ID: 1136471208

View in Genome Browser
Species Human (GRCh38)
Location 16:30481801-30481823
Sequence GTGCACAGTCTGTAATCCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 109}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136471205_1136471208 -2 Left 1136471205 16:30481780-30481802 CCAAGAGAAAGTCTAAGCCAGGT 0: 1
1: 0
2: 2
3: 17
4: 144
Right 1136471208 16:30481801-30481823 GTGCACAGTCTGTAATCCCAGGG 0: 1
1: 0
2: 0
3: 5
4: 109

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136471208 Original CRISPR GTGCACAGTCTGTAATCCCA GGG Intronic
901941874 1:12668468-12668490 GTCCTCAGTCTATAATCACAAGG - Intergenic
903162319 1:21497930-21497952 GTGCAGTGTCAGGAATCCCAGGG - Intergenic
904552849 1:31335139-31335161 GTGCTCAGTTTATACTCCCAGGG + Intronic
906949682 1:50324052-50324074 ATGCACAGTCTCTGATCTCAAGG + Intergenic
908190678 1:61700531-61700553 GTGCATAGTTTCTAATCCCAGGG + Intronic
920977239 1:210797620-210797642 GTGCACCGTCTGGAACTCCATGG + Exonic
924103585 1:240628820-240628842 ATGCACACTCTGATATCCCAAGG + Intergenic
1074965249 10:118485406-118485428 GCACACAGTGTGTAATCACAGGG + Intergenic
1078555950 11:12326276-12326298 GTGCAAAGTCTGTTCTGCCAAGG + Intronic
1084490715 11:69476729-69476751 GTGCACAGGCTGTAATCAGCGGG - Intergenic
1085619410 11:78026494-78026516 TGGCTCAGTCTATAATCCCAAGG + Intronic
1086803158 11:91202626-91202648 GTGCACAGTCAACAATACCAGGG + Intergenic
1086887468 11:92222704-92222726 GTAAACAGTCTCTACTCCCAGGG - Intergenic
1087171543 11:95054275-95054297 GTGCATGGTGTGTACTCCCAAGG - Intergenic
1088031167 11:105252538-105252560 GCACACAAACTGTAATCCCATGG + Intergenic
1088881600 11:113977333-113977355 GTGCACAATTTCTAAGCCCAAGG - Intronic
1089647794 11:119891701-119891723 GTGCCCTGGCTGTACTCCCATGG + Intergenic
1089997720 11:122924820-122924842 GTGCACAGACTTGAGTCCCATGG + Intronic
1091058697 11:132442141-132442163 TTGCATAGTCTGCAATCTCATGG + Intronic
1092515303 12:9205325-9205347 CTCCACACTCTGAAATCCCATGG + Intronic
1092810577 12:12267850-12267872 GTGCACAGTCTGAGATTCTAGGG - Intergenic
1093592413 12:20918458-20918480 GTTCTCAGACTGTAATCCTAAGG + Intergenic
1097618262 12:61909044-61909066 GATGACAGTTTGTAATCCCATGG + Intronic
1097794212 12:63844571-63844593 GAGCTCCGTCGGTAATCCCAGGG - Exonic
1101280639 12:103251501-103251523 GTGCTGAGTCTGTAACCCAAGGG + Intronic
1110801880 13:79707687-79707709 GTCCATAGTGTGTAACCCCAGGG - Intergenic
1111315350 13:86550250-86550272 TTCCACACTCTGTAATCGCAGGG - Intergenic
1111402271 13:87754980-87755002 ATGCACAGTCTATCATTCCATGG - Intergenic
1113553270 13:111209938-111209960 GTGCAAAGACTGTGATCCAAGGG - Exonic
1114715724 14:24821928-24821950 TTGCTCAAACTGTAATCCCAGGG + Intronic
1120141393 14:80933385-80933407 GGGCACTGTCTGTCAGCCCAGGG + Intronic
1121557694 14:94850794-94850816 CTGCAGAGTCTGTAATAACAGGG + Intergenic
1121753640 14:96382250-96382272 GGAAACAGACTGTAATCCCATGG + Exonic
1122249049 14:100425261-100425283 GTGCACATCCTGTCACCCCATGG + Intronic
1125510544 15:40290319-40290341 GTGGACAGGCTACAATCCCAAGG + Intronic
1126222161 15:46226420-46226442 GTTCTCTGTCTCTAATCCCATGG + Intergenic
1126485327 15:49174000-49174022 CGGCTCAGCCTGTAATCCCAGGG - Intronic
1130787222 15:87113796-87113818 GTGCATAGTCTGTAAAACTAAGG + Intergenic
1133640662 16:7714179-7714201 GTGCACGTTCTGGAATCCTAGGG - Intergenic
1136084265 16:27873485-27873507 GTGCCCAGTCTGAAATCCTTGGG - Intronic
1136471208 16:30481801-30481823 GTGCACAGTCTGTAATCCCAGGG + Intronic
1144575625 17:16427775-16427797 GAGCAGAGTCTGTACTGCCAAGG - Intronic
1146545654 17:33735728-33735750 GAGCACAGTGAGTGATCCCAGGG - Intronic
1147654768 17:42082562-42082584 GTACACTGTCTGCCATCCCAGGG - Intergenic
1150267680 17:63841910-63841932 GTGCACAAGCTGGAATCCCCTGG + Intronic
1150642244 17:66957455-66957477 ATGCAGAGTCAGTAAGCCCAGGG - Intergenic
1151144034 17:72022512-72022534 GGGGACACTCTGAAATCCCAGGG + Intergenic
1152185027 17:78850534-78850556 GTGCAGAATCTGTTATTCCAGGG - Intergenic
1152205440 17:78972173-78972195 GGGCACAGTGTGGAATTCCAGGG + Exonic
1152491509 17:80637754-80637776 GTGGAAATTCTGTCATCCCAAGG + Intronic
1158406981 18:57168458-57168480 GTGCACAGTCAGAAGTGCCAAGG - Intergenic
1163702799 19:18794757-18794779 GTGCAGTGGCTGAAATCCCAGGG - Intergenic
1163811652 19:19436351-19436373 CTGCACAGTGTGCGATCCCAGGG - Intronic
1163958759 19:20667522-20667544 TTGCACAGGCTGTAATTCAATGG + Intronic
1164272429 19:23685043-23685065 GTGCCCAGGCTGGAATCCAATGG + Intronic
1165954411 19:39493160-39493182 GTGCACTGTCTGTAAGCCGGTGG + Intronic
1165977106 19:39685759-39685781 GTGAACAGTCTGTAAGCCAGTGG - Intergenic
1167360543 19:49028218-49028240 GTGCACAACCTGGAATCCTAGGG + Intronic
1167363105 19:49040582-49040604 GTGCACAACCTGGAATCCTAGGG - Intergenic
927145368 2:20162101-20162123 GTCCACACTCTGTAAGCCAAAGG - Intergenic
927153291 2:20207888-20207910 GTGCCCACTCTGTGATCCCCCGG - Intronic
927274150 2:21247336-21247358 CTGCACATTGAGTAATCCCATGG + Intergenic
927919544 2:26961457-26961479 CAGAACAGTCTTTAATCCCATGG - Intergenic
933011587 2:77070998-77071020 ATGCACAGGTAGTAATCCCAAGG - Intronic
939769269 2:146294793-146294815 GGTCACAGGGTGTAATCCCAGGG + Intergenic
942600154 2:177632845-177632867 GGGCACAGTCTTTTACCCCATGG + Intronic
943065739 2:183084293-183084315 GTAGACAGCCTGTAATCCCAAGG + Intronic
944895890 2:204164335-204164357 GTGTACAGTCTGTTCTCACATGG + Intergenic
948144403 2:235697538-235697560 GAGCACAGTCTGTGAAGCCAAGG - Intronic
1169424999 20:5489387-5489409 GTGCACAGTCTATCATCAAATGG - Intergenic
1175694146 20:61088690-61088712 GGTCACAGTCTGTATCCCCAGGG + Intergenic
1179481277 21:41680227-41680249 GTGCCCATTCTGTGATCACAGGG - Intergenic
1184050681 22:42001777-42001799 CTGCATGGTCTGTATTCCCAAGG - Intronic
1184527838 22:45035997-45036019 ATGCACAGTGTGAAGTCCCATGG - Intergenic
949772485 3:7594316-7594338 TTGCATAGTGTGTAATGCCAGGG + Intronic
950052696 3:10004362-10004384 GTTCTCAGCCTGGAATCCCATGG - Intronic
950304451 3:11907406-11907428 GTTCTCAGCCTGGAATCCCATGG - Intergenic
950414006 3:12858008-12858030 GTTCTCGGTCTGGAATCCCATGG - Intronic
950414886 3:12863460-12863482 GTTCTCAGCCTGGAATCCCATGG - Intronic
953669888 3:44953562-44953584 GTGCACGGGCTTTGATCCCATGG - Intronic
955494165 3:59513786-59513808 GTGCACAGGGTTTAATCCAATGG - Intergenic
958018741 3:87972128-87972150 GGGCACAGACTTTAATCCCTGGG - Intergenic
962643272 3:137410657-137410679 GGACACAGACTGTGATCCCATGG + Intergenic
965700135 3:171452285-171452307 GTGCACAGTTTGCAATCTCTTGG + Intronic
966587366 3:181642242-181642264 ATGTACAGTAGGTAATCCCATGG + Intergenic
966967634 3:185010957-185010979 GTGCCCAGGCTGGAGTCCCATGG - Intronic
970895120 4:21093522-21093544 TTTCACAGTTTGTAATCCCAGGG + Intronic
977477969 4:97537385-97537407 TTGCACAGGATATAATCCCATGG - Intronic
978698207 4:111608933-111608955 GTACAGAGTTTGTAATCCCTGGG - Intergenic
980761343 4:137238365-137238387 GTTCACATTCTTTTATCCCATGG + Intergenic
981971241 4:150664658-150664680 GTGCACATTATATAATTCCAAGG + Intronic
991468071 5:66935965-66935987 GCGCCCAGTCTTTAATCCTAAGG + Intronic
993014170 5:82516973-82516995 GTCTCCAGTCTGTACTCCCAGGG - Intergenic
995200375 5:109418666-109418688 CTGCAAAGTCTGTAACTCCAGGG - Intergenic
995904591 5:117108080-117108102 TTGCACAGTCTGTGGTCACAAGG + Intergenic
998645923 5:144061976-144061998 GTTCCCAGTCTGTAATTCCCAGG - Intergenic
1002954735 6:1851030-1851052 GTTTATAGTCTGTTATCCCAGGG - Intronic
1007265251 6:40590853-40590875 GGGTGCAGTCTGTAATCCCAGGG + Intergenic
1007649216 6:43407501-43407523 TTGAACAGTCTGTGCTCCCAAGG - Intergenic
1015508017 6:134009154-134009176 GTGCTCAGTCTGAACTGCCAGGG + Intronic
1015960129 6:138639990-138640012 TTGCACAGACTATAATCTCATGG + Intronic
1024999927 7:55307299-55307321 GTGCTGAGCCTGTAATCCCAAGG - Intergenic
1025149916 7:56539882-56539904 GAGCTCAGTCTGTAGTGCCAGGG + Intergenic
1030965473 7:115988605-115988627 GTGCACAGTGGGAAAACCCAAGG + Intronic
1037453178 8:19037364-19037386 TGACACAGTCTGGAATCCCAGGG - Intronic
1041994311 8:64035040-64035062 CTGCTCAGTCTGTCATCCCCAGG + Intergenic
1042766549 8:72328563-72328585 AGGCACAGGCTGTAATCCCCTGG - Intergenic
1045228488 8:100275985-100276007 GTTCTCAGTCTTTAATCCGAAGG - Intronic
1050299327 9:4241139-4241161 GTGCACACTCTGAAATCTAAAGG + Intronic
1050355799 9:4781657-4781679 GTCCACAGCCTGTCATCTCATGG + Intergenic
1050971677 9:11884569-11884591 GAGCACAGTCTGTTGTCGCAAGG - Intergenic
1052437825 9:28452243-28452265 GTGCACAGTCCCTGATCTCAAGG + Intronic
1059296258 9:113273861-113273883 TTCCACAGCCTGAAATCCCAAGG + Intronic
1060480754 9:124015669-124015691 ACGCACAGTCTGGAAGCCCAGGG - Intronic
1199193962 X:145004979-145005001 GTGCTCAGTCTGTGTTACCATGG - Intergenic