ID: 1136472479

View in Genome Browser
Species Human (GRCh38)
Location 16:30490509-30490531
Sequence GTGAAGAGGCAGGAGGAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 930
Summary {0: 1, 1: 0, 2: 9, 3: 76, 4: 844}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136472479_1136472484 10 Left 1136472479 16:30490509-30490531 CCTGGCTCCTCCTGCCTCTTCAC 0: 1
1: 0
2: 9
3: 76
4: 844
Right 1136472484 16:30490542-30490564 TTTCCCTCTCTGGCCCTGCATGG 0: 1
1: 0
2: 4
3: 46
4: 521
1136472479_1136472483 0 Left 1136472479 16:30490509-30490531 CCTGGCTCCTCCTGCCTCTTCAC 0: 1
1: 0
2: 9
3: 76
4: 844
Right 1136472483 16:30490532-30490554 TAATGTAGTGTTTCCCTCTCTGG 0: 1
1: 0
2: 2
3: 12
4: 157

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136472479 Original CRISPR GTGAAGAGGCAGGAGGAGCC AGG (reversed) Intronic
900093900 1:932630-932652 CTGCAGAGGCAGAAGGACCCAGG - Intronic
900143532 1:1148409-1148431 GAAAAGATACAGGAGGAGCCTGG + Intergenic
900164555 1:1239545-1239567 CTGAGGGGGCAGCAGGAGCCAGG - Intergenic
900227703 1:1540650-1540672 GGGAGGAGGGAGGAGGAGGCAGG - Intergenic
900394382 1:2447167-2447189 GTGAGGCTCCAGGAGGAGCCAGG + Intronic
900488653 1:2935498-2935520 GGGAAGGGGCAGGATGAGCAGGG - Intergenic
900676538 1:3890690-3890712 GTGCAGAAGCAGAATGAGCCAGG - Exonic
900913609 1:5619270-5619292 GTGAAGAGGAAGGCTGAGCCTGG - Intergenic
901056416 1:6450521-6450543 GGGAAGAGGCAGGAAAAGCAAGG + Intronic
901216065 1:7556045-7556067 ATCAAGAGGCAGAGGGAGCCGGG + Intronic
901234587 1:7661157-7661179 GTGCAGATGCAGGAGAGGCCAGG - Intronic
901453970 1:9352844-9352866 GGGAAGAGTGAGGAGGAGGCTGG - Intronic
901604700 1:10450043-10450065 GGGAAGAGGGAAGAGGATCCAGG + Exonic
901661815 1:10803288-10803310 GTGAAGGGGTAGGAGGAGGTGGG - Intergenic
901727369 1:11252627-11252649 GTGCAGAAGCAGGAGGAGTCTGG - Intronic
901773416 1:11542917-11542939 GAGAAGAGGCAGGAGGAGGATGG - Intergenic
901878132 1:12178731-12178753 GAGAAGGGGGCGGAGGAGCCAGG + Intronic
902477933 1:16697964-16697986 GGGAAGAGGCAGGAAAAGCACGG - Intergenic
902657599 1:17880124-17880146 GGGAATAGGCAGGAAGAGGCTGG - Intergenic
902673651 1:17993381-17993403 GGGAGGAGGCAGGAGGAGAGTGG + Intergenic
902733446 1:18384606-18384628 GAGGAGGGGAAGGAGGAGCCTGG + Intergenic
902819721 1:18936483-18936505 GTCAAGAGGCAGGAGGCCCAGGG + Intronic
902836664 1:19051844-19051866 GGGAAGGGGCAGAATGAGCCTGG - Intergenic
903510255 1:23869276-23869298 GTGGAGAGCCAAGAGGACCCAGG + Intergenic
903742428 1:25565949-25565971 AGGAAGAGGAAGGAGGAGGCAGG - Intronic
903989200 1:27253438-27253460 GAGAAGAGGAAGGAGGAGGAAGG - Intronic
904030941 1:27533099-27533121 TGGAAGAGGCAGGAGGACTCAGG - Intergenic
904473277 1:30748733-30748755 GTGAAGAGGAGAGAGAAGCCAGG - Intronic
904497647 1:30896073-30896095 GAGAAGAGGAAAGTGGAGCCTGG - Intronic
904633827 1:31864213-31864235 GTCAAGAGGCAGAAGGAGCAGGG + Intergenic
904924879 1:34039636-34039658 GTGACAAGGCAGAAGGAGCCTGG + Intronic
905233702 1:36530861-36530883 GTGAGGAGGCAGCAGCAGGCTGG + Intergenic
905256265 1:36687475-36687497 GTGAAGAGGAAGGTGGAGATTGG + Intergenic
905443649 1:38010370-38010392 GGGAAGAGGCAGGAGTGGCTGGG + Intronic
905733728 1:40312649-40312671 GTAGAGAGGAAGTAGGAGCCGGG - Intronic
905776944 1:40674396-40674418 GTCTAGAGGCTGGAGGGGCCAGG - Intergenic
905881839 1:41468908-41468930 GGGAAGAGGAGGGAGGAGCCAGG - Intergenic
906066510 1:42984849-42984871 GGGAAGAAGGAGGAGGAGCGGGG + Intergenic
906078753 1:43069979-43070001 GAGAAGGGGTGGGAGGAGCCTGG - Intergenic
906088386 1:43156149-43156171 GTGAGGATGCAGGAGGACCTGGG - Intronic
906103701 1:43279254-43279276 GGGCAGAGGCAGGCGGGGCCAGG + Intergenic
906320678 1:44813553-44813575 GGGAGGGGGCAGGAGCAGCCCGG + Intronic
906327051 1:44853211-44853233 TGGAAGGGGCAGGGGGAGCCAGG + Intronic
907300539 1:53483949-53483971 GAGCAGGGGCAGGAGGGGCCTGG + Intergenic
907599439 1:55751881-55751903 AGGAACAGGCTGGAGGAGCCAGG - Intergenic
908407402 1:63828836-63828858 GTGCTGAAGCAGGAGTAGCCTGG - Intronic
908510774 1:64848468-64848490 GTGAAGATGAAGGTGGAGCCTGG + Intronic
908858515 1:68456069-68456091 GTGGAGAGACAAGAGGAGCAGGG - Intergenic
909457371 1:75865514-75865536 GTCGAGAGGCAGAAGGAGCAAGG + Intronic
909723586 1:78807067-78807089 GTGAGGAGGCAGGAGGGGGGTGG + Intergenic
911982809 1:104587055-104587077 GTCAAGAGGCAGGGGGATCAGGG - Intergenic
912260823 1:108110503-108110525 GTGAAGATGGAGCAGGAGCAAGG + Intergenic
912950001 1:114113992-114114014 GTCATGGGGCAGGAAGAGCCTGG - Intronic
913070577 1:115294824-115294846 CTGGAGAGCCAGGAAGAGCCAGG + Intronic
913122926 1:115758348-115758370 GAGAAGAGGAAGGAGGAGAAGGG - Intronic
913961326 1:143339920-143339942 GTGCAGAGGCAGCAGGTGGCAGG + Intergenic
914055679 1:144165493-144165515 GTGCAGAGGCAGCAGGTGGCAGG + Intergenic
914123467 1:144800869-144800891 GTGCAGAGGCAGCAGGTGGCAGG - Intergenic
914889832 1:151612547-151612569 GTGCAGGGGCAGGAGGGGCGCGG - Intronic
915073975 1:153294008-153294030 GTGATGAGCAGGGAGGAGCCAGG - Intergenic
915226602 1:154416530-154416552 ATGATGAGGGAGGAGGAGCTGGG + Intronic
915903621 1:159862967-159862989 GGGAAGAGGAAGGAGAAGCCAGG + Intronic
915953432 1:160205263-160205285 ATGGAGAGGCAGGAGGGGGCGGG - Intergenic
916245344 1:162682104-162682126 GGAAAGAGGTGGGAGGAGCCCGG - Intronic
917447806 1:175121409-175121431 GAGATGAGGCGGGAGGAGCAGGG + Intronic
918044726 1:180935089-180935111 ATGAAGAGACAGGAGGAGAGAGG - Intronic
918448930 1:184640812-184640834 GTGAGGCAGAAGGAGGAGCCAGG - Intergenic
919842988 1:201622941-201622963 GGGAAGAGGCACGAGGCACCGGG - Intronic
919911468 1:202113487-202113509 GGGGTGAGGCTGGAGGAGCCTGG - Intergenic
920004927 1:202826090-202826112 GAGAAGGGGCAGGTGGAGCTGGG + Exonic
920279761 1:204834138-204834160 GAGAATAGGCAGGATGAGGCAGG - Intronic
920416482 1:205802129-205802151 TTGGAGAGGGAGGAGGAGGCAGG + Intronic
920452847 1:206073131-206073153 GTAAAGACACAGGAGGAGCCAGG - Intronic
920649539 1:207826418-207826440 ATGAGGAGGCTGGAGGAGGCAGG + Intergenic
921214556 1:212925960-212925982 GGGAAGAGGCAGGAAGAGAAAGG + Intergenic
922157805 1:223053617-223053639 GTGATGTGGGAGGTGGAGCCTGG + Intergenic
922630266 1:227100271-227100293 GTGAAGTGGGAGGAGCAGGCTGG - Intronic
922754652 1:228089011-228089033 GAGAACACGCAGGAGGAGGCTGG + Intronic
922793253 1:228322256-228322278 GTGCAGAGGCAGGGAGAGGCAGG + Intronic
922890714 1:229059724-229059746 GGCCAGAGACAGGAGGAGCCAGG + Intergenic
923146581 1:231202791-231202813 GCTGAGAAGCAGGAGGAGCCTGG + Intronic
923404054 1:233643103-233643125 GTGATGAGGAAGGAGGAGTCAGG + Intronic
923687024 1:236160528-236160550 GTGGACAGACAGAAGGAGCCTGG - Intronic
924539642 1:244969887-244969909 GGGAAGCGGGAGGAGGAGGCCGG + Exonic
924878981 1:248137154-248137176 GTGCTGAGGCGGGAGGAGACTGG - Intergenic
1063218115 10:3942371-3942393 GTGGAGAGGCAGCAGCAGGCTGG - Intergenic
1063390992 10:5649822-5649844 CTTAAGAGGCAGGAGAGGCCGGG - Intronic
1063499309 10:6538541-6538563 TTCTAAAGGCAGGAGGAGCCAGG - Intronic
1064040793 10:11961505-11961527 GGGAAGAGGAGGGAGGGGCCGGG + Intronic
1064102766 10:12477594-12477616 GTGAAGGGGCTGGAAGAGACAGG + Intronic
1064342497 10:14499712-14499734 GTCAGGAGCCATGAGGAGCCTGG - Intergenic
1065894000 10:30145414-30145436 GGGAAGAGGCAGTGGGAGGCAGG + Intergenic
1065980189 10:30887282-30887304 GTCAGGAGGCAGAAGGAGCCAGG - Intronic
1066004569 10:31134383-31134405 CTGAAGAGGCAGCTGGAGCGCGG - Intergenic
1066279982 10:33906901-33906923 GGGAAGAGGAAGGAGGACTCTGG - Intergenic
1066439648 10:35426075-35426097 GTGAAGGGAGAAGAGGAGCCAGG - Intronic
1067029777 10:42872318-42872340 GTGCAGAGGCAGCAGGCGGCAGG + Intergenic
1067421940 10:46159517-46159539 GTCAAGAGTGGGGAGGAGCCAGG + Intergenic
1067507247 10:46865606-46865628 GTCAAGAGTGGGGAGGAGCCAGG + Intergenic
1068088228 10:52401064-52401086 GTATAGAGGCAGGAGGTGACAGG - Intergenic
1068348376 10:55813438-55813460 GTCAAGAGTGGGGAGGAGCCAGG - Intergenic
1068617265 10:59132828-59132850 GGGTAGAGGCTGGAGGAGGCAGG + Intergenic
1068652987 10:59543000-59543022 GTGAAGATGGAGGTGGAGACTGG - Intergenic
1069725422 10:70574481-70574503 GTGCAGAGGCAGAATGAACCTGG + Intergenic
1069874854 10:71555564-71555586 GAGAAGATGCAGGGGGAGCCTGG + Intronic
1070228390 10:74536664-74536686 GTGAGGAGGAAGGAGGAAACAGG - Intronic
1070736516 10:78867028-78867050 GTCCTGAGGCAGCAGGAGCCTGG - Intergenic
1071294806 10:84211787-84211809 TGGCAGAGGCAGGAGGGGCCTGG + Intronic
1071363317 10:84873409-84873431 GTGCACATGCAAGAGGAGCCAGG + Intergenic
1071411500 10:85401448-85401470 GAGAAGCTGAAGGAGGAGCCAGG + Intergenic
1072711554 10:97718788-97718810 GGGCACAGGGAGGAGGAGCCTGG - Intergenic
1072736057 10:97880447-97880469 GTGTATAGGCAGGCAGAGCCTGG - Intronic
1072753254 10:97999452-97999474 GGGAAGAGGCAGCAGGCGGCTGG - Intronic
1072893830 10:99348639-99348661 GTGAAGACGGAGGAAGAGCAGGG + Intronic
1072940491 10:99759543-99759565 GAGAAGGGGGAGGAGGTGCCAGG + Intergenic
1073131032 10:101189518-101189540 GGGGAAAGGCAGGAGGTGCCTGG - Intergenic
1073424813 10:103449971-103449993 GAGAGGAGGCAGGAGGAGACGGG + Exonic
1073471143 10:103723145-103723167 GGGGAGAGGCAGGGGGAACCTGG - Intronic
1073483369 10:103800987-103801009 GTGAAGAGGCGGGAGGATGGTGG - Intronic
1073643409 10:105275683-105275705 GTGAAGATGGAGGTGGAGACTGG - Intergenic
1073779099 10:106817412-106817434 GTGGGGAAGCAGGAGGGGCCTGG - Intronic
1073859167 10:107717593-107717615 GGGAAGGGGCAGGACGAGACAGG + Intergenic
1074292491 10:112148920-112148942 CTGAAGGGGCAAGAGAAGCCAGG + Intergenic
1074510825 10:114110427-114110449 GTGGACATGCAGTAGGAGCCTGG + Intergenic
1074532047 10:114304943-114304965 GTGCAGATGCAGGAGGGGACAGG + Intronic
1074776621 10:116772034-116772056 GGGCAGAGGCAGGACGAGGCTGG + Intergenic
1074971492 10:118542967-118542989 CTGATGTGGCAGGAGGAGCTTGG + Intergenic
1075884992 10:125892175-125892197 GAGATGAGGAAGGAGAAGCCAGG - Intronic
1075930011 10:126287973-126287995 GGGTACAGGCAGGAGGAGTCGGG + Intronic
1076121392 10:127939748-127939770 AAGGAGAGGCAGGAGGAGGCAGG + Intronic
1076329597 10:129654655-129654677 CTGGAGAGACAGGAGGAGGCAGG + Intronic
1076392284 10:130111686-130111708 GTGCTAAGGCAGGAGGGGCCTGG - Intergenic
1076444336 10:130501587-130501609 GTGAAGATGGAGGCAGAGCCTGG - Intergenic
1076677287 10:132153649-132153671 GAGAAGAGGAAGGAAGACCCAGG + Intronic
1076736125 10:132459893-132459915 TTCAACAGGCAGGAGGGGCCAGG - Intergenic
1077020202 11:413919-413941 GAGAAGGTGCAGGAGGAGGCAGG - Intronic
1077059841 11:613271-613293 GTGGAGGGGCTGGCGGAGCCTGG + Exonic
1077104180 11:834846-834868 GCGTGGAGGCAGGTGGAGCCTGG - Intronic
1077143727 11:1035809-1035831 TTGGAGAGGAAGGAGGAGCACGG + Intronic
1077323949 11:1955496-1955518 GAGAAGAGGGAGGAGGAGTGAGG - Intronic
1077366688 11:2164098-2164120 GTGCAGGGGCAGTGGGAGCCTGG + Exonic
1077390452 11:2298601-2298623 GGGCAGAGGCAGGAGATGCCTGG - Intronic
1077498850 11:2899892-2899914 ATGAAGCGGCAGGAGGAGATGGG - Intronic
1077535923 11:3124022-3124044 ACGCAGAGGCGGGAGGAGCCAGG + Intronic
1077672231 11:4167111-4167133 GGGAAGATGCAGGTGGAGACTGG - Intergenic
1077888842 11:6404807-6404829 GGGTGGAGGCAGGAGGGGCCGGG - Intronic
1077996419 11:7456301-7456323 GTCAGGAGGCAGGAGGGGGCTGG + Intronic
1078443397 11:11385952-11385974 GTGAAGAGGAAGGCAGAGACTGG + Intronic
1078633575 11:13028495-13028517 GTGCAGAGGGAGGAGGAGGGAGG + Intergenic
1078640540 11:13091596-13091618 CTGAAGAGGCAGGAATAGGCAGG - Intergenic
1078908770 11:15711737-15711759 ATTTAGAGGCAGGAGGAGCAAGG - Intergenic
1078912884 11:15749801-15749823 GTCAAGAGGCAGTGGGAGTCGGG + Intergenic
1079094911 11:17503968-17503990 GTGAGGAGGCTGGAGAAGCCTGG + Intronic
1080401614 11:31941612-31941634 GTCAAGAGGCAGAGGGAGCAAGG + Intronic
1080774121 11:35369993-35370015 GTGAAGAGGGAGGATGATTCAGG + Intronic
1081194106 11:40140243-40140265 ATGAGGAGGCAGCAGGAGGCAGG - Intronic
1081455826 11:43221721-43221743 GTCAAGAGAGAAGAGGAGCCAGG + Intergenic
1081889910 11:46532161-46532183 ATGAAGAGGCAAGAGATGCCTGG + Intronic
1083890507 11:65593425-65593447 GGGAAGGGGGAAGAGGAGCCTGG - Intronic
1083932331 11:65852839-65852861 GGGAAGAGGCATGGGGATCCGGG - Intronic
1084486774 11:69452852-69452874 GTGGAGAGGTAGAAGGAACCTGG + Intergenic
1084696835 11:70760882-70760904 GAGAAGAGCCAGCAGGAGGCGGG + Intronic
1084726535 11:70945969-70945991 GTGGAGAGGGAGGTAGAGCCTGG - Intronic
1084726545 11:70946005-70946027 GTGGAGAGGGAGGGCGAGCCTGG - Intronic
1084726579 11:70946149-70946171 GTGGAGAGGGAGGTTGAGCCTGG - Intronic
1084726606 11:70946258-70946280 GTGGAGAGGGAGGTTGAGCCTGG - Intronic
1084726648 11:70946439-70946461 GTGGAGAGGGAGGTTGAGCCTGG - Intronic
1084726753 11:70946841-70946863 GTGGAGAGGGAGGATGAGCCTGG - Intronic
1084726762 11:70946877-70946899 GTGGAGAGGGAGGTTGAGCCTGG - Intronic
1084726771 11:70946914-70946936 GTGGAGAGGGAGGGTGAGCCTGG - Intronic
1084726781 11:70946951-70946973 GTGGAGAGGGAGGGTGAGCCTGG - Intronic
1084726802 11:70947023-70947045 GTGCAGAGGGAGGTTGAGCCTGG - Intronic
1085470177 11:76752663-76752685 GAGGAGAGGAAGGAGGAGTCTGG + Intergenic
1087091129 11:94274340-94274362 GAAAAGATGCAGCAGGAGCCAGG - Intergenic
1087427246 11:98006224-98006246 GAGACAAGGCAGGAGGTGCCAGG - Intergenic
1087679364 11:101202346-101202368 GAGTGGAGGCAGAAGGAGCCAGG - Intergenic
1088734599 11:112718441-112718463 GTGAAGAGGCAGAAAAATCCTGG - Intergenic
1088876492 11:113940778-113940800 GTGATGGAGCAGGAGGTGCCGGG - Intronic
1089294076 11:117457652-117457674 GTGGAGAGGGAGGGAGAGCCGGG + Intronic
1089461793 11:118658208-118658230 ATGAAGAGGCAGGGGAAGGCAGG + Exonic
1089466170 11:118687952-118687974 ATGAAGAGGCAGGGGAAGACAGG + Intergenic
1089602575 11:119624526-119624548 ATGAGGAGGCAGGAGGGCCCAGG - Intronic
1089632914 11:119794581-119794603 GGGAAGAGGAACGGGGAGCCGGG + Intergenic
1089871198 11:121673825-121673847 GTGAAAAGGCAAGAGGAGCAAGG + Intergenic
1090071588 11:123549020-123549042 CTGAAGAGGCAGGAAGATGCTGG + Intronic
1090418695 11:126558515-126558537 ATGAAGTGGCTGGAAGAGCCAGG - Intronic
1090713391 11:129408495-129408517 GTGAAGAGACAGGCAGGGCCAGG - Intronic
1090745215 11:129699838-129699860 CAGAAGTGGCAGAAGGAGCCGGG - Intergenic
1202806935 11_KI270721v1_random:10691-10713 GAGAAGAGGGAGGAGGAGTGAGG - Intergenic
1091817997 12:3454135-3454157 GTGAAGAGACAGCAGGGGCTAGG - Intronic
1091857668 12:3752713-3752735 ATGAAGAGGCTGGATGAGGCTGG + Intronic
1092657385 12:10701263-10701285 GTGAAGGTGCCTGAGGAGCCTGG + Exonic
1093125441 12:15322758-15322780 GAGCAGAGGCAGGAGGCGGCGGG - Exonic
1094438218 12:30445288-30445310 GTGAAGAGGCAGCAAGAGGGTGG + Intergenic
1094567356 12:31611733-31611755 GTGAAGAGGGATGTGGAGCGGGG - Intergenic
1095204155 12:39420296-39420318 GTAAAGAGGTAACAGGAGCCAGG + Intronic
1095481456 12:42640409-42640431 GTGAAGAGGCTGGAAGTTCCAGG - Intergenic
1095943649 12:47741399-47741421 GAGAAGAGGGAGGAGGGGCCTGG - Intronic
1096439295 12:51626057-51626079 GTCAGGAGGCAGAAGGAGCGAGG + Intronic
1096473690 12:51895396-51895418 GTGATGAGGGAGGGGGAGGCAGG - Intergenic
1096528695 12:52230078-52230100 GTGGAGAGGAAGCAGGACCCAGG + Intergenic
1096528840 12:52231030-52231052 ATGGAGAGGCAGGAGGAGACTGG + Intergenic
1096675704 12:53224717-53224739 GGGAAGTGGCAGGAGGAGGGAGG - Intronic
1096815619 12:54200095-54200117 GGGAGGAAACAGGAGGAGCCAGG + Intergenic
1096881016 12:54670682-54670704 CTGAGAAGGCAGGAGGAGACAGG - Intergenic
1097179027 12:57160388-57160410 GCCCTGAGGCAGGAGGAGCCGGG - Intronic
1097872124 12:64610465-64610487 GGGAGGCGGCAGGAGGGGCCGGG + Intergenic
1098029482 12:66239466-66239488 GGATAAAGGCAGGAGGAGCCTGG - Intronic
1099051402 12:77785468-77785490 GTGAAGAAGTAGGAGGAGGGAGG + Intergenic
1099334990 12:81344153-81344175 GTCAGGAGGCAGAAGGAGCAGGG - Intronic
1099888126 12:88556668-88556690 GAGAAGAGGCAGCAGGAGTCTGG + Intronic
1101196245 12:102385757-102385779 GTGAAGAGGGAGGCAGAGACTGG - Intergenic
1101373302 12:104149975-104149997 GTGCTGAGGCAGGCTGAGCCTGG + Intergenic
1101782751 12:107850059-107850081 GTGGAGAAGAAGGAGGAGCAGGG - Intergenic
1102230371 12:111257649-111257671 GGGAAGAGGGAGGAGGAGGAAGG - Intronic
1102310060 12:111837695-111837717 GTGAAGACAGAGGAAGAGCCTGG + Intergenic
1102512011 12:113422288-113422310 GTGAAGACGGAGGAGGAGAGGGG - Exonic
1102645826 12:114403265-114403287 CGGAGGAGGCAGGAGGAGGCAGG + Intronic
1102645830 12:114403275-114403297 AGGAGGAGGCAGGAGGAGGCGGG + Intronic
1102650662 12:114439993-114440015 GAGAAGAGCCAGGTGGGGCCTGG - Intergenic
1102720570 12:115012854-115012876 GTGAAGAAGAGGAAGGAGCCAGG - Intergenic
1102762312 12:115398696-115398718 GTTCAGAGGCAGCAGGAGCTGGG - Intergenic
1102908447 12:116694873-116694895 AGGAAGAGGGAGGAGGAGGCAGG + Intergenic
1103205727 12:119127430-119127452 AGGAAAAGGGAGGAGGAGCCAGG + Intronic
1103359762 12:120346638-120346660 GAACGGAGGCAGGAGGAGCCCGG - Intronic
1103628996 12:122244060-122244082 GTGAACGGGCAAGAGGAGGCAGG + Intronic
1104014140 12:124950973-124950995 GTGAAAAGGAAGGAAGTGCCGGG + Intronic
1104034295 12:125087697-125087719 GCAAAGAGGCAGGAGGAGCTGGG + Intronic
1104400660 12:128473335-128473357 GTGAAGATGAAGAAGGAGGCTGG - Intronic
1104756011 12:131269709-131269731 GGGAAGAGGACGGAGGAGGCGGG + Intergenic
1104894813 12:132158927-132158949 GTGAAGAGGAGGGCGGAGGCCGG + Intergenic
1104915833 12:132263999-132264021 CTGAAGAGGCTGGAGGCCCCCGG - Intronic
1106230187 13:27815476-27815498 GTGAAGAGGCTGGATGAGCCAGG - Intergenic
1106708973 13:32311381-32311403 GCTGACAGGCAGGAGGAGCCCGG - Exonic
1107372541 13:39768328-39768350 GTGGAGTGGCAGTAGGGGCCAGG - Intronic
1107660113 13:42630556-42630578 GTGGAGAGGAAGGAGGGGGCAGG - Intergenic
1108268361 13:48734315-48734337 GTGAAGATTCAGGAGAAGACAGG + Intergenic
1109470511 13:62798888-62798910 AGGAGGAGCCAGGAGGAGCCAGG + Intergenic
1110458078 13:75712250-75712272 CTGAAGTGGCAGGTGGAGCAGGG + Intronic
1111969051 13:94891590-94891612 GTGGAAAGGCAGAAAGAGCCTGG - Intergenic
1111986712 13:95073355-95073377 GGTAAGTGGCAGAAGGAGCCAGG - Intronic
1112107635 13:96259204-96259226 GTGCACAGGCTGGAGGACCCGGG + Intronic
1113077427 13:106480864-106480886 GAGATGAGGGAGGAGGAGCCAGG + Intergenic
1113556830 13:111242716-111242738 GTGCAGTGGCAGGAGGACCTGGG + Intronic
1113577277 13:111403471-111403493 GTGACCAGGCTGGGGGAGCCGGG + Intergenic
1113677687 13:112218590-112218612 GTGAAGATGATGGAGGTGCCAGG - Intergenic
1113698267 13:112364339-112364361 AGGTGGAGGCAGGAGGAGCCTGG + Intergenic
1113766882 13:112887519-112887541 CTGAAGGGCCTGGAGGAGCCTGG - Intergenic
1113803810 13:113101807-113101829 GAGCAGAGGCAGGAGGAGGAGGG + Intergenic
1114992592 14:28306039-28306061 GTGAAGAGGCAACAGGTACCTGG - Intergenic
1115114838 14:29867698-29867720 GTACAGAGGCAGAATGAGCCAGG + Intronic
1115505724 14:34092591-34092613 GTGAGGGGGCAGGAGGTGCCAGG + Intronic
1117322045 14:54633646-54633668 GGGAGGGGGCAGGAGGAGTCAGG + Intronic
1117481400 14:56148865-56148887 ATGAAGAGGGAAGAGGAGTCAGG + Intronic
1117974531 14:61284058-61284080 GTGCAAAGGCAGGAGCAGGCTGG + Intronic
1118167667 14:63353818-63353840 GTGGAGAGAGAGCAGGAGCCAGG - Intergenic
1118346185 14:64942788-64942810 GTGGGGAGGAAGGAGGAGCCAGG + Exonic
1118445950 14:65851374-65851396 GTGCAGGGACAGGAGGAGACTGG - Intergenic
1118512374 14:66489623-66489645 GAGAAGATACAGGAGGAGGCAGG - Intergenic
1118686101 14:68292663-68292685 GTGGAAAGGGAGGAGGGGCCTGG - Intronic
1119423155 14:74519928-74519950 CAGAACAGGCTGGAGGAGCCAGG - Intronic
1119543325 14:75454843-75454865 TCAGAGAGGCAGGAGGAGCCAGG + Intronic
1119747552 14:77054986-77055008 GGGAAGAGGCAGGAGGTGTTGGG + Intergenic
1120186159 14:81395871-81395893 GTGAGGAGGTAGGAAGGGCCCGG - Intronic
1120532312 14:85646825-85646847 GTCAAGAGGCAGAACCAGCCTGG - Exonic
1120625963 14:86827016-86827038 GGGAAGAGGCAGGAAGAGGAAGG + Intergenic
1121398287 14:93647636-93647658 GGGAAGAGGCAGTGTGAGCCAGG + Intronic
1121526725 14:94624344-94624366 GGAAAGAGCCAGGTGGAGCCTGG - Intronic
1121632910 14:95433865-95433887 GTGATGGGGCAGTAGGAGCGGGG + Intronic
1121685103 14:95829951-95829973 GTGAAGAGGAAGGTGGAGATTGG + Intergenic
1121721028 14:96108695-96108717 GTGAAGAGGAAGGAGTGGACTGG - Intergenic
1121725098 14:96141510-96141532 GTCAGGAGGCAGGAGGAGCGAGG + Intergenic
1122037964 14:98962094-98962116 GAAATGAGGCAGGAAGAGCCAGG - Intergenic
1122064259 14:99160452-99160474 GCAAAGAGGCTGGAGGGGCCTGG + Intergenic
1122116073 14:99527884-99527906 CTGCAGAGGCGGGAGGACCCCGG + Intronic
1122245385 14:100399482-100399504 GAGAAAAGGCAGGCGGAGACAGG - Intronic
1122622625 14:103068478-103068500 GTGAAGAGGCTGGCAGTGCCGGG + Intergenic
1122784075 14:104155858-104155880 GGGAAGAGGGTGGAGGGGCCGGG + Intronic
1122822299 14:104353699-104353721 GGGAAGGGGCGGGAGGACCCCGG + Intergenic
1122935429 14:104953843-104953865 GTGAGGAGGTGGAAGGAGCCGGG - Exonic
1122942517 14:104988242-104988264 GTGAAGGGGTAGGAGGAGGGTGG - Intronic
1122949471 14:105033721-105033743 GTGAAGGGGAAGGAGGAACAGGG - Intergenic
1122967560 14:105138416-105138438 GAGAAGAGGCAGGAGTCTCCGGG + Intergenic
1123068085 14:105628176-105628198 GTGGGGGGGCAGGAGGAGCAGGG - Intergenic
1123092223 14:105746940-105746962 GTGCAGGGACAGGAGGATCCGGG - Intergenic
1202873046 14_GL000225v1_random:181779-181801 GAGATGAGGAAGGAGAAGCCAGG + Intergenic
1123457883 15:20442643-20442665 GTGAAGACGCAGGCAGAGACTGG + Intergenic
1123479012 15:20613986-20614008 GTGCAGAGGCAGGGGCAGCACGG + Intergenic
1123639000 15:22386399-22386421 GTGCAGAGGCAGGGGCAGCACGG - Intergenic
1123660186 15:22557766-22557788 GTGAAGACGCAGGCAGAGACTGG - Intergenic
1123687588 15:22810133-22810155 GTCAAGAGGCAGGGGGAGGGAGG + Intronic
1123808239 15:23897272-23897294 GTGAGGAGGCAGGAGCAGGAAGG + Intergenic
1124235717 15:27988053-27988075 GTGAATACGCATGAGGAGACAGG + Intronic
1124264031 15:28217796-28217818 GTGAAGACGCAGGCAGAGACTGG + Intronic
1124314045 15:28652261-28652283 GTGAAGACGCAGGCAGAGACTGG - Intergenic
1124373319 15:29115564-29115586 GGGAAGAGGCAGGAGGCGGCCGG + Intronic
1124430998 15:29608493-29608515 AGGAGGAGGCAGGAGGAGGCAGG - Intergenic
1124937053 15:34183329-34183351 TGGGAGGGGCAGGAGGAGCCTGG - Intronic
1125182128 15:36888917-36888939 GTGAGGAGGCAGGAGGATCCTGG + Intergenic
1125428323 15:39572167-39572189 GTGAAGAGGCAGGCGAAACAGGG - Intergenic
1125540520 15:40467322-40467344 GTGAGGGGGCTGGAGCAGCCTGG + Exonic
1125580781 15:40783928-40783950 GTGAAGAAGAAGGAGCAGGCTGG + Intronic
1125933604 15:43616695-43616717 GTGCAGAGGGAGGAGCAGGCAGG + Intronic
1125946702 15:43716157-43716179 GTGCAGAGGGAGGAGCAGGCAGG + Intergenic
1125953814 15:43776111-43776133 GAGAAGAGGCAGGACCAACCAGG + Exonic
1126755697 15:51923089-51923111 GTGAAGAGGCAGAAGGGGCCAGG + Intronic
1127250845 15:57236077-57236099 GTTACTAGGCAGGAGCAGCCAGG + Intronic
1127904015 15:63362849-63362871 GAGAAGAGACAGAAGTAGCCAGG - Intronic
1128067499 15:64774356-64774378 GTGAATAGGGACGAGGAGCTAGG - Intronic
1128317872 15:66672445-66672467 GTGAAGAGGCAGCAAGAGAGTGG - Intronic
1128347918 15:66866235-66866257 TTGAAGAGCAGGGAGGAGCCTGG + Intergenic
1128413581 15:67423222-67423244 ATGCAGGGGGAGGAGGAGCCAGG + Intronic
1128570829 15:68731571-68731593 GGGAAGAGGGAGGAAGAGGCAGG + Intergenic
1128693041 15:69739789-69739811 GCTCTGAGGCAGGAGGAGCCTGG + Intergenic
1128727792 15:70000594-70000616 GAGAAGAAGCAAGAAGAGCCAGG + Intergenic
1128830411 15:70763364-70763386 CTGAGGAGGCAGGACGTGCCCGG - Exonic
1128864440 15:71103572-71103594 GTCAAGTGGCAGGAGGAGAAAGG + Intronic
1129155821 15:73716957-73716979 TAGAAGAGGCAGGATGATCCAGG - Intergenic
1129199151 15:73988533-73988555 GTGACCTGGCAGGTGGAGCCAGG + Intronic
1129825894 15:78634828-78634850 GTGCTGAGGGAGGAGGTGCCTGG - Intronic
1130086230 15:80780089-80780111 GTGCTGAGGCAGGAGCAGCAGGG - Intronic
1130901766 15:88212638-88212660 TTGGAGAGGTAGGAGGAGCTGGG - Intronic
1131253956 15:90849167-90849189 GTCAAAAGGCATGAGGAGCTGGG - Intergenic
1131459142 15:92606281-92606303 AGGAAGAGGCAAGAAGAGCCGGG + Intergenic
1131829910 15:96347575-96347597 GTGGAGGGGCTGGCGGAGCCTGG - Intergenic
1132548362 16:543936-543958 GTGCACAGGCTGGTGGAGCCTGG + Intronic
1132764432 16:1527059-1527081 GGGAAAAAGGAGGAGGAGCCTGG - Intronic
1132900270 16:2250379-2250401 GTTCAGAGGCACCAGGAGCCTGG + Intronic
1133282680 16:4676153-4676175 GTGAAGAGGCTGCTGGGGCCTGG + Intronic
1133478427 16:6146188-6146210 GGGTGGAGGCAGGAGAAGCCAGG + Intronic
1134018183 16:10903808-10903830 GCGAAGGGGCTGGTGGAGCCTGG - Exonic
1134080079 16:11319088-11319110 GTGATGAGGATGGAGGAGCTGGG + Intronic
1135223958 16:20639406-20639428 CTGCAGAGGCAGGAGGAAGCTGG - Intronic
1135316589 16:21451576-21451598 GTGAAGAGACTGGAGGTGCGGGG - Intergenic
1135330333 16:21555022-21555044 GTGAAGAGGCACCCGGAACCTGG + Intergenic
1135369512 16:21883821-21883843 GTGAAGAGACTGGAGGTGCGGGG - Intergenic
1135442302 16:22487306-22487328 GTGAAGAGACTGGAGGTGCGGGG + Intronic
1135892014 16:26365814-26365836 GTGAGGAGGCAGGCAGAGGCAGG + Intergenic
1136326702 16:29532055-29532077 GTGAAGAGACTGGAGGTGCGGGG - Intergenic
1136367165 16:29814177-29814199 GTGAAGGGGCAGGGGGAGGAGGG - Intronic
1136441392 16:30272039-30272061 GTGAAGAGACTGGAGGTGCGGGG - Intergenic
1136472479 16:30490509-30490531 GTGAAGAGGCAGGAGGAGCCAGG - Intronic
1136546656 16:30958385-30958407 GTGAGGAGGCGGGAGGGGGCGGG + Intronic
1136590669 16:31216010-31216032 GTGCAGGGGCTGGAGGAGGCGGG + Exonic
1137498981 16:48996097-48996119 GTTGCGAGGCAGCAGGAGCCTGG + Intergenic
1137533843 16:49302234-49302256 GAGAAGAGCCAGGGTGAGCCAGG - Intergenic
1137593580 16:49708826-49708848 GTGCTGAAGCAGGAGGAGGCAGG - Intronic
1137822108 16:51456062-51456084 GAGAAGAAGAAGGAGGAGCAGGG + Intergenic
1138353204 16:56357697-56357719 GTGAGGAGGCACCGGGAGCCGGG - Intergenic
1138457869 16:57131718-57131740 GTGAGGGGCCAGGAGGGGCCAGG - Intronic
1138601832 16:58060244-58060266 CTGAAAATGCAGGTGGAGCCAGG - Intergenic
1138815732 16:60200882-60200904 CTTTAGAGGCAGGATGAGCCAGG - Intergenic
1139446540 16:67001719-67001741 GTGGAGAGGCAGAAGGTGCTGGG - Intronic
1139603551 16:68001583-68001605 GGGAGGAGGCAGGAGGGCCCTGG + Intronic
1139656167 16:68388337-68388359 GTGAAGAGGCAGGAGTCCCAGGG - Intronic
1139664870 16:68448395-68448417 GTGAGGAGCCGGGAGGAGCGGGG - Exonic
1139682245 16:68574079-68574101 GTCAGAAGGCAGGAGGGGCCTGG - Intronic
1140247711 16:73266442-73266464 ATGAAGAGCTAGGAGGTGCCAGG + Intergenic
1140477154 16:75244684-75244706 GTGGAGAGCCAGGAGGAGCAAGG + Intronic
1141065856 16:80913068-80913090 TTGGAGAAGCAGGAAGAGCCAGG - Intergenic
1141294175 16:82751393-82751415 GTGAGGAGGCAGGAGGAGGTGGG - Intronic
1141527167 16:84618650-84618672 GAGAAGAGGGAGGCGAAGCCGGG - Intergenic
1141610268 16:85177185-85177207 GGGGTGAGGCTGGAGGAGCCAGG + Intronic
1141675630 16:85515835-85515857 CAGAAGAGGCAGGAGGGGACCGG - Intergenic
1141894024 16:86947093-86947115 GGGACGCGGCAGGAGAAGCCAGG - Intergenic
1141981256 16:87551748-87551770 GTGAAGATGGAGGAGGAGACTGG + Intergenic
1142604114 17:1072333-1072355 TTGGAGAGGCAGGAGGCACCCGG + Intronic
1142624527 17:1183365-1183387 GTGATGAGGCAGGAGCAGGCAGG - Intronic
1142764827 17:2059095-2059117 AGGAAGAGGCGGGAGGGGCCTGG - Exonic
1142961396 17:3554462-3554484 GTGCTGAGGCAGGAGCAGTCAGG - Intronic
1142976570 17:3648240-3648262 GTGCAGAGACAGAAGGAGCTGGG - Intronic
1143539581 17:7561242-7561264 GTGAAGAGGCAGAGGGCACCTGG - Exonic
1143761863 17:9110566-9110588 GAAAAGAGGCAGGAGGGGCTGGG - Intronic
1144585562 17:16485602-16485624 AAGAACAGCCAGGAGGAGCCAGG + Intronic
1144647830 17:16987464-16987486 GTGGAGAGGGAGGAGGAGGAAGG + Intergenic
1144944395 17:18962338-18962360 GGGAAGAGGCAGGATGTGTCTGG + Intronic
1145746881 17:27326523-27326545 GGCAAGAGGCAGGAGGAGCAGGG + Intergenic
1145767828 17:27471526-27471548 GTCAAGGGCCAGGAGGAGGCTGG + Intronic
1146295807 17:31649516-31649538 GTCAAGCGGCAGGAGCAGCAGGG + Intergenic
1146506024 17:33406053-33406075 GTCAGGAGGCAGAAGGAGCCAGG - Intronic
1146518460 17:33508070-33508092 GAGGAGAGGGAGGAGGAGTCAGG - Intronic
1147293445 17:39461913-39461935 GTCGGGAGGGAGGAGGAGCCTGG + Intronic
1147367873 17:39971172-39971194 GTGAAGAGGAAGAAGGAGCCAGG + Intronic
1147427345 17:40352196-40352218 GGGAAGAGGCAGCAGGAGGAGGG - Intronic
1147447656 17:40484579-40484601 CTGCTGAGGAAGGAGGAGCCAGG - Exonic
1147455626 17:40536480-40536502 GTCAAGAGGCAGGAAAATCCAGG + Intergenic
1147986581 17:44310567-44310589 GTGATGAGGCAGTAGGGGCCTGG - Intronic
1148073617 17:44922704-44922726 TGGAAGAGGCAGGATGAGGCAGG + Intergenic
1148094203 17:45041193-45041215 GTGAAGGGCCAGGAGGAGGCGGG - Intronic
1148208349 17:45793489-45793511 GTCATGAGGCAGGAGTAGCCAGG + Intronic
1148463979 17:47853595-47853617 GGGAAAAGGCAGAAGGGGCCAGG - Intronic
1150702649 17:67461150-67461172 GAGAAGAAGCAGGAGGAGGCAGG - Intronic
1151139139 17:71975233-71975255 GGAAAGAGGCAGAAGGAGTCTGG + Intergenic
1151259853 17:72907888-72907910 GAGAAGTGGAAGGAGGAGACAGG + Intronic
1151357140 17:73566143-73566165 GTTAGAAGGCAGGAGGTGCCAGG - Intronic
1151515510 17:74592497-74592519 GCCAAGGAGCAGGAGGAGCCAGG + Exonic
1151576851 17:74956810-74956832 GAGAGGAAGCAGAAGGAGCCAGG - Intronic
1152119408 17:78408959-78408981 GGGTACAGGCAGGAGCAGCCCGG + Intronic
1152243810 17:79175026-79175048 AGGAAGAGGCAGGAGGGGCTGGG - Intronic
1152393180 17:80015132-80015154 GTGAAGAGGCAGGCACAGCTGGG + Intronic
1152520513 17:80853279-80853301 GTGGAGAGGCTGGAAAAGCCCGG - Intronic
1152641959 17:81452942-81452964 GTGAAGGGGCACCAGCAGCCTGG - Intronic
1152693123 17:81730311-81730333 GTGAAGAGCTGGGAGGGGCCTGG + Intergenic
1152741994 17:82022520-82022542 GCGAAGAGAGAGGAGGAGCTGGG - Intronic
1152818585 17:82423969-82423991 GGGACGGGGCAGGAGGAGCCGGG - Intronic
1152937483 17:83148834-83148856 GTGAGGGTGCAGGAGGGGCCTGG + Intergenic
1153679270 18:7484987-7485009 GGGAAGAGGAGGGAGGAGACAGG - Intergenic
1154290448 18:13101997-13102019 GGGTGGAGGCAGGAGGAGCTAGG - Intronic
1154330862 18:13428199-13428221 GAAAGGAGGTAGGAGGAGCCGGG + Intronic
1156656868 18:39298696-39298718 GGGAAGACGCAGGAGGAGCAAGG - Intergenic
1157237917 18:45981471-45981493 GTGAAGAGGCAGCAAGAGAGTGG - Intergenic
1157587455 18:48813848-48813870 GTGCAGGGGCAGGAGGAGACTGG - Intronic
1158172451 18:54614877-54614899 TTGAAGAGGCAGGAGGGGACGGG + Intergenic
1158426042 18:57340422-57340444 GTGAAAAGGCAGAAGGAGCTGGG - Intergenic
1158532745 18:58278353-58278375 GTGAAGAGGCAGGAGGGGCAGGG - Intronic
1158896744 18:61921352-61921374 GTGCAGAGGCAGGATCAGCCAGG - Intergenic
1159914916 18:74180313-74180335 GTGAAGATGAAGGCGGAGACTGG + Intergenic
1159950361 18:74478361-74478383 GTCAAGGGGCAGGAGCAGGCGGG - Intergenic
1160014471 18:75129589-75129611 GTAGAGAGTCAGGAGGAGCTAGG + Intergenic
1160204404 18:76821862-76821884 GTGGAGAGGCCGGCCGAGCCCGG - Intronic
1160227009 18:77019419-77019441 GTGAAGATGGAGGAGGAGCCTGG + Intronic
1160248969 18:77184599-77184621 GTGAAGAGGCAGGCCGGGCGCGG - Intergenic
1160528953 18:79552548-79552570 GGGAAGAGGCTGGAGGAGAAAGG + Intergenic
1160705185 19:526246-526268 GTGAAGGGGGAGGAAGGGCCTGG - Intergenic
1160752301 19:740222-740244 GCGATGGGGCAGGCGGAGCCGGG - Intronic
1160757320 19:764559-764581 GAGACGGGGCTGGAGGAGCCGGG - Intergenic
1161026013 19:2037720-2037742 GTGAAGATCCTGGAGGACCCTGG - Exonic
1161055284 19:2187944-2187966 GTGAAAAGACAGGAAGGGCCAGG + Intronic
1161068879 19:2250771-2250793 GTGGAGAGGGACGGGGAGCCGGG + Intronic
1161244769 19:3243827-3243849 GTGAAGATGCAGGCGGAGATGGG - Intronic
1161330285 19:3683700-3683722 GAGGAGAGTGAGGAGGAGCCAGG + Intronic
1161613565 19:5257443-5257465 AGGAAGAGGCAGAAGGCGCCGGG + Intronic
1161836295 19:6649353-6649375 GTGAAGAGTGAGGAGGAGGGCGG - Intergenic
1161963760 19:7536379-7536401 GAGAAGAGGCAGACGGATCCAGG - Intronic
1162148807 19:8630709-8630731 CTGGAGAGCCAGGAGGAGCAAGG + Intergenic
1162400914 19:10446142-10446164 GTCAAGAGGAATGAGGAGGCCGG - Intronic
1162439493 19:10683710-10683732 GGGAAGAGGCGGGAGCATCCGGG + Exonic
1162788786 19:13052451-13052473 GTGACGATGCAGGAGCTGCCAGG + Intronic
1162967703 19:14163862-14163884 GAGAAGAGGGAGAAGGGGCCGGG - Intronic
1163032399 19:14553239-14553261 GTGCAGAGGCAGCGGTAGCCCGG - Intronic
1163053822 19:14704071-14704093 GTGAAGAGGCAGCAGGAGGGTGG - Intronic
1163413192 19:17169728-17169750 GTGAAGAGGAAGAGGGAGGCAGG - Intronic
1163695571 19:18761717-18761739 GTGAAGGAGAGGGAGGAGCCTGG + Intronic
1163720225 19:18895226-18895248 GGGAAGAGGCAGGAGCTGCCCGG - Intronic
1164477929 19:28589624-28589646 ATGGAGAGGCAGGCGGCGCCAGG - Intergenic
1165076315 19:33281668-33281690 CTGGGGAGGCAGCAGGAGCCCGG + Intergenic
1165361309 19:35338526-35338548 GTCAAGAGCAAGGAGCAGCCAGG + Intronic
1166063596 19:40343154-40343176 GGGAAGAGGGCAGAGGAGCCGGG - Intronic
1166303097 19:41923010-41923032 GGGAAGAGGCGGGAGGGGGCTGG + Intronic
1166534652 19:43565023-43565045 GTGAAGATGCAAGCAGAGCCTGG - Intronic
1166668900 19:44698181-44698203 GTGGGGAGACAGGAGGACCCAGG + Intergenic
1166766202 19:45252986-45253008 GTGTAGGGGCAGGGGGCGCCTGG - Intronic
1167441709 19:49512920-49512942 GGGAGGAGGGAGGAGGGGCCGGG + Intronic
1167448948 19:49556100-49556122 TTGAAAAGGAAGGAGGAGGCGGG + Intronic
1167451200 19:49570643-49570665 GGGAAGTCGGAGGAGGAGCCTGG - Intronic
1167532343 19:50025901-50025923 CTGAAGAAGCAGGAGGAGATGGG + Exonic
1167597154 19:50433778-50433800 GTGAAGACTCAGAGGGAGCCAGG + Intronic
1167665529 19:50821110-50821132 GGGAGGAGGAAGGAGGAGGCGGG - Intronic
1202695162 1_KI270712v1_random:118170-118192 GTGCAGAGGCAGCAGGTGGCAGG + Intergenic
1202711953 1_KI270714v1_random:23791-23813 GGGAAGAGGCAGGAAAAGCACGG - Intergenic
925084781 2:1099527-1099549 CTGAAGAGGCTGGAGGTCCCAGG + Intronic
925090765 2:1154165-1154187 GGGGAGAGGCGGGAGGAGCATGG + Intronic
925389341 2:3484802-3484824 GTGCAGAGCCAGGACCAGCCCGG + Intronic
925599765 2:5596348-5596370 GTGAAGAAGTGGGAGGAGGCTGG - Intergenic
925610326 2:5696618-5696640 GTGGCGAGGCAAGAAGAGCCAGG - Exonic
925762649 2:7200510-7200532 GTGAAGAGACAGCATGCGCCAGG - Intergenic
925919351 2:8628406-8628428 GTGAAGAGGAAGGAGCAGCAGGG + Intergenic
925924072 2:8658162-8658184 GGGAAGAGGCAGCAGGGGCCCGG + Intergenic
926056406 2:9776459-9776481 GTGTGGTGGCAGGAGAAGCCAGG - Intergenic
926647989 2:15310738-15310760 GTTTAGAGGCAGAAGGAGCCAGG - Intronic
927139139 2:20118033-20118055 CTGGAGGAGCAGGAGGAGCCCGG + Intergenic
927139163 2:20118117-20118139 CTGGAGGAGCAGGAGGAGCCCGG + Intergenic
927399497 2:22694825-22694847 GTCAAGAGGCAGAGGTAGCCAGG + Intergenic
927560825 2:24071725-24071747 CTGAAGAATGAGGAGGAGCCAGG + Intronic
927651057 2:24914043-24914065 GTGAGGAGGAAGGAGGGGACTGG - Intronic
927906844 2:26864710-26864732 GTGAAGCTGCAGGAAGGGCCAGG + Intronic
928762867 2:34605219-34605241 CTTAAGAGGCAGGAGGAGATGGG + Intergenic
929040343 2:37738417-37738439 GTCAGGAGGCAGAAGGAGCCAGG + Intronic
930171745 2:48258505-48258527 GTGAAGATGCAGAAGTGGCCAGG - Intergenic
930292156 2:49508680-49508702 GTGAAGATGAAGGAAGAGCAAGG - Intergenic
930641347 2:53857355-53857377 TTGAGGAGGCAGGAAGAGCAGGG + Intronic
931740130 2:65234714-65234736 TGGAGGTGGCAGGAGGAGCCTGG - Intronic
931906007 2:66844732-66844754 GGAAAGAGGCAGGAGGAACAAGG - Intergenic
932221132 2:69999877-69999899 GGGAGGAAGGAGGAGGAGCCCGG - Intergenic
932330556 2:70896269-70896291 GGAAAGAAGCAGGAGGAACCCGG + Intergenic
932850128 2:75176695-75176717 GTGATGAGGCAGGTGGTGCAGGG - Intronic
933250923 2:80027603-80027625 GTGAAGAAGTAGGAGCAGACTGG + Intronic
933661589 2:84931836-84931858 GTCAAGAGGCAGAGTGAGCCAGG - Intergenic
933989603 2:87624782-87624804 GTGCAGAGACAGGAGGCTCCCGG + Intergenic
933995827 2:87669065-87669087 TGGTAGAGGCAGGAGGAGGCAGG + Intergenic
934276332 2:91575219-91575241 GTGCAGAGGCAGCAGGTGGCAGG + Intergenic
934562197 2:95319225-95319247 GTGCGGAGGCTGGTGGAGCCGGG + Intronic
934564337 2:95330126-95330148 GAGAAGAGGCAGGAGCAGGAAGG + Intronic
934737090 2:96695119-96695141 CTGAAGAAGCAGGAAGTGCCTGG - Intergenic
934969575 2:98751981-98752003 GTTGAGAACCAGGAGGAGCCTGG + Intergenic
935024573 2:99263835-99263857 GTCAGGAGCCAGGAGGAGCTGGG - Intronic
935618202 2:105107121-105107143 GTGGGGAGGCAGAAGGAGCGAGG - Intergenic
935637561 2:105261454-105261476 GAGAAAAGGCAAGGGGAGCCGGG + Intergenic
935692770 2:105745323-105745345 GTGCAGAGCCGGGAGGTGCCCGG - Intronic
936298030 2:111281847-111281869 TGGTAGAGGCAGGAGGAGGCAGG - Intergenic
936304240 2:111326044-111326066 GTGCAGAGACAGGAGGCTCCTGG - Intergenic
936618711 2:114073527-114073549 GGGAAGAGGGAGGAGCAGCAGGG + Intergenic
937319655 2:120953547-120953569 GTGAAGAGGTGGAAGGAACCTGG + Intronic
937323665 2:120975991-120976013 GGGAACAGGCAGGAGGAGGAAGG - Intronic
937327488 2:120999909-120999931 GGGCAGCGGAAGGAGGAGCCAGG - Intergenic
937681994 2:124654077-124654099 GTGAAGGGACAGGATGAGGCAGG + Intronic
937875944 2:126825439-126825461 GGGAAAAGGAAGGAGGTGCCAGG - Intergenic
938343239 2:130549173-130549195 GTGAAGTGAGAGGAGGGGCCTGG - Intronic
938346594 2:130571549-130571571 GTGAAGTGAGAGGAGGGGCCTGG + Intronic
939445266 2:142302070-142302092 GAGAGGGGGTAGGAGGAGCCAGG - Intergenic
940803405 2:158157422-158157444 GTGAAGAAGCAGCTAGAGCCAGG + Intergenic
940846216 2:158644750-158644772 GTGAAGAGGAAGGAGGAAAATGG + Intronic
941172778 2:162159990-162160012 ATGAAGAGGCAAGATGAGGCTGG + Intergenic
941329661 2:164164444-164164466 GTGAAGAATTAAGAGGAGCCTGG + Intergenic
941567149 2:167123637-167123659 GTGAAGAGGCAGCAAGAGGGAGG - Intronic
941697899 2:168573011-168573033 GAGAAGAGGAAGGAGGAGGCAGG + Intronic
941969648 2:171336047-171336069 GTGAACAGGAAGGGTGAGCCTGG + Intronic
942143488 2:173001735-173001757 GTGAAGGGGGAGCAGGAGCGAGG + Intronic
942413020 2:175731391-175731413 GTGAAGAGGCAGAAAGAGGGTGG + Intergenic
943797652 2:192017209-192017231 CTGGAGAGGCAGGTGGGGCCAGG + Intronic
944515653 2:200509780-200509802 GGGAAGAGCCGGGAGGAGCTGGG + Exonic
946147584 2:217742651-217742673 GTGCAAAGGCAGGTGGAGACAGG - Intronic
946371697 2:219285217-219285239 GTGGAGGGGCCCGAGGAGCCAGG + Exonic
946408738 2:219506204-219506226 GGGAAGAGGCAGGAGGCAGCAGG - Intronic
946416923 2:219544315-219544337 GTGCAGAGGCCCGAGGGGCCGGG - Exonic
946426546 2:219601453-219601475 GGGAAGAGGCAGGATGTGCAAGG + Intronic
946536748 2:220638375-220638397 GAGAAGAGGCAGGAGGATCGAGG + Intergenic
946740106 2:222792868-222792890 GTGAAGAAGGAGGAGGAGGAGGG - Intergenic
946746788 2:222854324-222854346 GCAAAGAGACAGGAGGAGCTGGG + Intergenic
947150473 2:227110182-227110204 GGGCAGAGTCAGCAGGAGCCCGG - Intronic
947534604 2:230933068-230933090 GGGAAGAGGCAGGAAGGGGCAGG - Intronic
947565119 2:231188792-231188814 GTGAGGTGGCAAGAGGAGCAGGG - Intergenic
947775877 2:232708909-232708931 GTCAAGAGTCAGGACCAGCCTGG + Intronic
947779318 2:232743187-232743209 GTGGAGTGGCAGGAGAAACCAGG + Intronic
947908575 2:233785568-233785590 GTGAGGAGGCAGAGGGAGTCAGG + Intronic
948188270 2:236038436-236038458 GACACGAGTCAGGAGGAGCCTGG - Intronic
948426915 2:237894404-237894426 GGAAGGAGGCAGGAGGAGCCGGG + Intronic
948601612 2:239110902-239110924 CTGAGGAGGCAGGAGGGGCCGGG - Intronic
948601897 2:239112078-239112100 GTGCTGAGCCAGGAGCAGCCTGG + Intronic
948883582 2:240872283-240872305 GTGAACATGCAGGAGGAGGAGGG + Intronic
948883607 2:240872440-240872462 GTGAACATGCAGGAGGAGGAGGG + Intronic
1168763346 20:364943-364965 CTGAAGAAGAAGGAAGAGCCTGG + Intronic
1168768434 20:397897-397919 GCCAAGAGACAGAAGGAGCCTGG - Intergenic
1168858516 20:1028016-1028038 GTGAATGGGCAGGAGGTCCCTGG - Intergenic
1168991939 20:2102814-2102836 GGGATGAGGCAGGGGGGGCCCGG + Exonic
1169277212 20:4241862-4241884 GAGAGAAGGCAGGAGGAGGCAGG - Intronic
1170030117 20:11935749-11935771 GAGAGGAGTCAGGAGGGGCCTGG - Intergenic
1170567782 20:17616517-17616539 GTGGAGAGGCTGGAGGAGTTGGG - Intronic
1170823238 20:19771865-19771887 AAGAGGAGGCAGGAGGAGGCAGG - Intergenic
1171419857 20:25010786-25010808 GTTAAGAGCCAGGACGAGGCAGG + Intronic
1171439497 20:25148788-25148810 GCAAAGAGCCAGGGGGAGCCAGG - Intergenic
1171467008 20:25336833-25336855 ATGGAGAGGCAGGAGGAGTGGGG + Intronic
1171484356 20:25476663-25476685 CTGAGGAGGCGGCAGGAGCCGGG - Exonic
1172223312 20:33288259-33288281 GAGCAGAGGAAGAAGGAGCCAGG - Intronic
1172590165 20:36112225-36112247 CTGAAGCGGCAGCAGGGGCCAGG - Intronic
1172974034 20:38893578-38893600 GGGAGGAGGCGGGAGGAGGCGGG + Intronic
1173197128 20:40924655-40924677 GTGAAGTGGCACGAGTAGCTGGG - Intergenic
1173263712 20:41459355-41459377 GCCAAGTGGCAGGAGGTGCCTGG - Intronic
1173590756 20:44222783-44222805 GGGAGGAGGCAGGAGGTACCAGG - Intergenic
1173759844 20:45549840-45549862 ATGAAAAAGCAGGAGGTGCCAGG - Intergenic
1174186000 20:48706827-48706849 CTGAAGGGGCTAGAGGAGCCAGG + Intronic
1174374453 20:50116443-50116465 GTGATGAGGGAGGTGGAGCCTGG + Intronic
1174528932 20:51195656-51195678 GAGAAAAGGGAGGAGGTGCCGGG + Intergenic
1174532434 20:51224762-51224784 GTGAAGATGGAGGCAGAGCCTGG + Intergenic
1174979399 20:55376162-55376184 GAGAAGCTGCAGGAGGAGCCAGG - Intergenic
1175026656 20:55909761-55909783 GCCAGGAAGCAGGAGGAGCCTGG + Intergenic
1175203008 20:57290873-57290895 GAGAAGCTGTAGGAGGAGCCAGG - Intergenic
1175245285 20:57578591-57578613 CTGAAGAGCCAGGAGAAGCGAGG + Intergenic
1175300815 20:57941466-57941488 GGGAAGAGGCAGGACGTGCCAGG + Intergenic
1175491596 20:59384080-59384102 GTGAATGGGCAGGAGGTGACTGG + Intergenic
1175619531 20:60431577-60431599 GTGGAGAGGAAGCAGGAGACCGG - Intergenic
1175764138 20:61581452-61581474 ATGAAGATGGAGGAGGGGCCAGG - Intronic
1175801356 20:61802770-61802792 GAGGAGAGGCTGGAGGAACCGGG + Intronic
1175829191 20:61952778-61952800 GTGAAGATGGAGGTGGAGACGGG - Intergenic
1175879310 20:62247582-62247604 AGGAGGAGGCAGGAGGAGGCAGG + Intronic
1176033620 20:63025800-63025822 GCTCAGAGACAGGAGGAGCCTGG - Intergenic
1176084203 20:63288650-63288672 GTGGCCAGGCAGGAGGGGCCGGG + Exonic
1176214047 20:63939927-63939949 GTCAGGAGGCAGGAGGAGGGTGG + Exonic
1178498134 21:33104078-33104100 ATGAAGAGGTAGGAGCAGCTTGG + Intergenic
1179470567 21:41607331-41607353 GTGAGGAGGCAGGCAGAGACGGG + Intergenic
1179482227 21:41685644-41685666 GCTAGGAGGCAGGAGGAGGCTGG - Intergenic
1179775581 21:43659773-43659795 GTGAAGACGCAGAGGGAGACAGG + Exonic
1179804210 21:43826769-43826791 GTGGGGAGGCCGGAGGAGACAGG + Intergenic
1180011308 21:45053366-45053388 GTAACCAGGCAGGAGGAGCTTGG + Intergenic
1180099126 21:45576171-45576193 CTGCAGATGCAGGAGGACCCTGG + Intergenic
1180285049 22:10737738-10737760 GAGATGAGGAAGGAGAAGCCAGG - Intergenic
1180763042 22:18223479-18223501 GCACCGAGGCAGGAGGAGCCAGG + Intergenic
1180772601 22:18401068-18401090 GCACCGAGGCAGGAGGAGCCAGG - Intergenic
1180784631 22:18539939-18539961 GTGAAGAGGGAGGCGGAGATGGG + Intergenic
1180803981 22:18650684-18650706 GCACCGAGGCAGGAGGAGCCAGG - Intergenic
1180806782 22:18718765-18718787 GCACCGAGGCAGGAGGAGCCAGG + Intergenic
1180831609 22:18909776-18909798 GGAAAGGAGCAGGAGGAGCCGGG - Intronic
1180911843 22:19456128-19456150 CTGAGGTGGCAGGAGGTGCCAGG - Intronic
1180962941 22:19770504-19770526 GTGCAGAGGCAGGAGCACGCGGG + Intronic
1180997480 22:19972647-19972669 GTGAAGGTGAAGGAGGAGTCAGG - Intronic
1181128209 22:20713992-20714014 GTGAAGAGGGAGGCGGAGATGGG + Intronic
1181217738 22:21344575-21344597 GCACCGAGGCAGGAGGAGCCAGG + Intergenic
1181241534 22:21479296-21479318 GTGAAGAGGGAGGCGGAGATGGG + Intergenic
1181431095 22:22882387-22882409 CAGTAGAGGGAGGAGGAGCCTGG - Intronic
1181616966 22:24061475-24061497 GTGAAACAGCAGGAGGAACCAGG + Intronic
1181962772 22:26634891-26634913 GTGAAGATTCAGGAAGAGGCTGG - Intergenic
1182296708 22:29314508-29314530 GTGAAGAGGAAAGAGCAGGCAGG - Intronic
1182439175 22:30352065-30352087 GGGGAGAGACAGGAGGAACCCGG + Intronic
1182460118 22:30477613-30477635 GTGAAAAGGCACCAGGGGCCGGG + Intergenic
1182806097 22:33071885-33071907 GGGAAGAGTCAGGAACAGCCAGG - Intergenic
1183038028 22:35154991-35155013 AAGAAGAGGCGCGAGGAGCCAGG - Intergenic
1183431449 22:37768391-37768413 GTGAAGAGGTGGGTGGAGGCTGG - Intronic
1183618533 22:38959468-38959490 GTGGGGAGGGAGGAGGAGGCAGG + Intronic
1183627619 22:39014402-39014424 AGGAAGTGGCAGGAGGGGCCTGG - Intronic
1183649053 22:39144034-39144056 GTTAAAAGGCAGAAAGAGCCTGG + Intronic
1183987664 22:41578308-41578330 ATGGAGAGGGAGGAAGAGCCTGG + Intronic
1184420979 22:44382782-44382804 GTGGAGGAGCAGGAGGGGCCTGG - Intergenic
1184651313 22:45920603-45920625 CTGTTGAAGCAGGAGGAGCCTGG + Exonic
1184693711 22:46128669-46128691 GTGGACAGACAGGAGGAGCGAGG - Intergenic
1184879879 22:47297953-47297975 TGGAGGAGGCGGGAGGAGCCAGG + Intergenic
1184918281 22:47588304-47588326 GTGAGGAGGCAGGAAGAGAGTGG - Intergenic
1184946267 22:47806333-47806355 GTGTTGGGGCAGGAGGACCCAGG - Intergenic
1185045694 22:48527687-48527709 TGGAAGTGGCAGGAGGATCCGGG + Intronic
1185315105 22:50175606-50175628 GGGAAGAGGCAGGAAAAGCTGGG - Intronic
1203234439 22_KI270731v1_random:142056-142078 GCACCGAGGCAGGAGGAGCCAGG - Intergenic
1203292614 22_KI270736v1_random:9959-9981 GTCAGGAGGCAGAAGGATCCAGG + Intergenic
950358200 3:12429419-12429441 CTCAAGAGGAAGGAGGAGGCTGG + Intronic
950467036 3:13161804-13161826 GTGCACAGACAGGAGAAGCCGGG - Intergenic
950718371 3:14865475-14865497 GGGAAGAGGCAGGAGAAGAGGGG - Intronic
950974235 3:17223800-17223822 GGGAAGAAGCAGGAGAACCCTGG + Intronic
951962889 3:28348829-28348851 GAGCCGAGGCAGGAGGGGCCGGG + Exonic
953848103 3:46444806-46444828 CTGCAGAAGCAGGTGGAGCCAGG + Intronic
954139779 3:48598896-48598918 GTGGGAAGGCAGGAGGATCCAGG + Intergenic
955004311 3:54954810-54954832 GAGAAGAGCCAGGGGGTGCCAGG + Intronic
955033297 3:55241578-55241600 ATCAAGAGGCAAGAGGAGCAAGG + Intergenic
955077269 3:55625453-55625475 AAGAAGAGGGAGGAGGAGGCTGG + Intronic
956737619 3:72250195-72250217 GGGGAGAAGCAGGAGGAGGCTGG + Intergenic
956749189 3:72332768-72332790 GTGCAGAGCCTCGAGGAGCCAGG + Intergenic
956855482 3:73270762-73270784 TTGAAGAGGCAGAAGGAAGCAGG - Intergenic
958676974 3:97277365-97277387 GGGATGAGCCAGGATGAGCCAGG + Intronic
960100046 3:113732289-113732311 TTGAAGATGAAGGAAGAGCCAGG + Intronic
960357462 3:116671094-116671116 GGGAAGAGGGAGGAGGAGGCAGG + Intronic
960914023 3:122679468-122679490 GTGAAGGGGAAGAAGGAGCCAGG - Intergenic
960968181 3:123120094-123120116 GGGAAGAGGCAGATGGAGACAGG - Intronic
960995170 3:123335849-123335871 TTGAAGTGGCCAGAGGAGCCAGG - Intronic
961006085 3:123406302-123406324 GTCAGGAGGCAGAGGGAGCCAGG - Intronic
961623822 3:128245396-128245418 GTCAAGGGGCAGGAGGGCCCAGG - Intronic
962207714 3:133448638-133448660 ATGAAGAGGTAGGAGGGGGCTGG + Exonic
962215432 3:133516859-133516881 GTGAAGAGGCAGCAAGAAGCTGG - Intergenic
962385465 3:134929036-134929058 GTGAAGAGTCAGTAGGAGGTGGG + Intronic
962709875 3:138077354-138077376 GTGCAGATGCCAGAGGAGCCCGG + Intronic
963989026 3:151631824-151631846 AAGGAGAGGCAGGAGGAGCCAGG + Intergenic
965673811 3:171174026-171174048 CTGCAGAGGAAGGAGGAGCAGGG + Intronic
965894096 3:173552687-173552709 GTTTGCAGGCAGGAGGAGCCTGG - Intronic
966102966 3:176296444-176296466 GAGAAGAGGCAGGATCATCCTGG - Intergenic
966309129 3:178574331-178574353 CTGAAGCCCCAGGAGGAGCCAGG - Intronic
967888845 3:194351045-194351067 GGGAAGAGGCAGGAGGAAGGTGG - Intronic
968040969 3:195588980-195589002 GAAAAGAGGCAGGGGGAGCAGGG + Intergenic
968287249 3:197516122-197516144 GGGAAGATGCAGGAGATGCCTGG - Intronic
968453279 4:684941-684963 GTGGTGGGGCAGGAGGAGCTGGG - Intronic
968542499 4:1175213-1175235 GAGGAGAGGAAGGAGGCGCCGGG + Intronic
968672158 4:1857431-1857453 GCGGAGAAGCAGGAGGAGGCAGG - Intergenic
968751239 4:2390156-2390178 GTGAAGATGGAGGTGGAGACTGG + Intronic
968817115 4:2827907-2827929 GATAAGTGGCAGGTGGAGCCGGG + Intronic
968963339 4:3756744-3756766 GGGAAAAGGCAGAAGGGGCCAGG + Intergenic
968967301 4:3775608-3775630 GTGCAGAGCCATGAGGACCCTGG + Intergenic
968986645 4:3879258-3879280 CTGAGGGGGCAGGAGAAGCCGGG + Intergenic
968991571 4:3916810-3916832 GTGAAGACTAAGGAGGGGCCGGG + Intergenic
969099610 4:4759008-4759030 GTGAAGAAGCTGGAGGAGGTTGG + Intergenic
969131393 4:4993418-4993440 GTGTGGAGGCTGGAGGATCCAGG - Intergenic
969463892 4:7343518-7343540 GTGCAGAGGGAGCAGGTGCCAGG - Intronic
969477699 4:7430923-7430945 GCAGAGAGGCAGGAGGAGCAAGG - Intronic
970261397 4:14228615-14228637 GGGAGGAGGCAGGTGGAACCTGG + Intergenic
971255357 4:25009100-25009122 GTGCAGAGGCAGGAGGATGCAGG - Intronic
971451405 4:26804993-26805015 GTGAAGATTCAGGAGATGCCTGG + Intergenic
971510002 4:27412930-27412952 GTCAAGAGGCAGGATGAGTGAGG - Intergenic
972238180 4:37158364-37158386 GTCATGAGGCAGAAGGAGCAAGG + Intergenic
972730004 4:41785120-41785142 TTGCAGAGGAAGGAGAAGCCGGG + Intergenic
972736620 4:41848234-41848256 GGCAAGAGGCTGGAGGATCCTGG + Intergenic
973319069 4:48791417-48791439 GTGAGGAGGAAAGAGGAGGCAGG + Intergenic
973319125 4:48792335-48792357 GTGAAGAGGAAAGAGGAGGCAGG + Intergenic
973872991 4:55185462-55185484 ATGATGAGTAAGGAGGAGCCAGG - Intergenic
974023120 4:56709135-56709157 GTGCAGAGGGAGGAGGAGTTGGG + Intergenic
976142581 4:82007808-82007830 CTGAAGGGGCTGGAGGAGCGTGG + Intronic
976688256 4:87839923-87839945 GTAGAGAGGCTTGAGGAGCCTGG - Intronic
977471808 4:97452260-97452282 GTGGAGAGCCGGGAGAAGCCAGG - Intronic
977617695 4:99104531-99104553 GTAGTGAGGCAGGAGAAGCCAGG + Intergenic
977627948 4:99208839-99208861 GTAAAGCAGCAGGAGCAGCCAGG - Exonic
977991471 4:103447535-103447557 CTGGAGAGGCTGGAGGAGGCAGG + Intergenic
978163003 4:105571617-105571639 CTGAAGAGGCATGAGCAGGCAGG - Intronic
978268573 4:106859064-106859086 GTGAAGGGGGAGGAGGAGGGGGG + Intergenic
979350034 4:119632745-119632767 GTGAAGAGGCAGCAAGAGAATGG + Intergenic
979986162 4:127318465-127318487 GTGAAGAGGGTAGAGGAGCCAGG + Intergenic
982497572 4:156110029-156110051 GTGAGGAGGCAGAAGGAGTTGGG + Intergenic
982696840 4:158611675-158611697 GTGTGGAGGAATGAGGAGCCAGG - Intronic
983193378 4:164778703-164778725 AGGAAGAGGCAGGAAGAGCTCGG + Intergenic
983523389 4:168734761-168734783 GAGAAGGAGGAGGAGGAGCCAGG + Intronic
983657700 4:170099764-170099786 GTGAACAGGGAGGAAGAACCTGG - Intergenic
984495643 4:180494002-180494024 AGGTTGAGGCAGGAGGAGCCTGG + Intergenic
984732385 4:183079832-183079854 ATGGAGAAGCAGCAGGAGCCAGG + Intergenic
984768135 4:183415217-183415239 GTGACGAGCCAGGAGGATCGTGG - Intergenic
984934771 4:184880585-184880607 GGGAAGATGCAGGCGGAGGCTGG - Intergenic
985521147 5:374320-374342 GTGCAGACCCAGGAGAAGCCAGG - Intronic
985619245 5:945191-945213 CAGAGGAGGCAGGAGGAGCATGG - Intergenic
985673408 5:1218034-1218056 GGGAGGAGGCGGGAGGAGGCAGG - Intronic
985751585 5:1681727-1681749 GTGAAGAGGCAGGGGCTGCTGGG + Intergenic
985786882 5:1900610-1900632 GTGGAGAGGCAGGGAGGGCCAGG - Intergenic
985860343 5:2465725-2465747 GGGAATAGGAAGGAGCAGCCAGG + Intergenic
986269755 5:6220392-6220414 GGGAAGAGGCAGGAGTGGCTGGG - Intergenic
986285607 5:6356162-6356184 GAGGAGAGTCAGGGGGAGCCTGG - Intergenic
986652595 5:9979431-9979453 GTGGAGAGGCAGGAGGTGGTGGG - Intergenic
986673970 5:10167722-10167744 GAAAAGTGGCAGGAGCAGCCAGG + Intergenic
986691399 5:10316625-10316647 GTCAAGAAGCAGAAGGAGCAGGG - Intergenic
987087367 5:14483390-14483412 CTGCAGAGCCAGGAGGACCCTGG - Intronic
989425253 5:41289517-41289539 GTGAAGAGGGAGGAAGATTCAGG - Intergenic
989433158 5:41379178-41379200 GGGAAAAGGCAGCAGGAGCCTGG - Intronic
991548092 5:67805931-67805953 GTGAGGAGCCACCAGGAGCCAGG + Intergenic
991549889 5:67824439-67824461 GAGAAAAGGCGGGAGGAGCAAGG - Intergenic
991970170 5:72133226-72133248 AGGCAGAGGCAGGAGGATCCTGG - Intronic
992826504 5:80554653-80554675 GTTGGGAGGCAGGAGGAGCAAGG + Intergenic
992886738 5:81167048-81167070 GTGAAGAGACGGGATGATCCTGG + Intronic
992937160 5:81719721-81719743 GTCAGGAGGCAGAAGGAGACAGG + Intronic
993083475 5:83332847-83332869 GTGAAGAGCATGGAGGAGACAGG + Intronic
995251073 5:109993923-109993945 GTCAAAAGACAGGAGGAGGCTGG - Intergenic
995400024 5:111730588-111730610 GTGAAAAGGCAGGAGTGGACCGG + Exonic
995644691 5:114298385-114298407 GAGAAGAGCCGGGAGGTGCCAGG - Intergenic
995919622 5:117295789-117295811 GTGAATAGGGAGGAGGGGTCAGG - Intergenic
996205866 5:120734284-120734306 GGGAAGAGGGAGCAGGAGGCTGG + Intergenic
997042918 5:130278460-130278482 CTGCAGAGCCAGCAGGAGCCAGG - Intergenic
997197865 5:131991659-131991681 GGGAGGAGGCAGGAGAAGGCTGG - Intronic
997463736 5:134072737-134072759 GGGCAGAGGTAGGAGGAACCTGG - Intergenic
997512899 5:134465581-134465603 GGGAAGGGGCAGGAGGGGTCTGG + Intergenic
997589644 5:135064876-135064898 GTGAAGAGGTGGGAGCAGCTGGG + Intronic
997999895 5:138616657-138616679 GTCAGAAGGCAGGTGGAGCCTGG + Intronic
998946255 5:147342510-147342532 GTGAGGAGGCAAAAGGAGACAGG + Intronic
999301104 5:150490961-150490983 TTGTAGAGGTAGGAGGGGCCAGG - Intronic
999436945 5:151570589-151570611 GGCAAGGGGCAGGAGGAGCGGGG + Intergenic
999805420 5:155076700-155076722 GAGGAGAGGCAGGCAGAGCCAGG - Intergenic
1000353751 5:160373465-160373487 GTGAAGAGGAGGTAGCAGCCTGG + Intergenic
1000379180 5:160613594-160613616 GAGGAGAGGCAGCAGTAGCCTGG + Intronic
1000435353 5:161201108-161201130 GTCAAGAAGCAGGAGGATGCAGG + Intergenic
1001079199 5:168654464-168654486 GTCAAGAGCCAGGGCGAGCCCGG - Intergenic
1001104713 5:168843285-168843307 GTGAAGAGGAAGGTGGAGGGAGG + Intronic
1001141351 5:169146584-169146606 CAGTGGAGGCAGGAGGAGCCGGG - Intronic
1001560460 5:172665703-172665725 GGGCAGAGGCAGGGGGAGGCTGG - Intronic
1001758733 5:174190416-174190438 GTGATGAGTTTGGAGGAGCCAGG - Intronic
1001842219 5:174887652-174887674 AAGCAGAGGCAGCAGGAGCCAGG - Intergenic
1001866851 5:175113675-175113697 GTGAAAAGGCAGGTGTTGCCAGG + Intergenic
1002458074 5:179357280-179357302 GTGATAAGGCACGAGGAGGCAGG - Intergenic
1002716959 5:181233957-181233979 GTGGAGTGGCAGGAAGAGCCAGG + Intronic
1002815333 6:675062-675084 GTCAGGAGGCAGAGGGAGCCAGG - Intronic
1002858644 6:1059804-1059826 TTTCAGAGGCCGGAGGAGCCTGG + Intergenic
1003125955 6:3356081-3356103 GGGAGGAGGCGGGAGGAGGCGGG + Intronic
1003148741 6:3530979-3531001 GTGAAGAGGCAGGAGTATGGCGG + Intergenic
1003170547 6:3718683-3718705 GTCAGGAGGCAGAAGGAGCAGGG - Intergenic
1003339596 6:5206682-5206704 TTGAAGAGGCGGGAGGAGTGGGG + Intronic
1003426209 6:5999867-5999889 GTGGAGAGCAAGGAGGATCCAGG - Intronic
1003573493 6:7271292-7271314 GTTAAGAGGCAGGAGGATGGAGG + Intronic
1003585889 6:7389320-7389342 GTGCAGAGGGAGGGAGAGCCAGG - Exonic
1004675687 6:17839744-17839766 GTGAAGATGCAGGCAGAGACTGG + Intronic
1004721742 6:18273665-18273687 GAGAAGAGGCAGGAGCATGCTGG + Intergenic
1004830325 6:19470233-19470255 GTGAATGGGCAGGAGTAGGCAGG - Intergenic
1004867658 6:19869905-19869927 TAGATGAGGCAGGAGAAGCCAGG - Intergenic
1005862234 6:29910731-29910753 GAGATGAGGGAGGAGGAGCAGGG - Intergenic
1006034546 6:31201334-31201356 GTGCAGAGCCAGAAGCAGCCAGG - Intronic
1006643044 6:35498139-35498161 AGGCCGAGGCAGGAGGAGCCCGG - Exonic
1007702788 6:43774255-43774277 GTGAGGAGGGAGGAGGGGCTGGG + Intronic
1007938262 6:45753156-45753178 TTGAACAGGCACGAAGAGCCAGG - Intergenic
1008014235 6:46500539-46500561 TTGAAGAAGTAGGAGGAGGCTGG - Intergenic
1008493277 6:52107546-52107568 GTGGAGAGGTAGAAAGAGCCTGG + Intergenic
1010579325 6:77574737-77574759 GTGAAGAGGCAGAAAGACACAGG + Intergenic
1011433123 6:87309206-87309228 GGGAAGATGAAGGAGGATCCAGG - Intronic
1011745320 6:90402783-90402805 GTGGAGAGGCAGGAAGAGGGAGG + Intergenic
1012340756 6:98120115-98120137 GCGAAGACACAGTAGGAGCCAGG - Intergenic
1012777432 6:103515690-103515712 GTGCAAAGGCATGAGAAGCCAGG - Intergenic
1013041515 6:106438546-106438568 GTGACAATGCAGGAGGAGACTGG - Intergenic
1013180415 6:107712561-107712583 GAGCAGAGGCAGCAGGGGCCTGG + Intronic
1013366540 6:109441713-109441735 GAGAGGAGGCTGGAGGAGACTGG - Intronic
1013462799 6:110391648-110391670 GTAAAGAGGCTTGAGGAGGCTGG - Intergenic
1013596255 6:111663485-111663507 GTTGACAGCCAGGAGGAGCCAGG - Intronic
1015300754 6:131650768-131650790 GTGAAGATGAAGGCAGAGCCTGG - Intronic
1015479658 6:133693590-133693612 GTGAGGAGGCAGGAGTAGGGTGG - Intergenic
1015793979 6:136992304-136992326 ATAGAGAGGCAGGAGGAGCCTGG - Intergenic
1015969355 6:138728728-138728750 GGGAAGGGGCAGGAGGAGCCTGG + Intergenic
1016618355 6:146079056-146079078 GGGAGCAGGGAGGAGGAGCCTGG - Intronic
1017346229 6:153384958-153384980 GTGAAGAGGCAGCAGCAACAGGG + Intergenic
1017484352 6:154889391-154889413 GTGAAAAGGCAGGAGAAACAGGG + Intronic
1017753322 6:157509121-157509143 GAGATGAGGCAGGAGGAGAGAGG - Intronic
1018038045 6:159898542-159898564 AGGAAGAGGCAGGAGGAGGGAGG - Intergenic
1018058227 6:160070527-160070549 GAGAAGAGGTAGGAAGTGCCAGG + Intronic
1018674367 6:166206221-166206243 GTGAAGACGGAGGTGGAGACCGG - Intergenic
1018755145 6:166842354-166842376 GTGAAGATGGAGGTGGAGACTGG + Intronic
1018855352 6:167670529-167670551 ATCAAGCGGCAGGAGAAGCCAGG + Intergenic
1019459972 7:1152684-1152706 GTGAAGATGAAGGTGGAGACGGG + Intronic
1019514405 7:1433401-1433423 GTGATGAGGGTGGAGGAGCACGG - Intronic
1019516975 7:1444482-1444504 GGGAATGGGGAGGAGGAGCCAGG - Intronic
1019536569 7:1532487-1532509 GATAAAAGGCAGGAGAAGCCTGG - Intronic
1019559523 7:1649034-1649056 GGGAAGGGTCAGGAGGTGCCAGG - Intergenic
1020021638 7:4872789-4872811 GTGAACCGGCAGGAAGCGCCTGG + Intronic
1020080243 7:5282856-5282878 GGGAAGAGGGAGGAGGAGGGGGG + Intronic
1020461360 7:8433541-8433563 GTGAAGGGGGAGGAGGAGGACGG - Intergenic
1020627603 7:10601201-10601223 GTGAAGATGCAGGCAGAGACTGG + Intergenic
1021178896 7:17483334-17483356 GTGAGGAGGAAGCTGGAGCCAGG - Intergenic
1021546779 7:21822321-21822343 GAGAATGGGCAGGAGGAGCCAGG + Intronic
1022114348 7:27249360-27249382 GAGAAGAGGAAGTGGGAGCCCGG - Intergenic
1022208371 7:28184417-28184439 GTCAGTAGGCAGGAGCAGCCAGG - Intergenic
1022518012 7:30987982-30988004 GGGAAGGGGCTGCAGGAGCCTGG + Intronic
1022520914 7:31006425-31006447 GTGGACAGGCATGAGGAGCTGGG - Intergenic
1022910850 7:34898611-34898633 GTGAATAGGCATGAGGAACAGGG - Intergenic
1022969730 7:35505872-35505894 GTGAAGAGCCAGGAAAGGCCTGG + Intergenic
1023026590 7:36056396-36056418 GAGAAGAAGCAGGAGGAAGCAGG + Intergenic
1023507943 7:40919853-40919875 GTGAAGAATCAGGAGGAGTCAGG - Intergenic
1023770249 7:43550526-43550548 GTGAAGTGGCGGGTGGAGCGCGG + Exonic
1023809690 7:43902162-43902184 GTGGAGAGGGAGGAGGAGGGGGG + Intronic
1023934908 7:44732798-44732820 AGGAGGAGGCAGGAGGAGGCAGG + Intergenic
1024700297 7:51899319-51899341 GTGAGGACGCAGGAGAAGACAGG - Intergenic
1025114655 7:56247410-56247432 GTGAAGGAGAAGGAGGAGTCAGG - Intergenic
1026198947 7:68197502-68197524 GTGAAGGGGAAGGAGGAGCCAGG - Intergenic
1026800645 7:73397864-73397886 GGGAAGAGTGAGGAGGAGGCGGG + Intergenic
1026890584 7:73979429-73979451 GTCAAGAGGCAGAAGCAGGCAGG + Intergenic
1026906507 7:74065919-74065941 GAGAAGAGGCAGGTGGGGTCAGG - Intronic
1027848516 7:83418398-83418420 GTGGAGATGAAGGAGGAGCTGGG + Exonic
1029127318 7:98303566-98303588 CTGAAGAGGCAGGCAGAGTCCGG + Intronic
1029303264 7:99600790-99600812 GTACAGAGGCCAGAGGAGCCTGG + Intronic
1029366576 7:100120198-100120220 CTGCAGAGGCTGCAGGAGCCGGG + Intronic
1029416509 7:100446492-100446514 GGGCAGAGGCAGGAGGAGAGAGG + Intergenic
1029425356 7:100490880-100490902 CTGATGAGGCAGGGGCAGCCTGG + Intronic
1029504061 7:100951491-100951513 GGGCAGAGGGAGGAGGAGCCTGG + Intronic
1029652962 7:101906327-101906349 GAGGTGAGGCAGGAGGAGCAGGG + Intronic
1029704403 7:102268467-102268489 GAGAAGAGGCAGCAGGAGGCAGG - Intronic
1030596561 7:111546993-111547015 CTGAAGAGGCAAGCAGAGCCAGG + Intronic
1031971298 7:128066920-128066942 GGGAAGAGGCAGGAGTACCTTGG + Intronic
1032161419 7:129513805-129513827 GAGGAGGGGCAGGAAGAGCCAGG - Intergenic
1032283370 7:130523847-130523869 GGGAGGAGGCAGGAGGAGGGTGG + Intronic
1032284111 7:130528072-130528094 GGGAGGAGGCAGGAGGAGGGTGG + Intronic
1032284887 7:130532449-130532471 GGGAGGAGGCAGGAGGAGGGTGG + Intronic
1032544235 7:132728466-132728488 GTCAAGAGGGAGGTGGAGGCAGG + Exonic
1032952039 7:136925671-136925693 CTGCAGAGACAGGAGGTGCCAGG - Intronic
1033543239 7:142376304-142376326 GTGAAGAGGCTGGGGCAGCAAGG + Intergenic
1033705113 7:143879038-143879060 GAGAAAAGGCAGGAAAAGCCAGG - Intronic
1034306487 7:150048440-150048462 GTGAAGAGGGTGGAGGGGCGGGG + Intergenic
1034474778 7:151276013-151276035 GGGATGAGGAAGGAGGAGGCTGG + Intronic
1034532315 7:151703659-151703681 CTGAGGAGGCAGGTGGTGCCTGG - Intronic
1034542428 7:151767111-151767133 GTGAAGATGAAGGCGGAGACTGG + Intronic
1034740648 7:153470687-153470709 GTGAAGTGGAGGGAGGACCCCGG + Intergenic
1034800360 7:154052203-154052225 GTGAAGAGGGTGGAGGGGCTGGG - Intronic
1035043558 7:155948670-155948692 GTCAAGAGGGAGGAGTAGGCTGG + Intergenic
1035296979 7:157872853-157872875 GTGGAGAGGCAGCAGCAGACAGG - Intronic
1035371974 7:158385900-158385922 GGGAGGAGGGAGGAGGAGCACGG - Intronic
1035675581 8:1453268-1453290 GGGGAGAAGCAGGAGGAGCCTGG + Intergenic
1035705672 8:1672565-1672587 GTGAGAAGGCAGGGGCAGCCTGG + Intronic
1036966206 8:13301008-13301030 GTGTAGAAGGTGGAGGAGCCTGG + Intronic
1037728743 8:21505973-21505995 ATGAAGAGCCAGGAGTGGCCTGG + Intergenic
1037939978 8:22944035-22944057 GTCAGGAGGCAGGAGGAGCCGGG - Intronic
1037963548 8:23116944-23116966 GAGAAGAGGCAGGAGTCCCCGGG - Exonic
1038431972 8:27507596-27507618 GAGAAGAGGCAGGAGAAAGCTGG + Intronic
1038929685 8:32178825-32178847 GTGAAGAAGAGGGAGGAGTCAGG + Intronic
1039346157 8:36707941-36707963 AGGCAGAGGCAGGAGGATCCGGG - Intergenic
1039751915 8:40486398-40486420 GAGAAGAGGAAGGAGGAGGAGGG - Intergenic
1040350268 8:46559531-46559553 GAAAAGAGGCTGAAGGAGCCAGG + Intergenic
1041452008 8:58015548-58015570 TTGAAAAGGCATGAGGGGCCGGG + Intronic
1041691883 8:60695071-60695093 GGGAAGAGGGACTAGGAGCCTGG + Intronic
1042190884 8:66186020-66186042 ATGAAGAGGCTGTAGGAGGCAGG - Intergenic
1042298568 8:67250099-67250121 TTGGAGAGGCAGGTGGAGCCAGG + Intronic
1043101259 8:76049448-76049470 TTGAATAGGCAGCAGGAACCAGG + Intergenic
1043380293 8:79695290-79695312 ATGAAGAGGCAGAAGGACTCAGG + Intergenic
1043777019 8:84282498-84282520 GTAAAAAGGCAGGAGGAGGTAGG + Intronic
1044421791 8:92005094-92005116 GGTGAGAGGGAGGAGGAGCCTGG - Exonic
1044459836 8:92430691-92430713 GGGAAGGGGGAGGAGGTGCCAGG - Intergenic
1045300970 8:100909562-100909584 ATGAACAGACAGGAGGAGACCGG + Intergenic
1045418815 8:101993664-101993686 CAGGAGAGGCAGGAGCAGCCTGG - Intronic
1045479572 8:102581398-102581420 GAGATGGGGCAGGAGTAGCCTGG - Intergenic
1045663049 8:104457956-104457978 GTGAAGACGCAGGAGTAGAGAGG - Intronic
1045775475 8:105797569-105797591 GAGAAGAGGCTGTAGGAGGCAGG - Intronic
1047523177 8:125611307-125611329 GTTAAGAGAGAGGAGGACCCTGG + Intergenic
1048045186 8:130766397-130766419 GTGAGGATGCAGGAGGAGTCAGG + Intergenic
1048264379 8:132972649-132972671 GTGAGGAGAATGGAGGAGCCTGG + Exonic
1049083110 8:140457857-140457879 GAAAAGAGGAAGGAGGAGCGAGG + Intronic
1049268372 8:141681463-141681485 GTGATGGGGGAGGAGGGGCCAGG + Intergenic
1049269658 8:141687563-141687585 ATGAGGAGGCAGGAGGGGCAGGG + Intergenic
1049414566 8:142489270-142489292 GGGAAGGGCCAGGAGGAGCCTGG + Intronic
1049674854 8:143884879-143884901 CTGGTGAGGCAGGAGCAGCCAGG - Intergenic
1049721409 8:144117242-144117264 GTGAAGAGGCAGGTTCAGCTGGG - Exonic
1049728534 8:144163315-144163337 GTGAAGAGGCAGAGGGAACTTGG + Intronic
1050498397 9:6268207-6268229 TAGAAGTGGCAGGAGGGGCCCGG + Intergenic
1051898486 9:22013057-22013079 GTGAAGAGGCAGCAGTAGGATGG - Intronic
1052625285 9:30967505-30967527 GTGAAAAGACTGGAGGAGCAGGG + Intergenic
1053074354 9:35120229-35120251 GTGAAGAGGGAGGAAGAGAAGGG - Intergenic
1054730504 9:68698142-68698164 GCCATGAGACAGGAGGAGCCAGG + Intergenic
1054927255 9:70601464-70601486 GTGAAGAGGCAGGAAGGGCATGG + Intronic
1055248088 9:74271128-74271150 AGGAAGAGGCTGGAGGAGCAAGG + Intergenic
1055868271 9:80842093-80842115 GGGAAATGGCAGGAGGAGACAGG - Intergenic
1056950372 9:91036578-91036600 GTGATGGGGCAGGAGGAGGAGGG - Intergenic
1057081453 9:92177190-92177212 GGTAAGTGGCAGCAGGAGCCAGG + Intergenic
1057222061 9:93262785-93262807 GGGAAGCAGCAGCAGGAGCCAGG - Intronic
1058684908 9:107471464-107471486 GTGATATGGCAGTAGGAGCCTGG + Intergenic
1058731725 9:107856816-107856838 GTTTACAGCCAGGAGGAGCCTGG - Intergenic
1058885326 9:109318645-109318667 GAGAGGAGGCCTGAGGAGCCGGG - Intronic
1059330608 9:113533167-113533189 GTGAAGAGGCAGGAAGGGCATGG - Intronic
1060341307 9:122779421-122779443 CTTAAGAGGCAGCAGCAGCCGGG + Intergenic
1060500606 9:124151037-124151059 GAGAAGATGCAGGAGGATGCTGG - Intergenic
1060533854 9:124367175-124367197 GTGAGGAGGAAGCAGCAGCCAGG + Intronic
1060666868 9:125436922-125436944 GGGCAAAGGCAGGAGGAGCTCGG - Intergenic
1061161543 9:128898405-128898427 GTAAAGAGACAGGCGGGGCCTGG - Intronic
1061257299 9:129460301-129460323 GGGAGGAGGGAGGAGGAGCAGGG - Intergenic
1061584368 9:131556374-131556396 GGGCAGAGACAGGAGGAGCAAGG - Intergenic
1061614925 9:131773330-131773352 GTCAAGAGGCAGAGGGAGCCAGG - Intergenic
1061716388 9:132521041-132521063 GAGGACAGGCTGGAGGAGCCAGG - Intronic
1061941403 9:133886110-133886132 GTGAAGGGGCTGGAGCAGGCGGG + Intronic
1062033594 9:134372897-134372919 GTGAAGGGGCAGCAGGAGAGGGG + Intronic
1062065714 9:134525202-134525224 GTCCTGAGGCAGCAGGAGCCAGG - Intergenic
1062141669 9:134962537-134962559 GTTAAGGGGCATGTGGAGCCAGG - Intergenic
1062274939 9:135726146-135726168 GGGAGGGGACAGGAGGAGCCAGG + Intronic
1062545123 9:137058995-137059017 GGGAAGAGGCAGCAGGTGGCAGG - Intergenic
1062580406 9:137226909-137226931 AGGATGAGGCAGGAGGAGGCTGG + Intergenic
1203731411 Un_GL000216v2:94766-94788 GAGATGAGGAAGGAGAAGCCAGG - Intergenic
1186472441 X:9832163-9832185 TTGAAGAGGCAGGATGACCTTGG + Intronic
1186495091 X:10006749-10006771 CTGAAGCAGCAGCAGGAGCCTGG + Intergenic
1187500206 X:19833118-19833140 GGAAAGAGAGAGGAGGAGCCTGG - Intronic
1187500308 X:19833463-19833485 GGAAAGAGGGAGGAGGACCCTGG - Intronic
1187536880 X:20149053-20149075 GTGAAGAGGCAGCAAGAGGGCGG + Intergenic
1187764867 X:22630369-22630391 GTGAAGAGGCAGGCGGGGATAGG + Intergenic
1190681574 X:52830930-52830952 CTGTGGAGGCAGCAGGAGCCAGG + Intergenic
1190792210 X:53711024-53711046 GTGAAGAGGCAGCAAGAGAGAGG + Intergenic
1191851157 X:65587463-65587485 ATGAAGAGGGAAGAGGAGCCAGG + Intergenic
1195703813 X:107724222-107724244 GGGCAGTGGCAGGAGGAGGCAGG + Intronic
1195745800 X:108116733-108116755 CTGGAGAGGAAGGTGGAGCCAGG - Intronic
1195934581 X:110112725-110112747 GTGAAGAGGCAGCATGAGGGTGG - Intronic
1196552325 X:117043664-117043686 GAGATGAGGCAGGAAGAGCAAGG + Intergenic
1197432047 X:126378021-126378043 GGGAATAGGCAGAATGAGCCTGG + Intergenic
1197725374 X:129772990-129773012 GTGACGAGCCATGAGGAGCAGGG - Intergenic
1198100144 X:133415702-133415724 GAGGGGAGGAAGGAGGAGCCGGG - Intergenic
1198438975 X:136643475-136643497 GTGGAGAGGCAGGAAGACCAGGG - Intergenic
1200047944 X:153412495-153412517 GTTAAAAGGCAGTAAGAGCCGGG + Intergenic
1200324052 X:155218871-155218893 GTTAAGAGACAGGAGGTGCCTGG - Intronic