCCTGCTGCACAGATGG - Intergenic
1007632376 6:43279627-43279649 CACAAGGCCTGGCACACAGTTGG + Intronic
1007864440 6:44953129-44953151 GTCAGGGCCTGGCACACAGTAGG + Intronic
1007926977 6:45657694-45657716 CATCCTGCCTGGCACACAGTAGG + Intronic
1010315755 6:74448137-74448159 CACCCAGGCTGGAGCACAGTGGG - Intergenic
1010712577 6:79192450-79192472 CACCATGCCTGGCACACAGTAGG - Intergenic
1013779357 6:113713091-113713113 CGCCCAGGCTGGAGCACAGTTGG + Intergenic
1015490342 6:133817819-133817841 CGCCCAGGCTGGAGCACAGTGGG - Intergenic
1015941977 6:138461954-138461976 CTCAGGGCCTGGCACACAGTAGG - Intronic
1016516233 6:144895526-144895548 CTCAGTGCCTGGCACACAGTTGG + Intergenic
1018343663 6:162879677-162879699 CTCGGGGCCTGGCCCACAGCAGG - Intronic
1019514108 7:1432291-1432313 CTCCAGGCTGGGCACACAGTTGG - Intronic
1019630238 7:2045170-2045192 CTCCTGGCCTGGAGCAGAGAGGG - Intronic
1022923923 7:35041813-35041835 CTCAGTGCCTGGCACACAGTCGG + Intergenic
1023880860 7:44320776-44320798 CTTCCGGCCTGGCTCCCAGGAGG - Intronic
1027924953 7:84448088-84448110 CTCCCTGCCTGGCTCACCCTTGG + Intronic
1029637286 7:101793524-101793546 CTACAGGCCTGGCACATAGTAGG - Intergenic
1029703451 7:102262715-102262737 CTCCCAGGCTGGGGCACAGCTGG - Intronic
1029822237 7:103157585-103157607 CTCAGTGCCTGGCACACAGTCGG + Intergenic
1032262375 7:130347653-130347675 CTCCCCGCCTGGCCCTCAGCTGG + Intronic
1032303487 7:130711052-130711074 CGCCCGGGCTGGAGTACAGTGGG + Intergenic
1034193141 7:149226014-149226036 CTCCCAGCCGGGATCACAGTGGG + Exonic
1034338285 7:150337295-150337317 CTCCCGGACTGCAGCCCAGTAGG - Exonic
1034680822 7:152925954-152925976 CTCCCGGGCAGCCCCACAGTGGG + Intergenic
1035022001 7:155805702-155805724 GTCCCGGCCCGGCTCCCAGTAGG + Intronic
1036199366 8:6754541-6754563 CTCCTGACCTGGCACACAGCTGG - Intronic
1036904907 8:12699927-12699949 CTCCCTGCGTGGTGCACATTGGG + Intergenic
1038359728 8:26865013-26865035 CTCCCGGGCTGGCGCGGAGGCGG + Exonic
1038531250 8:28319550-28319572 CTCACTGCCTGGCACAGAGTGGG - Intronic
1038740294 8:30211280-30211302 CTCAGGGTCTGGCACACAGTAGG + Intergenic
1043187024 8:77165300-77165322 CTCCCAGGCTGGAGTACAGTGGG - Intergenic
1044332449 8:90937239-90937261 CTCCAGGCCTGGAACATAGTTGG - Intronic
1044715898 8:95099197-95099219 CACCCAGGCTGGAGCACAGTGGG - Intronic
1045111882 8:98944427-98944449 CTCCCGGCCTGGGGCAGCCTGGG + Exonic
1048037822 8:130693807-130693829 CTCCCGGCCTGGCAGTCAGCAGG + Intergenic
1048161109 8:132022893-132022915 CTCCTGGCCTGCTGCACAGTTGG - Intergenic
1049000356 8:139822151-139822173 CCCACGGCCTGGCCCACAGCTGG - Intronic
1049354288 8:142179965-142179987 CTCCCAGCCTGGGCCACAGGTGG + Intergenic
1049566615 8:143343546-143343568 CTCCCGGCCTCGGGAAGAGTGGG + Intronic
1049690194 8:143954926-143954948 GCCCCAGCCTGGCGCACAGTGGG - Intronic
1049839721 8:144763198-144763220 CACACAGCCTGGCGCACAGGTGG - Intergenic
1049989469 9:977580-977602 GCCCCGGCCTGGCGGAGAGTAGG - Intronic
1051374706 9:16391314-16391336 CTCTGTGCCTGGCCCACAGTAGG - Intergenic
1052339472 9:27351189-27351211 CACCACGCCTGGCCCACAGTGGG + Intronic
1052403613 9:28031931-28031953 CTGCCTGCCTGGCACACAGTTGG - Intronic
1053004844 9:34597584-34597606 CTCTAGGCCTGGCACACAGTAGG - Intergenic
1056477853 9:86970222-86970244 CACCCAGGCTGGAGCACAGTGGG + Intergenic
1056943710 9:90976270-90976292 GTCCCGGCCTGGCCCACCGCAGG - Intergenic
1058763476 9:108159560-108159582 CTCTCAGCCTGGTGCAGAGTAGG - Intergenic
1058908308 9:109498547-109498569 CTGAGGGCCTGGCACACAGTAGG - Intergenic
1059413833 9:114151107-114151129 AACCCAGCCTGGTGCACAGTGGG + Intergenic
1059457945 9:114411659-114411681 CACGGGGCCTGGCGCACAGTAGG - Intronic
1059468028 9:114481746-114481768 CTCTAGGCTTGGCACACAGTAGG - Intronic
1060498556 9:124135447-124135469 CGCCCAGGCTGGAGCACAGTGGG + Intergenic
1060523904 9:124309825-124309847 GACACGACCTGGCGCACAGTGGG - Intronic
1061250953 9:129426121-129426143 CACTCTGCCTGGCACACAGTAGG - Intergenic
1061258410 9:129466087-129466109 CTCCATGCCTGGCACACAGTAGG - Intergenic
1061483720 9:130909855-130909877 GTCCCTGCCTGGCACAAAGTAGG - Intronic
1061486018 9:130920847-130920869 CTCCCAGCCTGGTGGACAGAAGG - Intronic
1061676049 9:132216258-132216280 CACACTGCCTGGCACACAGTAGG - Intronic
1062520606 9:136956179-136956201 CTCCCTGCCCGGAGGACAGTGGG - Intronic
1062546203 9:137064785-137064807 CTCCTGGGCAGGTGCACAGTTGG + Exonic
1186191701 X:7073105-7073127 CACCCTGCCTGGCACACAGTGGG + Intronic
1186445142 X:9620861-9620883 CTCCCTGCCTGGGACCCAGTGGG - Intronic
1187411885 X:19058178-19058200 CCCCGTGCCTGGCACACAGTAGG - Intronic
1188371899 X:29379361-29379383 CTCCTGGCCTGGCAGTCAGTTGG + Intronic
1192270206 X:69571952-69571974 CACAGGGCCTGGCACACAGTGGG + Intergenic
1192637393 X:72832477-72832499 CTCCCGGCCCAGCAGACAGTAGG - Intronic
1192644321 X:72888337-72888359 CTCCCGGCCCAGCAGACAGTAGG + Intronic
1194353701 X:92855235-92855257 CTTCCGGCCTTGCGGACAGACGG + Intergenic
1197703209 X:129615541-129615563 CACCATGCCTGGCACACAGTAGG + Intergenic
1197754332 X:129983822-129983844 CTCCAGGCCTGGCGCGAAGCGGG - Intronic
1200662062 Y:5972307-5972329 CTTCCGGCCTTGCGGACAGACGG + Intergenic