ID: 1136476681

View in Genome Browser
Species Human (GRCh38)
Location 16:30517874-30517896
Sequence GGAGCTGGTGGGAGAGATCG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 487
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 458}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136476671_1136476681 25 Left 1136476671 16:30517826-30517848 CCCTGTTGTCTTCAGGCAGGAGA 0: 1
1: 0
2: 2
3: 28
4: 235
Right 1136476681 16:30517874-30517896 GGAGCTGGTGGGAGAGATCGAGG 0: 1
1: 0
2: 1
3: 27
4: 458
1136476675_1136476681 1 Left 1136476675 16:30517850-30517872 CCTCGTCCAAGTGATCGGGACTC 0: 1
1: 0
2: 0
3: 2
4: 43
Right 1136476681 16:30517874-30517896 GGAGCTGGTGGGAGAGATCGAGG 0: 1
1: 0
2: 1
3: 27
4: 458
1136476677_1136476681 -5 Left 1136476677 16:30517856-30517878 CCAAGTGATCGGGACTCTGGAGC 0: 1
1: 0
2: 2
3: 2
4: 83
Right 1136476681 16:30517874-30517896 GGAGCTGGTGGGAGAGATCGAGG 0: 1
1: 0
2: 1
3: 27
4: 458
1136476672_1136476681 24 Left 1136476672 16:30517827-30517849 CCTGTTGTCTTCAGGCAGGAGAT 0: 1
1: 0
2: 0
3: 16
4: 192
Right 1136476681 16:30517874-30517896 GGAGCTGGTGGGAGAGATCGAGG 0: 1
1: 0
2: 1
3: 27
4: 458

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136476681 Original CRISPR GGAGCTGGTGGGAGAGATCG AGG Exonic
900549907 1:3249248-3249270 GGATGTGGTTGGAGAGATGGAGG + Intronic
900763600 1:4488800-4488822 GGAGCTGGTGGGGAAGCTCATGG + Intergenic
901434453 1:9238163-9238185 GGACCTGGTGGGGGACATGGGGG + Intronic
901476654 1:9494823-9494845 GGAGTTGCTGGGAGAGAAGGAGG + Intergenic
901769946 1:11524935-11524957 GGAGGTGGTGAGGGAGATAGTGG - Intronic
901927116 1:12573279-12573301 GGAGCTGGGAGGAGAGAGCCAGG - Intronic
902571837 1:17352096-17352118 GGAGGTGGTAGGAGAGACTGTGG + Intronic
902680369 1:18039707-18039729 GGGGCTGGTAGGAAAGATGGAGG + Intergenic
902680549 1:18041120-18041142 GGAGCTGGTAGGAAAGTTGGAGG + Intergenic
903046755 1:20570085-20570107 GTAGCAGGTGGGAGAAATCAGGG - Intergenic
903558765 1:24212283-24212305 GGAGGTGGTGTGAGTGATGGAGG + Intergenic
903774059 1:25781687-25781709 GGGGGTGGTGGGGGAGATAGGGG - Intronic
904293496 1:29502796-29502818 GGAGCTGGTGGCAGAGGTTTGGG + Intergenic
904352151 1:29915495-29915517 AGAGCTGGTGGGGGAGATCAGGG - Intergenic
904771281 1:32882671-32882693 GCAGATGGTGGGACAGATGGAGG - Intergenic
905199139 1:36304754-36304776 GGAGCTGCTGGTGGAGAACGGGG - Exonic
905667227 1:39770508-39770530 GGTGGAGGTGGAAGAGATCGTGG - Exonic
906648105 1:47490618-47490640 GTAGCTGGGGGCAGAGATTGTGG - Intergenic
907118609 1:51990274-51990296 GGGGCTGGGAGGAGAGATGGGGG - Intronic
907408777 1:54270351-54270373 GGAGCTGCCGGGGGAGGTCGAGG - Intronic
907553760 1:55326950-55326972 GGAGCTAGTGTGAGAGGTAGAGG + Intergenic
907909762 1:58815535-58815557 GGAGCAGGTGGAAGAAATCCAGG + Intergenic
908266487 1:62384437-62384459 GGAGCAGGAGGAAGAGAGCGAGG - Intergenic
909957718 1:81800820-81800842 GGAGCTGGAGGCAGAGCTCGGGG + Intronic
910104370 1:83615549-83615571 GCAGCTGCTGGGAGAGCTGGGGG - Intergenic
910224632 1:84923867-84923889 TGAGCTGGTAGGAGAGAGTGTGG - Intergenic
911737137 1:101350028-101350050 GGAGCTGGGGAGTGAGATGGCGG - Intergenic
912659271 1:111513937-111513959 GGAGCTGGTGGGAGGGGCTGTGG + Intronic
913131434 1:115841137-115841159 GGAGATGGTGGAAGAGATAAAGG + Exonic
914521943 1:148425582-148425604 GAAGCTGGTGGGAGTCATGGCGG - Intergenic
914915605 1:151817374-151817396 GGAGCTGGTTGGAGAAGTAGTGG - Intronic
916008230 1:160681031-160681053 GGAGGTGGTGGTAGAGCTGGTGG + Intronic
916808210 1:168280804-168280826 GGATCAGGTGGGAGAGAGCCTGG - Intergenic
917442173 1:175077757-175077779 GAAGCTGGAGGAAGAGATGGTGG + Exonic
917747617 1:178026127-178026149 GAAGCTGGTGGGCGAGGGCGGGG - Intergenic
918276702 1:182959754-182959776 GCAGCTGGAGACAGAGATCGAGG - Intergenic
919177083 1:194032862-194032884 GGACCTGGTGGGAGATATTTTGG - Intergenic
919742661 1:200990218-200990240 GGAGCTGGCTGAGGAGATCGAGG - Exonic
920298727 1:204975614-204975636 GGAGCTGGTGGGAGAGAGGGAGG - Intronic
920366693 1:205451545-205451567 GGAGTTGGGGGGAGTGGTCGGGG + Intronic
920669904 1:207995614-207995636 GGAGCTGGTGGAACAGGTGGGGG + Intergenic
922425472 1:225488436-225488458 GTAGCTGGTGGGAGCGAGAGAGG - Exonic
922469485 1:225867065-225867087 GGTGCTGATGGGTGAGATCAAGG - Intronic
923146480 1:231202190-231202212 GGAGGTGGTGGCTGAGATAGTGG + Intronic
923203325 1:231733572-231733594 GGTGATGGTGGGAGTGATGGTGG + Intronic
923203338 1:231733641-231733663 GGTGATGGTGGGAGTGATGGTGG + Intronic
924624562 1:245688124-245688146 GGAGCTGGGGGGCGAGGTCCCGG - Exonic
924921057 1:248629514-248629536 GGAGATCGTGGGAAAGTTCGTGG - Intergenic
1063493956 10:6489762-6489784 GTAGGTGGTAGGAGAGAGCGGGG + Intronic
1064598806 10:16972759-16972781 GGGGCTGGTGATAGAGATGGTGG - Intronic
1064696629 10:17973826-17973848 GGAGATGGGGAGAGAGATAGGGG - Intronic
1064860282 10:19817762-19817784 GGAGCAGGTGGGAAAGGTGGAGG + Intronic
1065069926 10:22012972-22012994 GGAGCTGGTGGAAGTCAGCGTGG - Intergenic
1065257290 10:23883778-23883800 AGAGTTGGGGGGAGAGATGGAGG - Intronic
1065625343 10:27624170-27624192 GGAGGTGATGGGAAAGATGGGGG + Intergenic
1065846461 10:29747549-29747571 GGAGTTGGGGGGAGGGGTCGAGG + Intergenic
1065877195 10:30007734-30007756 GCAGCTGGTGGGTGAGACTGGGG - Intergenic
1067983674 10:51116740-51116762 GGAGATGATGGGAGAGAGGGTGG + Intronic
1069635271 10:69921237-69921259 GGAGATGGAGGCAGAGATTGGGG - Intronic
1072199551 10:93145891-93145913 GGAGCTGGTGAGAGAGCTGGCGG - Intergenic
1073047776 10:100650977-100650999 GGAGGTGGTGGGAGTGGTGGAGG - Intergenic
1073047792 10:100651031-100651053 GGAGGTGGTGGGAGTGGTGGAGG - Intergenic
1073047829 10:100651139-100651161 GGAGGTGGTGGGAGTGGTGGAGG - Intergenic
1073047930 10:100651445-100651467 GGAGGTGGTGGGAGTGGTGGAGG - Intergenic
1073047948 10:100651499-100651521 GGAGGTGGTGGGAGTGGTGGAGG - Intergenic
1073047983 10:100651607-100651629 GGAGGTGGTGGGAGTGGTGGAGG - Intergenic
1073396832 10:103224940-103224962 GGAGCAAGAGGAAGAGATCGGGG + Intergenic
1073544955 10:104339797-104339819 GGAGGTGGTGGGGGCGATCTGGG + Intergenic
1074702038 10:116100945-116100967 GGCCCTGGTGGGAAAGATGGGGG + Intronic
1074765763 10:116698974-116698996 GGAGCTAGAGGGAGAGAAGGAGG - Intronic
1075693233 10:124415030-124415052 AGTGCTGGTGGCACAGATCGTGG - Intronic
1075974852 10:126686180-126686202 TGAGGTGGTGGGAGACATCATGG - Intergenic
1077144080 11:1037048-1037070 GGACCTGTTGGGGGAGGTCGGGG + Intergenic
1077198037 11:1291348-1291370 GGAGCTGGTGATAGAGACCCCGG + Intronic
1077574952 11:3375907-3375929 GGTGCTGGTGAGAGAGTTCCTGG + Intronic
1077842933 11:5994551-5994573 GCAGCTGGAGACAGAGATCGAGG - Intergenic
1079021353 11:16911756-16911778 GGAGCAGGTGGGAGAGCGTGGGG - Intronic
1079063119 11:17266942-17266964 GGAGCTGGTGGGTGGGAGTGGGG + Intronic
1079321601 11:19456095-19456117 GGAGCTGGTGGGAGCAATCCAGG - Intronic
1081520790 11:43879193-43879215 GGAGGTGGTGGTAGAGACCATGG - Intergenic
1081855305 11:46299687-46299709 GGAGCTGGTGGTAGAGAGAATGG + Intronic
1082796480 11:57381508-57381530 GGAGCTGGTGGGAGACAATGGGG + Intergenic
1083378524 11:62245355-62245377 GGAGCTCTTGGGAGAGCTTGAGG - Intergenic
1083419937 11:62546865-62546887 GGAGCTGTGGGGAGAGGGCGGGG + Intronic
1083432611 11:62622071-62622093 GGAGCTGGTAGGGGAGTGCGAGG - Exonic
1083610430 11:64001681-64001703 GGAGCAGGTGGAAGGGATCCAGG - Intronic
1083780376 11:64914440-64914462 GGAGCTGGTGGAAGGCTTCGTGG - Exonic
1084409792 11:69000142-69000164 GGAGCTGGAGGCAGGGATGGGGG - Intergenic
1085054141 11:73394323-73394345 TGGGCTGGTGGGAGATAACGGGG + Intronic
1085446516 11:76604429-76604451 GGAGCAGGTGGGAGAGAGGCGGG - Intergenic
1086479558 11:87219467-87219489 GGGGCTGGGGGGAGAGAGCCAGG + Intronic
1089074304 11:115725880-115725902 GGAGATGGTGGCAGTGATGGTGG - Intergenic
1089160409 11:116432732-116432754 GGAGCTGGTGGGAGCGAGGCAGG - Intergenic
1090675210 11:128986019-128986041 GGAGCTGCTGGATGACATCGTGG + Exonic
1090990914 11:131815953-131815975 GGAGATGGGGAGAGAGATGGCGG + Intronic
1091000579 11:131907644-131907666 GGAGATGGTGGGAAAGAGGGTGG + Intronic
1091446182 12:545485-545507 GGAGCAGATGGGAGGGACCGGGG - Intronic
1092100721 12:5881691-5881713 GGAGCTGGAGGGAGTGATGGGGG - Intronic
1092163853 12:6330549-6330571 GGAGCTGGTGGGGGTGAGGGAGG - Intronic
1093958545 12:25250007-25250029 GGAGGTGGAGGTAGAGATGGTGG - Intronic
1094019880 12:25902823-25902845 GGAGCTGGTGGCAAAGATTAGGG + Intergenic
1094427045 12:30326963-30326985 GGCCATGGTGGGAGAGATGGAGG - Intergenic
1095945568 12:47751480-47751502 GGAGCTGGTGGATGGGATCTTGG - Exonic
1096634715 12:52950840-52950862 GCAGCTGGAGACAGAGATCGAGG + Exonic
1097264376 12:57737351-57737373 GGAGTTGGTGGGAGGGTTAGCGG + Exonic
1098582932 12:72122070-72122092 GGAGGTGGTGGGAGAAATGAGGG + Intronic
1101422849 12:104563741-104563763 GGATCTGGTGGGAGTGGTTGTGG + Intronic
1102028297 12:109725960-109725982 TGAGCTGGTGGGAGAGAGAAAGG + Intronic
1102063377 12:109952339-109952361 GGTGCGGGTGGGAGAGACCTCGG - Intronic
1102144807 12:110646824-110646846 GAAACTGGTGGGAGGGATGGAGG - Intronic
1102518581 12:113465638-113465660 GGAGGCGGTGGGATAGGTCGGGG + Intronic
1103741212 12:123092833-123092855 GGGGCTCGGGGGAGAGGTCGAGG - Intronic
1104595017 12:130115070-130115092 GGAACTGGAGGGAGAGAGGGAGG - Intergenic
1104982892 12:132582043-132582065 GGAGCTGGGGGCAGAGGCCGGGG - Exonic
1105438331 13:20395902-20395924 GGAGGGGGTCGGAGAGATCCAGG - Intergenic
1106196164 13:27495938-27495960 GGAGCTGGTGGATGAGAACTTGG + Intergenic
1107529000 13:41263795-41263817 GGAGATGGTGGGAGGGAGGGAGG + Intergenic
1108332596 13:49404979-49405001 GGAGGTAGAGAGAGAGATCGGGG + Intronic
1114529122 14:23384519-23384541 GGAGCTGGAGGGTGAGCTGGAGG - Exonic
1115763615 14:36600499-36600521 GGAGCTGCTGGGAGAGGCCATGG + Intergenic
1116669032 14:47817568-47817590 GCAGCTGCTGTGAGAGATGGAGG + Intergenic
1118156619 14:63248846-63248868 GGAGCTGCTGGGAGCCATCTGGG - Intronic
1120874354 14:89362537-89362559 GGAGGTGGTGGTGGAGATGGTGG - Intronic
1120874384 14:89362651-89362673 GGAGGTGGTGGTGGAGATGGTGG - Intronic
1120874403 14:89362714-89362736 GGAGGTGGTGGTGGAGATGGTGG - Intronic
1120874425 14:89362786-89362808 GGAGGTGGTGGTGGAGATGGTGG - Intronic
1121234996 14:92385809-92385831 GGAGCTGGGAGGAAGGATCGTGG - Intronic
1121666766 14:95678159-95678181 GGAGCTGGTGAGGGAGAACCAGG - Intergenic
1122112140 14:99510328-99510350 GGAGCTGGTGGTGGACATCCCGG - Exonic
1122163805 14:99805965-99805987 GGAGCTGGCGGGGGAGAGTGGGG - Intronic
1124013793 15:25860220-25860242 GGTGCTGCAGTGAGAGATCGGGG - Intronic
1127369208 15:58321401-58321423 GGAGCTGGAGGGAGAGAGAATGG + Intronic
1128309822 15:66622883-66622905 GGTGCTGGTGGCAGAGAACATGG + Intronic
1129598407 15:76982728-76982750 GGAGCGGGAGGGAGAGAGCTTGG + Intergenic
1130048901 15:80467273-80467295 GGAGAAGGTGGGAGAGAACCAGG + Intronic
1130603438 15:85293933-85293955 GGAGCAGGAGGGAGACAGCGGGG + Intergenic
1130926072 15:88386783-88386805 GAAGGTGGTGGGAGAGACAGTGG - Intergenic
1131356433 15:91750107-91750129 GGAGGTGGTGGTGGAGATGGTGG + Intergenic
1131402343 15:92135163-92135185 AAAGCTGGAGGGAGAGATGGAGG + Intronic
1132169464 15:99634232-99634254 GAAGTTGGTGGGAGAGATGAGGG + Intronic
1132335870 15:101048370-101048392 GGAGAGGGTGGGAAAGATGGGGG + Intronic
1132752747 16:1466302-1466324 GAAGGTGGAGGGAGAGATGGGGG - Intronic
1134857673 16:17534138-17534160 TGAGCTGGTGGCAGAGAAGGTGG + Intergenic
1136138573 16:28274045-28274067 GGGGCTGGCGGGAGAGAGGGAGG + Intergenic
1136476681 16:30517874-30517896 GGAGCTGGTGGGAGAGATCGAGG + Exonic
1137798151 16:51239258-51239280 GGAGATGGTGGTAGATATGGTGG + Intergenic
1138205238 16:55119816-55119838 GCAGATGGTGGGATAGATCCTGG - Intergenic
1139285296 16:65807819-65807841 GGAGTTGGCTGGAGAGATTGAGG + Intergenic
1139356022 16:66367425-66367447 GGTGCTGGTGGGAGGAATGGTGG - Intronic
1139427920 16:66894613-66894635 GGAGCAGGTGAGAGAGAAGGAGG + Intronic
1139753113 16:69121112-69121134 GGAGCTACAGGGGGAGATCGAGG - Exonic
1140199126 16:72880170-72880192 GAAGGTGGTGGGAGAGATGAAGG - Intronic
1141040579 16:80669491-80669513 GGAGATGGTGGCACAGATCTGGG + Intronic
1141114880 16:81299888-81299910 GGAGTTGGTGGGAAAGTTGGGGG + Intergenic
1142087589 16:88192208-88192230 TGAGCTGGTGGAAGCGTTCGGGG + Intergenic
1142414415 16:89933832-89933854 AGAGCTGGTGAGACAGAACGGGG + Intronic
1142722118 17:1783390-1783412 CGCCGTGGTGGGAGAGATCGCGG - Exonic
1142809055 17:2386826-2386848 GGAGCTGGTGGGTGAGAGAGTGG + Exonic
1143156201 17:4838168-4838190 GGGGCTGTTTGGAGAGCTCGAGG + Intronic
1143185340 17:5006849-5006871 GGAGCTGATGAGAGACATCCAGG - Intronic
1143516233 17:7420552-7420574 GGAGCTGGTGGGATAGTGGGGGG + Intronic
1143929000 17:10400746-10400768 GGAGCTGGGGGAAGAAATCGAGG - Exonic
1143933150 17:10452297-10452319 GGAGCTGGAGGAGGAAATCGAGG - Exonic
1143937444 17:10501466-10501488 GGAGCTGGAGGAGGAAATCGAGG - Exonic
1143939856 17:10529046-10529068 GGAGCTGGAGGAGGAAATCGAGG - Exonic
1144873103 17:18382551-18382573 GGAGCTGGAGGAACAGATCGCGG + Exonic
1144957002 17:19023665-19023687 AGTGCTGGTGGGCGAGATCCTGG - Intronic
1146469157 17:33110639-33110661 AGGGGTGGTGGGAGAGATCCTGG + Intronic
1146762397 17:35490020-35490042 GGAGGTGGTGGAAGTGTTCGTGG - Intronic
1146790936 17:35750175-35750197 GCAGCTGGAGGAGGAGATCGAGG - Exonic
1147503362 17:40987805-40987827 GGGGCAGGTGAGAGAGAGCGTGG - Intergenic
1147671546 17:42179846-42179868 GGAGCTGGAGGGAGACAGCTCGG - Intronic
1148083859 17:44982476-44982498 GGTGGTGGTGGTAGAGATGGTGG + Intergenic
1148083867 17:44982524-44982546 AGAGCTGGTGGTAGTGATGGAGG + Intergenic
1148184640 17:45633286-45633308 GGAGATGGTGGGAGATATTATGG - Intergenic
1150148791 17:62792979-62793001 GGAGGTGGTGGTAGTGATGGAGG - Intronic
1151241935 17:72764937-72764959 GGAGGTTGTAGGAGAGATGGAGG - Intronic
1151684681 17:75639645-75639667 TGGGCTGGTGGGAGAGGTTGGGG + Exonic
1151938079 17:77275830-77275852 GGAGCTGGTGCGAGGGAAGGAGG - Intergenic
1152273451 17:79339511-79339533 GGAGCTGGTGGGAGGGAAGGAGG + Intronic
1152460681 17:80440736-80440758 GAAGCTGGTGGGAGAGTGTGGGG - Intergenic
1153584989 18:6611945-6611967 GGAGATGGTGGGAGGAAGCGAGG - Intergenic
1155190088 18:23422099-23422121 AGAGCTTGTGGGAGATATTGTGG - Intronic
1155351476 18:24911679-24911701 GGCGCTGGATGGAGAGATAGCGG - Intergenic
1156466531 18:37351102-37351124 GGTGCTGGTGGGGGAGAGGGGGG + Intronic
1157295008 18:46435927-46435949 GGAGCTGGGGAGAGAGGTTGAGG + Intronic
1159795005 18:72831200-72831222 GGAGGTGGTGGTAGAAATCATGG - Intronic
1160255835 18:77248423-77248445 GGAGATAGTGGGAGAGGTGGAGG + Intergenic
1160742236 19:692012-692034 GGAGGTGGTGGGTGAGACGGGGG + Intronic
1160742439 19:693405-693427 GGAGGGGGTGGGTGAGATGGGGG + Intronic
1161366314 19:3881713-3881735 GGGGCTGGTGGGAGTGTTCCTGG + Intronic
1161403769 19:4080867-4080889 GGAGGTGGAGGGAGAGAGGGAGG + Intergenic
1162583863 19:11547064-11547086 GGAGCGGGGGGCAGGGATCGGGG + Intronic
1163398172 19:17076074-17076096 GGAGCTGGTGAGGGAGTTCGAGG + Intronic
1164507840 19:28874165-28874187 GGAGGGGGTGGAAGAGATGGAGG + Intergenic
1164711518 19:30360099-30360121 AGAGCTGGGGGAGGAGATCGGGG + Intronic
1164930607 19:32172979-32173001 GGGGCAGGTGGGAGAGAACCTGG - Intergenic
1166439268 19:42797080-42797102 GGAGCTGGAGGAAGAGAGCAAGG + Intronic
1166457309 19:42952629-42952651 GGAGCTGGAGGAAGAGAGCAAGG + Intronic
1166467640 19:43047059-43047081 GGAGCTGGAGGAAGAGAACAAGG + Intronic
1166494897 19:43293405-43293427 GGAGCTGGAGGAAGAGAGCAAGG + Intergenic
1167374339 19:49103074-49103096 GCAGCTGGTGGGAGGGAGCATGG + Intronic
1167426355 19:49431651-49431673 GGAGCTGGTGGGCGTGGTCAGGG - Intronic
1167571371 19:50290955-50290977 GAAGCTGGAGGGAGAGCTGGAGG + Exonic
1168317773 19:55491522-55491544 GGAGCTGGTGGGAAGGAGGGAGG + Intronic
1168405464 19:56108203-56108225 GGGGCTGGGTGGAGAGAGCGGGG - Intronic
924968587 2:101361-101383 GGAGCGGGTAGGCGAGATGGAGG - Intergenic
926127292 2:10279412-10279434 GGAGCTGATGGCTGAGATGGAGG + Intergenic
927249962 2:20988612-20988634 GGAGATGGTGAGAGAGGTAGAGG + Intergenic
927395773 2:22649777-22649799 AGAGCTGGTGGGAGTGTTCAAGG + Intergenic
927730036 2:25463063-25463085 GGAGCTCGAGGGAGAGGTCAGGG - Intronic
927980028 2:27369343-27369365 GGATGTGGTGGGAGAGATAAGGG - Intronic
929277971 2:40045744-40045766 GTAGCTGGAGGGAGAAATGGAGG - Intergenic
930845598 2:55900308-55900330 AGAGTTGGTGGGGGGGATCGTGG - Intronic
931087683 2:58851552-58851574 GGAGATGGTGGGAGTGATTTGGG + Intergenic
931241769 2:60460778-60460800 GGAGCTGGACGGAGGGATCTCGG - Exonic
931902770 2:66807580-66807602 GGAGGAGGTGGGGGAGATGGAGG + Intergenic
932570210 2:72934513-72934535 GGAGCTGGAGGTAGAGACCAGGG - Exonic
932743142 2:74307402-74307424 GTAGCTGGAGACAGAGATCGAGG - Intronic
934600347 2:95652476-95652498 GGAGGAGGTGGAAGAGATGGAGG - Intergenic
936261171 2:110960531-110960553 GGAGTTGGCGGGATAGGTCGGGG - Intronic
936511077 2:113147878-113147900 GGAGGTGGAGAGAGAGATAGGGG - Intergenic
937304096 2:120860592-120860614 TGAGCTGCAGGGAGAGATCTGGG + Intronic
938150009 2:128874532-128874554 GGAGCTGGTGCGGGAGAGCTGGG - Intergenic
938292616 2:130158168-130158190 GGAGCAGGTGGGAGGAATTGGGG - Intronic
940992068 2:160107615-160107637 GAGGCTGGTGGAAGAGATTGAGG - Intronic
941125693 2:161580658-161580680 GCAGCTGGAGGCAGAGATCAAGG + Intronic
941653344 2:168117313-168117335 GGAGCTGGTGTGAGAGTGCAAGG - Intronic
943548660 2:189311928-189311950 GCAGCTGGAGACAGAGATCGAGG - Intergenic
945162202 2:206904099-206904121 GGAGGTAGAGGGAGAGATCAGGG - Intergenic
947528972 2:230896605-230896627 GGAGCAGGTGTGAGAGAAAGGGG - Intergenic
947708562 2:232295750-232295772 AGTGCTGGGGGCAGAGATCGGGG - Intronic
947831318 2:233143877-233143899 GGAGATGGTGGTAGTGATGGTGG + Intronic
947831510 2:233144753-233144775 GGAGATGGTGGTAGTGATGGTGG + Intronic
948429564 2:237911210-237911232 GGAGCTGGTGGCAGAGGTTCGGG + Intronic
948642335 2:239383648-239383670 GTACCTGGTGGGAGAAAGCGCGG + Intronic
948858699 2:240742706-240742728 GGAGCTGGTGGCAGAGGTGTGGG - Intronic
948867238 2:240782337-240782359 GGGGCTGCTGGGAGACACCGAGG - Intronic
1168841707 20:913968-913990 GGAGGTGTTGGGGGAGATCCAGG + Intronic
1168877317 20:1180691-1180713 GGTGCTGGAGGGAGAGCTCGGGG - Exonic
1168889627 20:1286423-1286445 GGAGCTGGGAGGAGAGATGAAGG + Intronic
1169468196 20:5860055-5860077 GGGGTGGGTGGGAGAGAGCGGGG - Intronic
1169670629 20:8096956-8096978 GGAGCTGGGAGGAGAGACTGTGG - Intergenic
1171146470 20:22788190-22788212 GGGGCTGCTGGGAGAGACTGAGG - Intergenic
1172596377 20:36153909-36153931 GCAGCTTGTGGCAGAGATCATGG - Intronic
1172623655 20:36335309-36335331 GGAGCTGGTGGGACACACCTGGG + Intronic
1172877612 20:38175390-38175412 GGAGCTGGTGGGGGAGGGGGAGG + Intergenic
1173656511 20:44703538-44703560 GGAGATGGTAGCAGTGATCGTGG - Intergenic
1173752337 20:45487349-45487371 GGAGCGGGTGGGAGAGGCTGAGG - Intergenic
1173998154 20:47355823-47355845 GGGGGTGGGGGGAGAGATCTTGG - Intronic
1174349587 20:49957333-49957355 GCAGCTGGAGACAGAGATCGAGG + Intergenic
1174561417 20:51433090-51433112 GGAGCTGCTGGGATAGAAAGAGG - Intronic
1174843520 20:53921522-53921544 GGAGCTGGGGGGTGGGGTCGGGG + Intergenic
1175259136 20:57663856-57663878 GGAGCTGGATGGAGATTTCGGGG - Intronic
1175578990 20:60084568-60084590 GGAGGTGTTGGTAGAGATGGAGG - Intergenic
1175705988 20:61177112-61177134 GGAGCTGGAGGGAGGGAGGGAGG + Intergenic
1175806535 20:61832194-61832216 GGAGCTGGTGGGTCAGAGCAGGG + Intronic
1175921772 20:62453507-62453529 GGAGGTGGGGGGTGAGCTCGGGG + Intergenic
1177188045 21:17819398-17819420 GGAGCCGGCGGGAGAGGGCGGGG - Intergenic
1178974213 21:37208128-37208150 GGAGCTGGTGGCAGATTTCTTGG - Intergenic
1179925980 21:44534161-44534183 GGAGCTGGTGTGAGGGGGCGGGG + Intronic
1180613261 22:17111054-17111076 GGAGGCAGTGAGAGAGATCGGGG + Exonic
1181034221 22:20162225-20162247 GGTGGTGGTGGTAGTGATCGTGG - Intergenic
1181893344 22:26084305-26084327 GGAGCTCGAGGGAGAGACTGAGG + Intergenic
1182764900 22:32751467-32751489 GGTGGTCATGGGAGAGATCGGGG + Intronic
1183197484 22:36363438-36363460 GTAGCTGGAGGGAGAGACAGAGG + Intronic
1184290631 22:43496510-43496532 GGAGATGGTGGTGGAGATGGTGG + Intronic
1184290659 22:43496618-43496640 GGAGATGGTGGTGGAGATGGTGG + Intronic
1184291545 22:43500204-43500226 GGAGGTGGTGGGGGTGATGGTGG + Intronic
1184401390 22:44276644-44276666 GGAGATGGTGGGAGGCAGCGGGG + Intronic
1184580400 22:45413154-45413176 GGAGGTGGAGGGCGAGAGCGGGG + Intronic
1184842344 22:47059371-47059393 GGCGCTGGTGTGAGAGGCCGGGG - Intronic
1185011455 22:48316857-48316879 GGAGCCTGTGGGAGAGAGGGTGG + Intergenic
950387716 3:12673212-12673234 GGAGGTGGTGGGGGAGGTGGTGG - Intergenic
951053106 3:18116915-18116937 GGAGCAGGTTGGAGAGATGTTGG - Intronic
952319142 3:32259528-32259550 GCAGCTGGAGACAGAGATCGAGG + Intronic
952843760 3:37669460-37669482 AGAGCTTGTGGCAGAGATCCAGG - Intronic
953367188 3:42354839-42354861 GGAGGAGGTGGGAGAGAAGGAGG - Intergenic
953410926 3:42690132-42690154 TGAGCTGGAGGGAGAGATCTGGG + Intronic
953666802 3:44931311-44931333 GGAGCTGGTGGAAGAGCCCAGGG + Intronic
954151380 3:48659016-48659038 AGAGGTGGTCGGAGACATCGGGG + Exonic
955125859 3:56111417-56111439 GGAGCTGGTGAGAGAGAGGGGGG - Intronic
956653086 3:71523134-71523156 GGAGATGAAGGCAGAGATCGAGG + Intronic
956787288 3:72653184-72653206 GGAGCTGTTGGCTGAGATGGTGG + Intergenic
956787388 3:72653852-72653874 GGAGCTGTTGGCTGAGATGGTGG - Intergenic
959383990 3:105678526-105678548 GGGGGAGGTGGGAGAGATGGAGG + Exonic
960235656 3:115279327-115279349 TGAGCTGGTGGGACAGACAGGGG - Intergenic
960479235 3:118168868-118168890 GGAGCAGGAGGGAGAGAGAGAGG - Intergenic
961080870 3:124026370-124026392 GGAGCTGAAGGGAGAGAGAGGGG - Intergenic
961330189 3:126133870-126133892 GGAGCTCCTGGGAAAGACCGTGG - Intronic
962250455 3:133833029-133833051 GGAGCTGGTGGGATGGAGAGCGG + Intronic
962351102 3:134656287-134656309 GGAGCTGGAAGGAGTGATGGAGG + Intronic
962362006 3:134750433-134750455 TGAGCTGCTGAGAGAGATGGAGG - Intronic
962706595 3:138050509-138050531 GGAGGTGGTGGTAGTGATGGTGG + Intergenic
962962385 3:140322408-140322430 GATGCTGGTGGGGGAGATGGAGG + Intronic
963606300 3:147413974-147413996 GGAGCGGGTGGGTGGGATTGTGG + Exonic
965768372 3:172154903-172154925 GGTGCTGGTGGGACAAGTCGGGG + Intronic
966007990 3:175040061-175040083 GGAGCTTGTAAGAGAGATCTTGG - Intronic
967054335 3:185815753-185815775 GGTGCTGGTGGGAGGGAGAGAGG - Intronic
967742697 3:193020887-193020909 GGAACTGGAGTGAGAGACCGTGG + Intergenic
968065925 3:195759463-195759485 GGAGGTGGGGGGAGAGAAAGAGG - Intronic
968122366 3:196134644-196134666 GGATCTGGAGTGAGAGATCTTGG - Intergenic
968631583 4:1654807-1654829 GGAGTGCGTGGGAGCGATCGGGG - Intronic
968716710 4:2165411-2165433 GGGGCTGGTGGGAGGGAGGGAGG + Intronic
968830552 4:2931271-2931293 GCGGCTGGTGGGAGACATCGAGG + Exonic
969399585 4:6945081-6945103 GGAGCTGGTGTGAGAGTGGGAGG + Intronic
971959512 4:33467550-33467572 GGTCCGGGTGGGAGAGATCTGGG - Intergenic
972296659 4:37745692-37745714 GGAGCAGGAGGGAGAGAGAGAGG + Intergenic
972538722 4:40020830-40020852 GCAGCTGGAGACAGAGATCGAGG + Intergenic
972569123 4:40294787-40294809 GGAGATGGAGGCAGAGATAGAGG - Intergenic
972569233 4:40295447-40295469 GGAGCTGGAGGCAGAGATGGAGG - Intergenic
972569238 4:40295471-40295493 GGAGATGGAGGCAGAGATGGAGG - Intergenic
975825355 4:78314226-78314248 GGAGCTCGTGGGAGAGGTATGGG - Intronic
975835986 4:78422631-78422653 GCATCTGGTGGGAGAGACAGAGG + Intronic
977878460 4:102176763-102176785 GGAGCTGCTGGGAGTGTTAGGGG - Intergenic
981422966 4:144572286-144572308 GTAGCTGGAGGCAGAGATTGAGG + Intergenic
982176952 4:152714943-152714965 GGAGCTGTTGCAAGAGATGGGGG + Intronic
982377955 4:154715318-154715340 GGACCTGGTGGGAGATATTTTGG + Intronic
986671158 5:10144204-10144226 GGAGATGGAGGCAGAGATTGGGG - Intergenic
987351356 5:17024992-17025014 GGAGCTGGTGAGAGAGAACCTGG + Intergenic
989462668 5:41718718-41718740 GGTGGTGGTGGTAGAGATAGTGG + Intergenic
989782844 5:45290029-45290051 GGACCTGGTGGGAGAAATCATGG + Intronic
989814937 5:45724466-45724488 GGAGATGGAGGGAGAGAGGGAGG - Intergenic
991182157 5:63765019-63765041 GGAGCTGTTGGCAGAGGTAGAGG - Intergenic
993966991 5:94371041-94371063 GGAGCTGGTGGGGGAGCGGGTGG + Intronic
994149509 5:96432254-96432276 GAAGCTGGGGGGAGAAATGGTGG - Intronic
995411132 5:111858366-111858388 GGACTTGGTGGGAGAGACCCGGG - Intronic
996452057 5:123636697-123636719 GCAGCTGGAGACAGAGATCGAGG + Intergenic
996685407 5:126274545-126274567 GTAGCTGGTATGATAGATCGTGG + Intergenic
997447301 5:133950975-133950997 GGAGCTGATGAGAGAGAGCTGGG - Intergenic
997836325 5:137196176-137196198 GGAGCTGGTGCTGGAGATGGTGG - Intronic
998005165 5:138651849-138651871 GGAGATGGTGGCAGAAATCCAGG - Intronic
999868603 5:155728194-155728216 GGGGCTGGAGGGAGGGAGCGAGG - Intergenic
1000029599 5:157390479-157390501 GCAGCTGGAGTGAGAGGTCGGGG - Intronic
1001094770 5:168767707-168767729 GGTGGTGGTGGGAGGGGTCGGGG + Intronic
1001161068 5:169314273-169314295 GGGGATGGTGGGACAGATAGTGG + Intergenic
1001179241 5:169503246-169503268 GGGGCTGGGGGGAGAGAAAGGGG - Intergenic
1001369002 5:171177368-171177390 GAAGCAGGTGGAAGAGATTGTGG - Intronic
1001396501 5:171422185-171422207 GGAGCTGGAGGGAGGGAGTGTGG + Intronic
1001415387 5:171541802-171541824 GGAGCTGGGAAGAGAGATAGGGG + Intergenic
1002140322 5:177133862-177133884 GGAGCGGTGGGGAGAGAGCGGGG - Intronic
1002847720 6:962634-962656 GGAGCTGTGGGGAGAAATCAGGG - Intergenic
1003136967 6:3441285-3441307 GGACTTGATGGGAGAGATCCAGG - Intronic
1003318891 6:5035488-5035510 GCAGCTGGTGGGGGAGGTGGAGG - Intergenic
1004280854 6:14278482-14278504 GGAGATGGAGGGAGAGGTAGGGG + Intergenic
1004702518 6:18092532-18092554 AGAGATGGTGGTAGAGATGGTGG + Intergenic
1004702523 6:18092556-18092578 GGAGATGGTGGTAGAGATGGTGG + Intergenic
1004924063 6:20402417-20402439 GGAGGTGGTGGAAGTGTTCGTGG - Exonic
1005440628 6:25864118-25864140 GGAGCTGGTTGGAGAGCGCCTGG + Intronic
1005660362 6:27992405-27992427 GGAGAGGGTGGGAGAGACAGGGG - Intergenic
1005761213 6:28969810-28969832 GCAGCTGGAGACAGAGATCGAGG - Intergenic
1005887529 6:30108184-30108206 TGAGCTGGTTGGTGAGATCAGGG + Intronic
1006170257 6:32088066-32088088 GGCTCTGGTGGGAGGGATCGAGG - Intronic
1006342217 6:33452968-33452990 GGAGCTGGCGGGAGGGAGGGAGG - Exonic
1006547500 6:34792064-34792086 CGCGCTGGTGGGTGGGATCGTGG + Exonic
1008109706 6:47478428-47478450 GAAACTGGTGGGAGAGCTCGCGG + Intronic
1010229273 6:73520855-73520877 GAAGTGGGTGGGAGAGTTCGAGG - Exonic
1011239398 6:85255234-85255256 GGAGCTCAAGGGAGAGATCAGGG - Intergenic
1011549709 6:88519893-88519915 TGAGCTGGTGGGAGTGATGAGGG - Intergenic
1011712782 6:90071526-90071548 TGAGCTGGTGTGAGAGAACATGG + Intronic
1012402147 6:98849548-98849570 GGAGGGGGTGGGGGAGATGGAGG - Intergenic
1013667332 6:112362117-112362139 GCAGCTGGAGACAGAGATCGAGG - Intergenic
1013671120 6:112404358-112404380 ACAGCTTGTGGGAGAGATGGAGG - Intergenic
1014009241 6:116457997-116458019 GCAGCTGGAGACAGAGATCGAGG - Intergenic
1015151925 6:130049756-130049778 GGAGCTCGGGGGAGAGGTCGGGG - Exonic
1017291662 6:152744837-152744859 GGAGCTGGGGGGAGAGCCTGTGG + Intergenic
1017429216 6:154354398-154354420 GGAGGTGGTGGTGGAGATGGTGG - Intronic
1017530683 6:155289239-155289261 GGAGATGGTGGGAGAAAAAGAGG + Intronic
1018699685 6:166416577-166416599 AGAGGTGGCGGGAGTGATCGTGG - Intronic
1019420029 7:946480-946502 GGTGCTGCTGGGAGGGATCCAGG - Intronic
1019462685 7:1169408-1169430 GGAGGTGGTGGCAGAAGTCGGGG - Intergenic
1019480563 7:1264810-1264832 GGGGCTGCTGGGAGAGTTCCAGG - Intergenic
1019530425 7:1500334-1500356 GGTGCTGCTGGATGAGATCGAGG - Exonic
1019614901 7:1954813-1954835 GGTGGGGGTGGGAGAGCTCGGGG - Intronic
1020104397 7:5415144-5415166 GGAGCTGGTGGGAGGGGATGTGG - Intronic
1020185338 7:5954659-5954681 TGACATGGTGGGAGATATCGTGG + Intronic
1020297575 7:6770086-6770108 TGACATGGTGGGAGATATCGTGG - Intronic
1021822457 7:24511719-24511741 GGGGCTGGTCTGAGAGATTGAGG - Intergenic
1021840506 7:24718207-24718229 GGAGCTGGAGGTAGAGGTCTGGG - Intronic
1021884698 7:25127277-25127299 GGAGCTAGAGAGAGAGATCAGGG - Intergenic
1022976655 7:35564747-35564769 TGAGATGGTGGGAGAGAACAGGG + Intergenic
1022993207 7:35728619-35728641 GGAGCTGGAGGGACAGAGGGAGG + Intergenic
1023075578 7:36478897-36478919 GGAGCTTTTGGGAGAGACCATGG + Intergenic
1023089372 7:36603342-36603364 GGAGCTGGAGGAAGAGCTTGTGG - Intronic
1024299536 7:47876577-47876599 GGAGCAGGAGGGAGGGGTCGGGG + Intronic
1024569745 7:50713801-50713823 GGAGATGGTGGAAGTGATGGTGG - Intronic
1024957035 7:54933262-54933284 GCAGCTGGTGGCAGAGAGGGAGG + Intergenic
1025030943 7:55556231-55556253 GGAGGAGGTGGGAGAGACAGGGG + Intronic
1026234614 7:68515837-68515859 GGAGCTGGAGGGAGGGACAGTGG + Intergenic
1026549185 7:71352607-71352629 GGAGCTTGAGAGAGAGATAGGGG + Intronic
1026671248 7:72392457-72392479 GGTGCTGATGGGAGAGACTGAGG + Intronic
1029252276 7:99245297-99245319 GGAGCTGGTGGCAGGGACAGGGG + Intergenic
1029404538 7:100366713-100366735 GGACCTGGAGGGAGAGGTGGGGG + Intronic
1029745027 7:102512005-102512027 GGGGCTGGAGGGCGGGATCGGGG + Intronic
1029763019 7:102611166-102611188 GGGGCTGGAGGGCGGGATCGGGG + Intronic
1029980631 7:104875361-104875383 GGATCTGGTGGGATGGATAGAGG - Intronic
1031066867 7:117114926-117114948 GGAGCTGGGGGCAGAGACCCAGG - Intronic
1031957222 7:127954868-127954890 GGAACTGGTGGGAGACTTCTTGG - Intronic
1031964074 7:128014837-128014859 GGAGCTGGTGGGATGGATACAGG - Intronic
1033243325 7:139699168-139699190 CAGGCTGGTGGGAGAGATGGCGG - Intronic
1033655686 7:143372454-143372476 GGAGCTGGTTGGAGAAAGTGTGG + Intergenic
1033662971 7:143415662-143415684 GGAGCTGTTGGGAGAGAAAAAGG + Intergenic
1034479859 7:151311254-151311276 AGACCTGATGGGAGAGATCGTGG + Intergenic
1034505604 7:151487334-151487356 AGAGCTGGGGGGAGAGGTTGCGG + Intronic
1034950247 7:155291900-155291922 GAAGTAGGTGGGAGAGATGGGGG - Intergenic
1035027316 7:155834511-155834533 GGATCTGTTGGGAGAGGCCGGGG - Intergenic
1035035351 7:155891013-155891035 GGAGGTGGTAGGAGTGATGGAGG + Intergenic
1035381037 7:158441077-158441099 GGTGCTGGTGGTAGTGATAGGGG + Intronic
1035469018 7:159098005-159098027 GGAGCTCCTGGGACTGATCGTGG - Intronic
1035677745 8:1467245-1467267 GGGGCTGGGGGGAGGGACCGTGG - Intergenic
1035814031 8:2519625-2519647 GGCTCTGGGGGGAGAGATAGAGG - Intergenic
1036507911 8:9372506-9372528 GGAGCTGGAGGGAGAGTGCCAGG - Intergenic
1037399199 8:18476641-18476663 CCAGCTGGTGGCAGAGATGGTGG - Intergenic
1037450974 8:19014753-19014775 TGACATGGTGGGCGAGATCGTGG - Intronic
1038643888 8:29348276-29348298 GGCGCTGGTGGGAGAGATGAGGG - Intronic
1039156317 8:34562529-34562551 GGAGATGGTGGCAGAGAGTGAGG - Intergenic
1039888463 8:41668905-41668927 GGAGGTGGTGGCAGAGTTTGAGG - Intronic
1039986505 8:42452298-42452320 GGAGGTGGAGGAAGAGATGGAGG + Intronic
1041169791 8:55129769-55129791 GGAGGTGGTGGGAGAGGGAGAGG + Intronic
1041179930 8:55236672-55236694 GGAGCTGGGGCGAGAGATGCAGG - Intronic
1041336390 8:56789334-56789356 GTAGCTGGAGGGACAGATCAAGG - Intergenic
1041407835 8:57519763-57519785 GGGGCTGGTTGGAGAGATGTTGG - Intergenic
1041466639 8:58163771-58163793 AGAACTGGTGGGAAAGATCTGGG + Intronic
1043334336 8:79155537-79155559 GAGCCTGGTGGGAGATATCGGGG + Intergenic
1044028329 8:87202406-87202428 AGAGCTGGAGAGAGAGAACGTGG + Intronic
1045216935 8:100158185-100158207 GGAGCGGGGGCGAGAGGTCGAGG + Intronic
1045463622 8:102448554-102448576 TGAGCTAGTGGTAGAGATTGGGG + Intergenic
1048358683 8:133675616-133675638 GGAGCTGGAGAGTGAGATGGAGG + Intergenic
1048392095 8:133976794-133976816 GGAGCAGGAGAGAGAGATGGGGG - Intergenic
1049589728 8:143451936-143451958 GGTGCTGATGGAAGGGATCGGGG + Intronic
1049681551 8:143920820-143920842 GCAGCTGCTGGTAGAGCTCGCGG + Exonic
1049742779 8:144249023-144249045 GGAGAAGGTGGGAGAGGGCGGGG + Exonic
1049742792 8:144249062-144249084 GGAGAAGGTGGGAGAGGGCGCGG + Intronic
1049806294 8:144542160-144542182 GGAGCAGGTGGGAGAGCTGGAGG + Intronic
1049833970 8:144721170-144721192 GGGGTTGGTGGGAGAGGTGGTGG + Exonic
1051386579 9:16515480-16515502 GGAGTTGGTGGGATAGAACAGGG - Intronic
1052333961 9:27300843-27300865 GGAGATGAAGGGAGAGATCAGGG + Intergenic
1052852181 9:33385086-33385108 GGGGGTGAGGGGAGAGATCGTGG + Exonic
1053083544 9:35197757-35197779 GGAGCAGGAGGGAGAGAAGGTGG - Intronic
1053295045 9:36906691-36906713 GGGGCTGGTGGGAGAGCTTGCGG - Intronic
1053790791 9:41685052-41685074 GGTCCTGGAGGGAGAGATCCTGG + Intergenic
1054154367 9:61629720-61629742 GGTCCTGGAGGGAGAGATCCTGG - Intergenic
1054179138 9:61896746-61896768 GGTCCTGGAGGGAGAGATCCTGG + Intergenic
1054474148 9:65560840-65560862 GGTCCTGGAGGGAGAGATCCTGG - Intergenic
1054658400 9:67684075-67684097 GGTCCTGGAGGGAGAGATCCTGG - Intergenic
1055059296 9:72052110-72052132 GGAGGTGGTGGGGGAGATATTGG + Exonic
1057215936 9:93228833-93228855 GGATGAGGTGGGAGAGAGCGTGG + Intronic
1058333244 9:103791388-103791410 GGAGCAGGAGGAAGAGATTGAGG - Intergenic
1059472223 9:114514322-114514344 GGAGCAGGAGGGAGAGAGAGGGG + Intergenic
1059727918 9:117027544-117027566 GGAGGTGGGGGGAGAGAGGGAGG - Intronic
1060252142 9:121995108-121995130 GGAGCTTGGGAGAGAGATCTGGG + Intronic
1060348610 9:122838134-122838156 GCAGCTGGAGACAGAGATCGAGG + Intergenic
1061248817 9:129414788-129414810 GGAGCCGGTGGGAGTCAGCGGGG + Intergenic
1061530451 9:131207904-131207926 GGAGCTGTTGGCAGTGATGGGGG + Intronic
1061579926 9:131530600-131530622 GGAGTTGCTGGGACAGAACGAGG - Exonic
1061707530 9:132464283-132464305 GGAGATGCTGGGAGAGTTCTGGG - Intronic
1061887365 9:133598588-133598610 GCTGCTGGTGGGAGAGAGGGAGG + Intergenic
1062173710 9:135149234-135149256 GGAGCAGGTGTGAGAGACAGCGG + Intergenic
1062357334 9:136171042-136171064 GGAGCTGGCGGGAGAGGACAGGG - Intergenic
1062367513 9:136218310-136218332 GGGGCTGGGGGGAGAGAGAGAGG - Intronic
1062416148 9:136451311-136451333 GGAGCGGGTGAGAGAGACAGAGG + Exonic
1186486440 X:9937497-9937519 GGAGCTGGCCAGGGAGATCGTGG + Exonic
1186496241 X:10014897-10014919 GGAGCGGGAGGGAGAGAGCGAGG + Intergenic
1186970446 X:14836252-14836274 AGAGCTGGTGGAAGAGAGAGAGG + Intergenic
1188967839 X:36577241-36577263 GGAGAGGGTGAGAGAGATAGGGG + Intergenic
1189761995 X:44331384-44331406 GGAGTTGGTGGAAGGGAGCGAGG + Intronic
1189874187 X:45418981-45419003 GGAGGTAGAGGGAGAGATCATGG - Intergenic
1189928644 X:45983952-45983974 GTAGCTGGAGACAGAGATCGAGG + Intergenic
1190338090 X:49275072-49275094 GAAGCAGGAGGGAGAGAACGTGG - Intronic
1190576712 X:51846705-51846727 GGAGCAGGTGGAAGAGAGAGAGG + Intronic
1192201832 X:69071235-69071257 GGAGCTGGGGGGAGGGAACCAGG - Intergenic
1193137582 X:77989683-77989705 TGAGCTGGAGGGAGAGTTTGAGG - Exonic
1193509253 X:82379081-82379103 GGAGCAGGTGGAAGAGAGAGAGG + Intergenic
1194427432 X:93756826-93756848 GGAGGTGGGGGCAGAGATGGGGG + Intergenic
1195112720 X:101663961-101663983 GGAGGTGGTGGGAGGGAAGGCGG + Intergenic
1195928999 X:110054543-110054565 TGAGCTGGTGGTAGAGCTCAAGG - Intronic
1197147227 X:123184231-123184253 GGAGGGGGTGTGAGAGATCCTGG + Exonic
1197617897 X:128715093-128715115 GCAGCTGGAGACAGAGATCGAGG + Intergenic
1198189727 X:134289918-134289940 GGACCTGGTGGGAGAGGTTTGGG - Intergenic
1198672889 X:139100344-139100366 AGAGATGGTGGGAGAGAGAGAGG + Intronic
1198764533 X:140067281-140067303 GCAGCTGGTTAGAGAGAACGAGG - Intergenic
1199203650 X:145122976-145122998 GAAGCAGGTGGGAGAGTTCCTGG + Intergenic
1200085876 X:153604737-153604759 GCAGCTGGAGACAGAGATCGAGG - Intergenic
1200126342 X:153816567-153816589 GGAGCTGAAGGGAGAGACGGTGG + Intronic
1200175998 X:154116733-154116755 GGACCTGGTTGCAGAGATCTGGG + Intergenic
1200366234 X:155667603-155667625 GGAGATGGTGGTAGTGATGGTGG + Intronic
1200948037 Y:8865521-8865543 GAAGATGGTGGGAGAGTTCTTGG - Intergenic