ID: 1136474342

View in Genome Browser
Species Human (GRCh38)
Location 16:30503198-30503220
Sequence GAGTCGATAATTGTTGAAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 422
Summary {0: 1, 1: 2, 2: 34, 3: 108, 4: 277}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136474342 Original CRISPR GAGTCGATAATTGTTGAAAC TGG (reversed) Intronic