ID: 1136461214

View in Genome Browser
Species Human (GRCh38)
Location 16:30411367-30411389
Sequence GAAGAATTATTGGCTGCTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 97
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 90}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136461214 Original CRISPR GAAGAATTATTGGCTGCTAC AGG Intronic
903685908 1:25131878-25131900 GAAGAGGTCTTGGCTGCTACAGG - Intergenic
905704577 1:40045148-40045170 GAAGTCTTATTGGCATCTACTGG - Intronic
905905270 1:41613829-41613851 GATGAATTAGTGGCTGCCAGGGG - Intronic
906807802 1:48796241-48796263 GAAGAAGTGTTGGGTGCTAGTGG - Intronic
908963199 1:69726977-69726999 GGAGAATTATTGGGTGGTTCTGG + Intronic
910607993 1:89108412-89108434 GAAAAATTATTGGCAGGTATAGG - Intronic
918404632 1:184199664-184199686 CATGATTTATTAGCTGCTACTGG + Intergenic
922647155 1:227300195-227300217 GAACACTTATAGACTGCTACTGG + Intronic
1063560355 10:7120607-7120629 GAAGAATTATTTGCTCATAAAGG + Intergenic
1063975934 10:11415568-11415590 GAAAAATTATTTCCTGCTTCTGG + Intergenic
1072093199 10:92149885-92149907 GAAGATTATTTGTCTGCTACAGG + Intronic
1073707722 10:106004445-106004467 TAAGAATTATGGGCTGGAACTGG - Intergenic
1080111502 11:28573093-28573115 GCAGAATTATTGGCTGCTTAAGG + Intergenic
1082233980 11:49800227-49800249 GAAGGAATATTTGCTGCAACAGG + Intergenic
1085469400 11:76747625-76747647 GCAGCTTTCTTGGCTGCTACAGG + Intergenic
1086761869 11:90641484-90641506 GAAGAAATAGTGGCTGCAATGGG - Intergenic
1092503940 12:9075948-9075970 GAAGAATTAATGGCTGTCAAAGG + Intronic
1093336788 12:17914409-17914431 GAAGAATGAGAGGCTGCTATAGG - Intergenic
1093789211 12:23228240-23228262 GAAGAATTAATGTCTCCTGCAGG + Intergenic
1099594542 12:84643636-84643658 TAAGAAAGATTGGCTGCTATAGG - Intergenic
1102284812 12:111647481-111647503 GAAGAAATATTCACTGGTACTGG + Intronic
1107113729 13:36724689-36724711 GCAGAATTCTTCACTGCTACAGG - Intergenic
1108901356 13:55412246-55412268 GAAGAACTAAGGGCTGCCACAGG + Intergenic
1111454904 13:88467926-88467948 AAAGAATTAGAGGCTGCTCCTGG + Intergenic
1117421823 14:55554277-55554299 AAAGAATTATTGACTGTAACAGG - Intergenic
1118471393 14:66078149-66078171 GAAGAATTACTGCCTGTTCCTGG + Intergenic
1118724707 14:68620881-68620903 GATGGAATATTGGCTGATACAGG + Intronic
1121029480 14:90645930-90645952 GAAGAAGTGCAGGCTGCTACAGG + Intronic
1126993382 15:54409986-54410008 GAACAATTATACGCTGCTAGTGG - Intronic
1136461214 16:30411367-30411389 GAAGAATTATTGGCTGCTACAGG + Intronic
1140833107 16:78769668-78769690 TAAGAATTATTAGCTACAACAGG + Intronic
1141305395 16:82858201-82858223 AAAGAATTGTTGGCAGCCACTGG + Intronic
1146665118 17:34695836-34695858 GAAGACTTATTTGCTTCTTCAGG - Intergenic
1146963556 17:37005424-37005446 GAAGAATTATTGGCATCTGAAGG + Intronic
1148329639 17:46806095-46806117 GAGGAATTACTAGCTGCCACTGG + Intronic
1148989618 17:51654115-51654137 GAAGATTTACTGGCTGCCAGTGG - Intronic
1151524950 17:74658716-74658738 GAAGAATTATAGCCTCCTCCAGG + Intergenic
1155603600 18:27577291-27577313 GGTGAATTATTGACTGCTAACGG - Intergenic
1161597211 19:5156655-5156677 TAAAAATTATTTGCTGCTGCAGG + Intergenic
926346811 2:11954467-11954489 GAAGACTTTTTGGGTGCTTCAGG + Intergenic
930764025 2:55065819-55065841 GAAGTATTATTGACTGAGACAGG + Intronic
930772167 2:55139529-55139551 GAAGATTTCTTGGCTGTTTCAGG + Intergenic
933310180 2:80651148-80651170 GAAGCATTTTTGGCTGCAGCAGG + Intergenic
937867152 2:126761090-126761112 AAAGAGCTCTTGGCTGCTACTGG + Intergenic
945708541 2:213266561-213266583 AAAGCATTATTGGCAGCTGCTGG + Intergenic
948678476 2:239613090-239613112 AAAGAATAAATGGCTGCTAAAGG - Intergenic
1169975437 20:11321459-11321481 TCAGAATTATTGGCTTCTAGTGG - Intergenic
1171225807 20:23441182-23441204 GAAAAAATATTGGGGGCTACAGG - Intronic
1172976339 20:38908682-38908704 AAAGGACCATTGGCTGCTACAGG - Intronic
1173072635 20:39784087-39784109 GAAGAATTATTGTGTGAAACAGG - Intergenic
1173208631 20:41014460-41014482 AATGAATTATGGGCTGCAACGGG - Intergenic
1175411370 20:58771864-58771886 GGAGAATAATTGACTGCTATGGG - Intergenic
1181010524 22:20037734-20037756 AAAGAACTATTGACTGCTACAGG + Intronic
1181395498 22:22618445-22618467 GCAGAATCAGGGGCTGCTACTGG - Intergenic
951590485 3:24259082-24259104 GAAGAGTTATTGGATGCTCATGG - Intronic
956345637 3:68275136-68275158 GAAGAATTTATGGCAGGTACTGG + Intronic
960626837 3:119689342-119689364 GAAGTATTAGGGGCTGATACAGG - Intergenic
962905196 3:139794981-139795003 CAAGAATTACTTGCTGCTTCTGG + Intergenic
965779763 3:172272491-172272513 GGAGAAGGACTGGCTGCTACAGG + Intronic
969378167 4:6776839-6776861 GTAGCATCATTGGCTGTTACTGG + Intergenic
971354924 4:25886748-25886770 AAAGAATTCCTGGCTGCTACGGG - Intronic
976103118 4:81586875-81586897 GAGGCATTATTGGCTGTTGCGGG - Intronic
980205088 4:129708301-129708323 GAAAAATAATTGTCTACTACTGG - Intergenic
985415702 4:189733891-189733913 GAAGAAATATTGGAGGCTTCAGG - Intergenic
985767987 5:1790903-1790925 GCAGGATTATTGGCTCCTGCAGG - Intergenic
985923067 5:2994561-2994583 GCAGAATTCTCAGCTGCTACTGG + Intergenic
987954427 5:24719633-24719655 GAAGTATGGTTGGCTACTACAGG - Intergenic
996429591 5:123357906-123357928 GAACAATTATATGCTACTACTGG + Intronic
996814596 5:127560775-127560797 GAATAATTGTTGACTGCTAATGG + Intergenic
996996919 5:129707947-129707969 TAAGAATCATTGACTGCTATTGG + Intronic
1000293194 5:159890296-159890318 GGAAAATTCTTGGCTGCTATTGG - Intergenic
1006015778 6:31079492-31079514 AAAGAATTATTGGCTGTAACAGG + Intergenic
1008750224 6:54724154-54724176 GAAGAATAATTTGATGCAACAGG - Intergenic
1008814568 6:55550117-55550139 GATGAATTATTGAGTGCTAAAGG + Intronic
1009519954 6:64669003-64669025 GAAGAAATATTGGAAGGTACAGG - Intronic
1009575449 6:65451438-65451460 GAAGAATTATTAGATGCTAAAGG - Intronic
1010396927 6:75403540-75403562 AAAGAAATATTGACTGGTACAGG + Intronic
1012070007 6:94602350-94602372 GAAAAATTATTGGCTGTGATTGG + Intergenic
1012141100 6:95627930-95627952 GAACACTTATTCACTGCTACTGG + Intergenic
1013696892 6:112713628-112713650 GAAGAAGGATTGTCTGCTTCAGG - Intergenic
1018706256 6:166465414-166465436 GAAGACACATGGGCTGCTACTGG + Intronic
1025808733 7:64858654-64858676 GAATAATGATTGCCTGCGACAGG - Intergenic
1028423123 7:90655769-90655791 GCAGAATTATTGGTGGCCACAGG - Intronic
1028446245 7:90927283-90927305 GAAGAATGACTGGTGGCTACAGG - Intronic
1030898653 7:115094137-115094159 GATGAGTTGTTGGCTGCTTCAGG - Intergenic
1031911983 7:127527181-127527203 GAAAAATTATTGGCTGCACTGGG - Intergenic
1034136855 7:148778904-148778926 GAGGAATAATGGGGTGCTACAGG - Intronic
1039683011 8:39763096-39763118 GATAAATTATTGGCTGCCTCTGG - Intronic
1044605283 8:94042526-94042548 GAAGGCTTACAGGCTGCTACTGG + Intergenic
1046785480 8:118261281-118261303 GAAGAATTGTTGGATGCTCTAGG - Intronic
1051960299 9:22752664-22752686 GCCCAATTATTTGCTGCTACGGG - Intergenic
1053115873 9:35501692-35501714 GAACCATGGTTGGCTGCTACTGG - Intronic
1055818450 9:80234116-80234138 TTAGAATAATTGGCTGGTACAGG + Intergenic
1192732378 X:73814037-73814059 GAAGAAAAATTGGCTACTATAGG + Intergenic
1194419310 X:93652731-93652753 TAATAATTAATGACTGCTACTGG + Intergenic
1199411432 X:147528431-147528453 GAAGAATTTTTGGTGACTACTGG - Intergenic
1201696203 Y:16829206-16829228 GCAGAAATAGTGGCTGGTACTGG - Intergenic