ID: 1136469796

View in Genome Browser
Species Human (GRCh38)
Location 16:30472636-30472658
Sequence TGCAGGAGTTGTGAAACCGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 60
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 56}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136469796 Original CRISPR TGCAGGAGTTGTGAAACCGC AGG (reversed) Exonic
901055580 1:6447426-6447448 TGCAGGAAATGCGACACCGCAGG - Intronic
904761400 1:32807149-32807171 TGCAGGAGTGGTGAGAATGCAGG - Intronic
906606827 1:47178766-47178788 TGGTGGAGTTCTGAAACAGCTGG - Intergenic
924708057 1:246513884-246513906 TGCAGGAGGTGGGCTACCGCAGG - Intergenic
1072628869 10:97132118-97132140 TGCAGGAGTTTGGACACCCCAGG - Intronic
1073805440 10:107092759-107092781 TGCAGGACTTGAGAAACAGAAGG + Intronic
1076130190 10:128008625-128008647 TGCAGGAGTTGAGAAAGACCAGG - Intronic
1078378037 11:10812937-10812959 TAAAGTAGTTGTGAAACAGCTGG - Intronic
1089976564 11:122737300-122737322 TGCCGGAGTTGTCAAAGCGAGGG + Intronic
1091415093 12:275944-275966 TGCAGGGCTTGTTAAAACGCAGG + Intergenic
1103778437 12:123383665-123383687 TGCTGGAGTTGCTAAACTGCTGG + Intergenic
1115328323 14:32166922-32166944 TGCATGAGTTCAGAAACCTCGGG + Intergenic
1120269865 14:82297599-82297621 TTCAGGAGTTGGGAATCCTCGGG + Intergenic
1121052192 14:90826783-90826805 TGCAAGAGTTTTGAAAACCCAGG - Intergenic
1123059595 14:105588513-105588535 TGCAGGAGCTGTGTAACCTTGGG - Intergenic
1130331420 15:82925226-82925248 TGCAGGGGCTGTGAAACCTTGGG - Intronic
1133820936 16:9235945-9235967 TGCAGGAGTAGTGAAAAAGAGGG + Intergenic
1136469796 16:30472636-30472658 TGCAGGAGTTGTGAAACCGCAGG - Exonic
1151882868 17:76905358-76905380 TGCAGGAGCTGAGAAAGCTCAGG + Intronic
929819829 2:45264148-45264170 TGCAGGGGTTGTGAAACCCAGGG + Intergenic
932569299 2:72929661-72929683 TGCAGGAGTGGTGAAAAAGAAGG + Intronic
932781317 2:74560379-74560401 TGGAGGAAGTGTGAAACCCCAGG + Intronic
935144012 2:100381670-100381692 TGCTGGAATTGTGAAACATCAGG + Intergenic
936001132 2:108831624-108831646 TGCAGGACTTGTTAAAACTCAGG + Intronic
944665503 2:201955844-201955866 CTCAGGAGTTGGGAAACCTCTGG - Intergenic
947043322 2:225949297-225949319 TGCAGGGGTTGTGGGACCCCAGG - Intergenic
948198664 2:236113763-236113785 TGCAGGAGCCGTGAACCCTCTGG - Intronic
1170028733 20:11921402-11921424 TGCTGTAGTTGTGAAAGCGGTGG + Intronic
1172823419 20:37759005-37759027 TGAAGGGGTTGTGAACCCACTGG + Intronic
1178086987 21:29122138-29122160 TGCAGGATTTGTGAAAGGGGTGG + Intronic
1181616964 22:24061465-24061487 TGGGGCAGTTGTGAAACAGCAGG + Intronic
1182451083 22:30422281-30422303 TGTAGGTGTTGTCAAACCGCAGG - Exonic
1182467228 22:30525083-30525105 TGTAGGTGTTGTAAAACCTCAGG + Exonic
1184203349 22:42984572-42984594 AGCAGGTGTTGTCAACCCGCTGG - Intronic
953447066 3:42977440-42977462 TGCAGGAGATTTGAAGCCTCTGG + Intronic
955879439 3:63528005-63528027 AGCAGGAGTTTTGGAACCACTGG - Intronic
958910590 3:99989549-99989571 TGCAAGAGCAGTGAAACTGCAGG - Intronic
970026070 4:11625380-11625402 AGCAGGAATTGTGAAAGTGCAGG + Intergenic
970077868 4:12245306-12245328 AACAGGAGTTGTGAAACTGAAGG + Intergenic
977172488 4:93780477-93780499 TGCATGGGTTGGGAAACCACTGG + Intergenic
977800529 4:101224835-101224857 TGAAGGAGGTGAGAAACCACTGG - Intronic
979684949 4:123501631-123501653 TACAGGAGCTGTCAAACCTCTGG + Intergenic
989432366 5:41370837-41370859 TGAATGAATTGTGAAACCTCGGG + Intronic
1000485231 5:161833490-161833512 TCCAGCAGTTATGAAACTGCAGG - Intergenic
1014469876 6:121800899-121800921 TGCAGGACTTGGGAAGCCTCAGG - Intergenic
1019262678 7:90393-90415 CCCAGGAGTTGTGAAACTCCAGG + Intergenic
1021311232 7:19100712-19100734 TGGAGCAGTTGTGACACAGCAGG - Intronic
1023674820 7:42618171-42618193 TGCAGGAGGTCTGAAGCCACTGG + Intergenic
1030691419 7:112538965-112538987 TGTAGGAGCTGTGAAACTTCTGG + Intergenic
1030857749 7:114582337-114582359 TTCAGGTGTTGTGACACTGCGGG - Intronic
1034275368 7:149821610-149821632 TGCAGGAGCTGGGAAAGAGCCGG - Intergenic
1037134959 8:15449543-15449565 TGGAGGACTTTTGAAACTGCTGG + Intronic
1040333958 8:46406703-46406725 TGGAGAAGTGGTGAGACCGCAGG + Intergenic
1046582929 8:116115138-116115160 TGCTGGAGTTTGGAAACTGCTGG + Intergenic
1047293770 8:123552929-123552951 TGCAGGAATTGAGAAAGCTCTGG - Intergenic
1050491992 9:6197901-6197923 TGCAGGTGTGGTGACACCACAGG + Intergenic
1058146952 9:101423026-101423048 TGGAGGGATTGTGAAAGCGCAGG - Intronic
1059573722 9:115468090-115468112 TGCAGGACTTGTGAAAGGGGTGG + Intergenic
1062115695 9:134806918-134806940 TGCAGGCTTTGTGAAGCCTCGGG + Intronic
1198545157 X:137684583-137684605 TACAGGAGTTGAGAAACAGCTGG - Intergenic