ID: 1136472986

View in Genome Browser
Species Human (GRCh38)
Location 16:30494268-30494290
Sequence GCCCCTCGATACCAGCACAT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 77}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136472980_1136472986 8 Left 1136472980 16:30494237-30494259 CCGGCAAAAGACTTCGTTGCTGG 0: 1
1: 0
2: 1
3: 4
4: 67
Right 1136472986 16:30494268-30494290 GCCCCTCGATACCAGCACATGGG 0: 1
1: 0
2: 2
3: 12
4: 77
1136472977_1136472986 13 Left 1136472977 16:30494232-30494254 CCCTCCCGGCAAAAGACTTCGTT 0: 1
1: 0
2: 0
3: 2
4: 47
Right 1136472986 16:30494268-30494290 GCCCCTCGATACCAGCACATGGG 0: 1
1: 0
2: 2
3: 12
4: 77
1136472974_1136472986 27 Left 1136472974 16:30494218-30494240 CCGTGACCTGGCTGCCCTCCCGG 0: 1
1: 0
2: 1
3: 34
4: 309
Right 1136472986 16:30494268-30494290 GCCCCTCGATACCAGCACATGGG 0: 1
1: 0
2: 2
3: 12
4: 77
1136472978_1136472986 12 Left 1136472978 16:30494233-30494255 CCTCCCGGCAAAAGACTTCGTTG 0: 1
1: 0
2: 0
3: 1
4: 30
Right 1136472986 16:30494268-30494290 GCCCCTCGATACCAGCACATGGG 0: 1
1: 0
2: 2
3: 12
4: 77
1136472976_1136472986 21 Left 1136472976 16:30494224-30494246 CCTGGCTGCCCTCCCGGCAAAAG 0: 1
1: 0
2: 0
3: 22
4: 131
Right 1136472986 16:30494268-30494290 GCCCCTCGATACCAGCACATGGG 0: 1
1: 0
2: 2
3: 12
4: 77
1136472979_1136472986 9 Left 1136472979 16:30494236-30494258 CCCGGCAAAAGACTTCGTTGCTG 0: 1
1: 0
2: 0
3: 7
4: 80
Right 1136472986 16:30494268-30494290 GCCCCTCGATACCAGCACATGGG 0: 1
1: 0
2: 2
3: 12
4: 77

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136472986 Original CRISPR GCCCCTCGATACCAGCACAT GGG Exonic
900948199 1:5843203-5843225 GGCCCTGCAGACCAGCACATGGG - Intergenic
900955065 1:5881581-5881603 GCCTCTCTCTACCACCACATCGG - Intronic
902329861 1:15725976-15725998 ACCCCCTGATACCATCACATTGG + Intronic
907627203 1:56041854-56041876 ACTCCTCAATACCATCACATTGG + Intergenic
907811211 1:57872237-57872259 GCCTCTTAATACCATCACATTGG - Intronic
916882612 1:169034472-169034494 GCCTCTGAATACCATCACATTGG + Intergenic
1079960087 11:26913385-26913407 GCCTCTCAATACCGGCACATTGG - Intergenic
1084269364 11:68020913-68020935 GCCCCTGGAGGCCAGCACAGAGG + Intronic
1084675357 11:70630867-70630889 GCCCCAGGACACCAGCACAAAGG + Intronic
1085520598 11:77137085-77137107 GCCCATCTATAGCAGTACATTGG - Intronic
1087800225 11:102495881-102495903 GCCCCTCCCAACCAGCCCATCGG + Intronic
1089753390 11:120667838-120667860 GCCTCTCGAGTCCAGCACAGTGG - Intronic
1089881597 11:121779033-121779055 GCCCCAAGATAAAAGCACATTGG + Intergenic
1091590972 12:1842778-1842800 CACCCTCGATAGCAGCACATTGG - Intronic
1095741915 12:45616733-45616755 GCCCCTCAATCCCAGCACATTGG + Intergenic
1095769291 12:45934569-45934591 CAGCATCGATACCAGCACATTGG + Intronic
1102608689 12:114091626-114091648 ACCCCTAGATAACATCACATAGG - Intergenic
1104994079 12:132643191-132643213 GGCCCTCCATGGCAGCACATTGG - Intronic
1111999448 13:95196460-95196482 ACCTCTCAATACCATCACATTGG - Intronic
1113449949 13:110401979-110402001 ACCTCTCAATACCAGCAGATTGG + Intronic
1116250666 14:42479087-42479109 GCCTCTTAATACCATCACATTGG - Intergenic
1117718426 14:58604375-58604397 GCCCCTCCATCCCAGAACTTTGG + Intergenic
1125091941 15:35803007-35803029 GCCTCTTAATACCATCACATTGG + Intergenic
1131560717 15:93437114-93437136 ACCTCTCAATACCATCACATTGG - Intergenic
1135138345 16:19901213-19901235 ACCTCTCAATACCATCACATTGG - Intergenic
1136472986 16:30494268-30494290 GCCCCTCGATACCAGCACATGGG + Exonic
1136599892 16:31278020-31278042 GCACCTCGATATCAGCACATCGG + Exonic
1136610529 16:31362664-31362686 GCCCCCCGCTACCAGCACACCGG + Exonic
1136618103 16:31410789-31410811 GCCCCCCGCTACCAGCATACCGG + Exonic
1137284641 16:47005039-47005061 ACCTCTCAATACCATCACATTGG + Intergenic
1141706514 16:85668229-85668251 GCCCCTCCACCCCAGCACAATGG + Exonic
1142563483 17:824967-824989 GCCCCACGATCCCAGCACTTTGG + Intronic
1143646037 17:8230874-8230896 GCCCCTAAATCCCAGCACTTTGG + Intronic
1148264747 17:46216724-46216746 GACCCTCGACACCTACACATAGG - Intronic
1153960368 18:10135075-10135097 GCCCCTGGGCATCAGCACATGGG - Intergenic
1153961666 18:10145386-10145408 GCCCCTGGGCATCAGCACATGGG - Intergenic
1155528886 18:26745515-26745537 ACCCCACGACACCAGCTCATAGG - Intergenic
1162623063 19:11860179-11860201 GCTCCTCAATCCCAGCACTTTGG + Intronic
1163612454 19:18308515-18308537 GCCCCTGGCACCCAGCACATGGG - Intronic
1165958699 19:39517396-39517418 GCCCCTCCACACCAGCCCATGGG - Intronic
1166337831 19:42119411-42119433 GCCCCTTAATCCCAGCACTTTGG + Intronic
1166518220 19:43462977-43462999 GCCCTACGATACAAGCACCTAGG + Intronic
925922174 2:8645406-8645428 GCCCCTCGGTGCCAGGGCATGGG + Intergenic
930899579 2:56487499-56487521 ACCCCTAGATGACAGCACATAGG + Intergenic
931425058 2:62163203-62163225 GCCTCCAAATACCAGCACATTGG + Intergenic
931517346 2:63057864-63057886 GCCCCCCGAGACCAGGACCTCGG - Intergenic
932496840 2:72149712-72149734 GCCCCTCCTTTCCTGCACATTGG + Intergenic
934966070 2:98723620-98723642 GCTCGTTAATACCAGCACATAGG - Intronic
937008115 2:118536369-118536391 GCCCCTGTATGGCAGCACATGGG - Intergenic
937998596 2:127713988-127714010 GGCCCTCCAAACCATCACATGGG - Exonic
939283655 2:140100127-140100149 ACCTCTCAATACCAGCACATTGG - Intergenic
942288245 2:174443466-174443488 GCCCGTTAATACCAGCACTTTGG + Intronic
946517036 2:220423757-220423779 GCCCCCCAATACCATCACACTGG + Intergenic
1169949785 20:11031176-11031198 ACCTCTCAATACCAACACATTGG + Intergenic
1172373382 20:34415296-34415318 ACCCCTTGATCCCAGCACTTTGG + Intronic
1173518731 20:43683468-43683490 TCTCCTCGATACCAGCCCAGAGG + Intronic
1174335247 20:49855049-49855071 GCCCCTCGCCACCAGCCCCTTGG - Intronic
1177669458 21:24207764-24207786 GCCTCTTGATACCACCACAGTGG - Intergenic
1177828073 21:26106255-26106277 GACCCTCGGTTCCAGCACCTAGG + Intronic
951312755 3:21149207-21149229 ACCTCCCGATACCATCACATTGG - Intergenic
956588296 3:70886737-70886759 ACCTCTCAATACCACCACATTGG - Intergenic
959110750 3:102119560-102119582 GCCTCTTAATACCATCACATTGG + Intronic
967185681 3:186942557-186942579 TGCCCTCGATTCCAGCACAGAGG - Intronic
982055319 4:151543338-151543360 GCCCCTCACCACCAGCCCATAGG + Intronic
983480138 4:168263545-168263567 GCCTCCAGATACCATCACATTGG - Intronic
984013696 4:174401724-174401746 ACCCCTTCATACCAGCACATGGG + Intergenic
985247048 4:187989378-187989400 GCCTCTTGATACCATCACATCGG + Intergenic
985713843 5:1445165-1445187 GCCCCCCGATAGCGCCACATGGG - Intronic
986447600 5:7836127-7836149 GCCTCCCAATACCACCACATGGG + Intronic
990342091 5:54833646-54833668 GCCCCTAGATATCAGCAGATGGG - Intergenic
994111263 5:96007505-96007527 ACCTCTAGATACCATCACATTGG - Intergenic
995345664 5:111113945-111113967 CCCTCTCAATACCATCACATTGG + Intronic
1012679501 6:102161646-102161668 GCCTCTTAATACCATCACATTGG + Intergenic
1013212333 6:107998298-107998320 GCCTCTAAATACCATCACATTGG + Intergenic
1017852372 6:158315907-158315929 ACCTCTTGATACCACCACATGGG + Intronic
1018396419 6:163381280-163381302 CCCCCTCGATATGAGCACAGAGG + Intergenic
1022550576 7:31235473-31235495 GCCCATGGATACCAGCACACGGG + Intergenic
1024351211 7:48366800-48366822 ACCTCTCAATACCATCACATGGG + Intronic
1024537764 7:50452135-50452157 GCCCCTTAAAACCATCACATTGG - Intronic
1024915491 7:54494289-54494311 GCCTCTTTATACCATCACATGGG - Intergenic
1026426782 7:70302732-70302754 GCCCCTCAAGACCATCAAATTGG - Intronic
1030597205 7:111554400-111554422 GCCCCACGATAGCAGCAGAAGGG - Intronic
1040822295 8:51575452-51575474 GCCCCTGAATCCCAGCACATTGG + Intronic
1043495504 8:80796442-80796464 ACCTCTCAATACCACCACATTGG + Intronic
1048988853 8:139749801-139749823 GCCCCTCCAGTCCAGCACAGGGG - Intronic
1055501946 9:76910010-76910032 ACCTCCTGATACCAGCACATTGG - Intergenic
1059106000 9:111512146-111512168 TTCCCCCGATACCAGCACTTTGG + Intergenic
1060425071 9:123497581-123497603 GCCCTTCTATCCCAGCACTTTGG - Intronic
1185558335 X:1038945-1038967 GCCTCCCGATACCATCACATTGG + Intergenic
1196717758 X:118826594-118826616 GGTCTTGGATACCAGCACATTGG + Exonic
1196871185 X:120115330-120115352 CCCCCTCCACACCAGCACAAAGG + Intronic
1198002947 X:132458701-132458723 GCCTCTCAATACCATTACATTGG + Intronic