ID: 1136464476

View in Genome Browser
Species Human (GRCh38)
Location 16:30432860-30432882
Sequence CACGTGAACCCAGGAGACGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136464476_1136464484 17 Left 1136464476 16:30432860-30432882 CCTCCGTCTCCTGGGTTCACGTG No data
Right 1136464484 16:30432900-30432922 TCCCAAATAGCTGGGATTACAGG 0: 2213
1: 60582
2: 463715
3: 503828
4: 336089
1136464476_1136464480 8 Left 1136464476 16:30432860-30432882 CCTCCGTCTCCTGGGTTCACGTG No data
Right 1136464480 16:30432891-30432913 GCCTCAGCCTCCCAAATAGCTGG 0: 3302
1: 90995
2: 264385
3: 415423
4: 375946
1136464476_1136464482 9 Left 1136464476 16:30432860-30432882 CCTCCGTCTCCTGGGTTCACGTG No data
Right 1136464482 16:30432892-30432914 CCTCAGCCTCCCAAATAGCTGGG 0: 4056
1: 104485
2: 314618
3: 469474
4: 382134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136464476 Original CRISPR CACGTGAACCCAGGAGACGG AGG (reversed) Intergenic
No off target data available for this crispr