ID: 1136477978

View in Genome Browser
Species Human (GRCh38)
Location 16:30525251-30525273
Sequence CAAATGTGAGGTCTGCAGCA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 247
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 224}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136477978_1136477983 -2 Left 1136477978 16:30525251-30525273 CCTTGCTGCAGACCTCACATTTG 0: 1
1: 0
2: 0
3: 22
4: 224
Right 1136477983 16:30525272-30525294 TGTAGGGCTTCTCACCGGTGTGG 0: 5
1: 11
2: 38
3: 133
4: 279
1136477978_1136477984 7 Left 1136477978 16:30525251-30525273 CCTTGCTGCAGACCTCACATTTG 0: 1
1: 0
2: 0
3: 22
4: 224
Right 1136477984 16:30525281-30525303 TCTCACCGGTGTGGATGCGCTGG 0: 5
1: 7
2: 35
3: 63
4: 228
1136477978_1136477987 19 Left 1136477978 16:30525251-30525273 CCTTGCTGCAGACCTCACATTTG 0: 1
1: 0
2: 0
3: 22
4: 224
Right 1136477987 16:30525293-30525315 GGATGCGCTGGTGCTGGATCAGG 0: 1
1: 0
2: 6
3: 29
4: 195
1136477978_1136477986 13 Left 1136477978 16:30525251-30525273 CCTTGCTGCAGACCTCACATTTG 0: 1
1: 0
2: 0
3: 22
4: 224
Right 1136477986 16:30525287-30525309 CGGTGTGGATGCGCTGGTGCTGG 0: 2
1: 2
2: 8
3: 28
4: 164
1136477978_1136477989 23 Left 1136477978 16:30525251-30525273 CCTTGCTGCAGACCTCACATTTG 0: 1
1: 0
2: 0
3: 22
4: 224
Right 1136477989 16:30525297-30525319 GCGCTGGTGCTGGATCAGGGTGG 0: 1
1: 1
2: 3
3: 28
4: 225
1136477978_1136477982 -7 Left 1136477978 16:30525251-30525273 CCTTGCTGCAGACCTCACATTTG 0: 1
1: 0
2: 0
3: 22
4: 224
Right 1136477982 16:30525267-30525289 ACATTTGTAGGGCTTCTCACCGG 0: 2
1: 4
2: 14
3: 70
4: 181
1136477978_1136477988 20 Left 1136477978 16:30525251-30525273 CCTTGCTGCAGACCTCACATTTG 0: 1
1: 0
2: 0
3: 22
4: 224
Right 1136477988 16:30525294-30525316 GATGCGCTGGTGCTGGATCAGGG 0: 1
1: 0
2: 1
3: 18
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136477978 Original CRISPR CAAATGTGAGGTCTGCAGCA AGG (reversed) Exonic
902148877 1:14426257-14426279 CAAATGTCACCTCTGCAGAAAGG + Intergenic
902672747 1:17986228-17986250 CAGATGTGATGTCTGCTTCATGG - Intergenic
904702144 1:32364016-32364038 AAAAGGTGATGTCTGGAGCATGG + Exonic
906901968 1:49845076-49845098 CAAATGTCAGGAATGCAGAAAGG + Intronic
906902085 1:49845917-49845939 CAAATGCAATGACTGCAGCAAGG + Intronic
907610619 1:55866363-55866385 CAAATGTCAGATCTGCATCATGG + Intergenic
908573682 1:65437053-65437075 CAAATGGCAAGGCTGCAGCAGGG - Intronic
912718053 1:111995927-111995949 CATATTTGAGGTATGCAGGAAGG - Intergenic
914745341 1:150497364-150497386 CAATTGTGTGGTCTGCAGTCGGG + Intronic
915140151 1:153762843-153762865 CAAAGGTGAGGCCATCAGCAAGG + Exonic
915480019 1:156178078-156178100 CAACTGTGGGGGCCGCAGCAGGG - Intergenic
917220444 1:172722952-172722974 CAAAACTGATGTCTGCAACATGG - Intergenic
919288609 1:195599507-195599529 TAAAAGTGAGGACTGCAACATGG + Intergenic
921775709 1:219097284-219097306 CCATTGTGAGGTCTGGAGAATGG - Intergenic
1064209392 10:13349792-13349814 TAAATCTGAGGTCTGCCGGATGG + Intergenic
1064355698 10:14615601-14615623 CAAATCTTAGGTCTGCCACAAGG + Intronic
1064981592 10:21172435-21172457 CCATTGTGAGGTCTGCAAGATGG - Intronic
1065280961 10:24137352-24137374 CAAATGCCAGTTTTGCAGCAGGG + Intronic
1067541689 10:47159626-47159648 CAAATGTAAAATCTGCAGCTGGG + Intergenic
1068849147 10:61716272-61716294 TAAATGTGAGGGTTGCAACAGGG + Intronic
1069069167 10:63976257-63976279 TAAAAGTGCGGTCTGCAGCCTGG - Intergenic
1069875988 10:71563173-71563195 CACTTGTGAGGCCTGGAGCAAGG + Intronic
1069888990 10:71641383-71641405 CCACTCTGAGCTCTGCAGCAGGG - Intronic
1070344684 10:75530492-75530514 CAACACTGAGGTCAGCAGCAAGG - Intronic
1070414597 10:76177973-76177995 CCAATGTGAGCTAAGCAGCATGG - Intronic
1070671254 10:78378848-78378870 CAAATGTGATGCCTGGAGCCTGG + Intergenic
1071292553 10:84197981-84198003 CACAGGAGAGGGCTGCAGCAAGG + Intronic
1071353122 10:84766674-84766696 CAAAAGTGAGGCCAGTAGCATGG + Intergenic
1074102556 10:110365045-110365067 TAGAGATGAGGTCTGCAGCAAGG + Intergenic
1075332016 10:121580784-121580806 CAAATATGCGGTTTGGAGCAGGG - Intronic
1076144942 10:128110812-128110834 CACACGTGAGCTCTGGAGCACGG + Intronic
1077260397 11:1615727-1615749 GAAATGTGGGGGCTGCATCAGGG + Intergenic
1079983797 11:27179128-27179150 CAAGTGGGAGGTCTGCAACTTGG - Intergenic
1080395517 11:31886397-31886419 CAAATGGGAGGTCTGCAGGCTGG - Intronic
1084502929 11:69545541-69545563 CAACTGTGATGTTTGCAGCCCGG + Intergenic
1084540486 11:69783145-69783167 CAGATGAGAGGACTTCAGCAGGG + Intergenic
1085129867 11:74028992-74029014 GAAATGAGAGCTCTGCATCAGGG + Intronic
1089488977 11:118869901-118869923 CAAATGTGGGGGCTGGAGAAAGG + Intergenic
1091283622 11:134396208-134396230 CAAAGGTGAGGACTGCACGAAGG + Intronic
1093537327 12:20237665-20237687 CAATTCTGAGGTCTGGAGGATGG - Intergenic
1094686916 12:32726574-32726596 CAATTTTGAAGTCTGCAGCAAGG + Intronic
1095708678 12:45265392-45265414 CAAATGTGAGGTGTGGAGCCAGG - Intronic
1095749585 12:45696266-45696288 CAGATGTGCTGGCTGCAGCAGGG + Intergenic
1097021956 12:56026971-56026993 CAAGTGTGACGTCTGCGGCATGG + Exonic
1097647085 12:62249355-62249377 CAAAGGTGAGGACTGCAGCCTGG - Intronic
1098895081 12:76050611-76050633 CAATTTCGAAGTCTGCAGCAAGG + Exonic
1099500453 12:83407496-83407518 TACATGTGAGTTCTTCAGCATGG + Intergenic
1099702326 12:86102659-86102681 CAAATGTAAGATCTGCATAAAGG + Intronic
1099878015 12:88433226-88433248 CAGCAGTGAGGTCAGCAGCAAGG - Intergenic
1101083800 12:101214954-101214976 CAATTCTGGGGTCTGCAGGATGG - Intergenic
1101770031 12:107740994-107741016 CAAGTGTGATTTCTGTAGCAAGG - Exonic
1104520973 12:129474714-129474736 CAAAGGTGAGGGCTGAATCATGG + Intronic
1104639513 12:130458403-130458425 CAAATGTGGGGTCTGCAGGTGGG + Intronic
1106025063 13:25948589-25948611 CCAATGTGATGGCTGCATCATGG + Intronic
1106048209 13:26165463-26165485 CAATTGTGGGGTCTGGAGGATGG - Intronic
1106435441 13:29719709-29719731 CACATAGGTGGTCTGCAGCAGGG + Intergenic
1106969192 13:35116041-35116063 CAGAGCTGAGGTCTGGAGCATGG + Intronic
1107656943 13:42601310-42601332 CACCTCTGAGGTCAGCAGCAGGG - Intronic
1109561600 13:64056869-64056891 CAAATTTGAGGACTGCAACATGG + Intergenic
1111062875 13:83046146-83046168 CAAATTTGAGGACTGCAGCCTGG - Intergenic
1113612227 13:111655234-111655256 CATATGTGAGGTACTCAGCATGG - Intronic
1113864932 13:113515290-113515312 CAAATGTGAATTCTGTAGCATGG + Intronic
1114314324 14:21495538-21495560 CAAATGTAAGCTCTTAAGCAGGG - Intronic
1117026012 14:51620830-51620852 CCAATGATATGTCTGCAGCAGGG - Intronic
1118480417 14:66159239-66159261 CCAATGTGAGGGCTGGAGGACGG + Intergenic
1119167701 14:72509044-72509066 CAAAGATGAGCTATGCAGCATGG + Intronic
1121289699 14:92763923-92763945 CAACTCTGTGGTGTGCAGCATGG + Intergenic
1121496008 14:94391587-94391609 GAGATTTGGGGTCTGCAGCAAGG + Intergenic
1121523049 14:94599525-94599547 CAAAGGTGAGCTCTGCAGGGAGG + Intronic
1121896209 14:97650284-97650306 AAAATGTGTGGTATGCAGGATGG + Intergenic
1122814526 14:104306005-104306027 GAGATGTGAGATCTGCAGCCAGG + Intergenic
1123483773 15:20664376-20664398 CAGAGCTGAGGTCTGGAGCATGG - Intergenic
1123943203 15:25226528-25226550 CAACTACCAGGTCTGCAGCAGGG + Intergenic
1125430428 15:39588220-39588242 TAAGTGTGAGGTCCGCTGCAAGG + Intronic
1129310707 15:74706780-74706802 AAAATGTTAGTTCTGCAGCCAGG + Intergenic
1131108146 15:89748322-89748344 CAAAAGTCAGGCCTGCAGCGGGG - Intergenic
1131987560 15:98060459-98060481 CTAATCTGGGGTCTGGAGCATGG + Intergenic
1132219728 15:100096410-100096432 CAGATGCGGGGTCTGCAGCGGGG - Exonic
1132408991 15:101562523-101562545 CATGGGTGAGGTCTGCACCACGG - Intergenic
1132954812 16:2585951-2585973 CAGATGTGGGGCCTGCAGCCGGG + Intronic
1133039526 16:3052969-3052991 CGCATGGGAGCTCTGCAGCAGGG + Intronic
1133043369 16:3072602-3072624 CGCATGGGAGCTCTGCAGCAGGG + Intronic
1133977276 16:10608238-10608260 CAAATGTGTGGTTTACAGTAGGG - Intergenic
1134753930 16:16649628-16649650 TAAATGTGATACCTGCAGCATGG - Intergenic
1134992129 16:18709416-18709438 TAAATGTGATACCTGCAGCATGG + Intergenic
1136042525 16:27591647-27591669 CAAATGTCAAGTGTTCAGCATGG + Intronic
1136089245 16:27906647-27906669 CAAATGTAAGCTCTTCATCAAGG + Intronic
1136458838 16:30397670-30397692 CAAGTGTGGGGTCTGTGGCAAGG + Exonic
1136477978 16:30525251-30525273 CAAATGTGAGGTCTGCAGCAAGG - Exonic
1137581571 16:49636709-49636731 TAACTGTAAGTTCTGCAGCAAGG - Exonic
1137896632 16:52219698-52219720 CACATTTCAGGGCTGCAGCATGG + Intergenic
1138270761 16:55694318-55694340 CAAATGTGAGGTGTGGAACTGGG + Intronic
1138653427 16:58474893-58474915 CAAATGCAATGTCTGCAGAAGGG - Intronic
1138736915 16:59261316-59261338 CAAGTGTGAGAACTGGAGCAAGG - Intergenic
1141747094 16:85933112-85933134 CAGATGCCAGCTCTGCAGCACGG - Intergenic
1142557272 17:788079-788101 CAATTCTGAGATCTGCAGCTGGG + Exonic
1143298763 17:5893001-5893023 CAAATGTTAGGTCTGGAACAGGG + Intronic
1146699105 17:34938568-34938590 TATATGTGAGGTTTGCAGCCAGG + Intronic
1148393544 17:47290683-47290705 CATCTGTGAGGCCTGCAGGAGGG + Intronic
1152463933 17:80455255-80455277 CAGAGTTGGGGTCTGCAGCAGGG + Intergenic
1154343696 18:13525357-13525379 TAAATGTGAGATTTGCAGAATGG - Intronic
1155402202 18:25451068-25451090 CATATGTGAAGTTTGCAGTACGG + Intergenic
1156252966 18:35369620-35369642 CAAATGTGAAATCTGCTTCAAGG - Exonic
1156362868 18:36399714-36399736 CAAATGAGCCTTCTGCAGCAGGG - Intronic
1159218520 18:65428713-65428735 CCATTCTGAGGTCTGGAGCATGG - Intergenic
1160585536 18:79911546-79911568 CACAGGTGCGCTCTGCAGCATGG + Intronic
1161735789 19:5991429-5991451 CAGATGTGATGGCTGGAGCACGG - Intergenic
1163018019 19:14468615-14468637 CAAATCTCAATTCTGCAGCATGG + Intronic
1164426226 19:28144219-28144241 CAATTGTGAGGACTGCAGTGAGG - Intergenic
1165073094 19:33266987-33267009 GGAATGTGAGGTCTGGAGAAAGG - Intergenic
1166602342 19:44108116-44108138 CAAATGTGAGGACTGTGGGAAGG + Exonic
1166623485 19:44327654-44327676 CAAATGTGAGGTATGTGGAAAGG - Exonic
1166623508 19:44327822-44327844 CAAATGTGAGGTGTGTACAAAGG - Exonic
1167865410 19:52322027-52322049 CAAATGTAATGTCTGTGGCAAGG + Exonic
1167894289 19:52568831-52568853 CAAGTGTGAGTTTTACAGCATGG - Intronic
1167896084 19:52582788-52582810 TAAATGTGATGTATGCGGCAAGG + Exonic
1167905052 19:52652535-52652557 CAAATGTCATGATTGCAGCAAGG - Intronic
1167919010 19:52766576-52766598 CAAATGTAAGGTCTGTGACAAGG - Exonic
1167923054 19:52798996-52799018 CAAATGTAAGGTTTGTAACAAGG - Exonic
1167932820 19:52881537-52881559 CAAATGTAAGGTTTGCGACAAGG - Exonic
1168339577 19:55615436-55615458 CAAGTGCGAGCTCTGCGGCAAGG + Exonic
925291039 2:2748886-2748908 CACGTGTGAGGACTGCAGCAGGG + Intergenic
925615104 2:5737788-5737810 CAAATGTACGTTCTGCCGCAAGG + Intergenic
925641638 2:5990944-5990966 CAAAGGTAAGGTCTGAACCAAGG - Intergenic
926246168 2:11123637-11123659 CAAAGGTGGGCTCTGCACCAGGG + Intergenic
929136590 2:38629998-38630020 AAGATGTGAGGACTGAAGCAGGG - Intergenic
929828546 2:45329297-45329319 CAGATGTGAGACCAGCAGCAGGG - Intergenic
932960674 2:76409082-76409104 CAATTCTGAGGTCTGGAGGATGG - Intergenic
933071118 2:77859056-77859078 CCAAAGTGAGGTCTGCTGCATGG + Intergenic
933512281 2:83256000-83256022 AAAAGGTGAGGTCAGTAGCAAGG + Intergenic
935318530 2:101861905-101861927 AAACTGTGGGATCTGCAGCATGG + Intronic
935403536 2:102684938-102684960 GAAATGTAAGCTCTGCAGCAGGG - Intronic
937345195 2:121121109-121121131 GAACGCTGAGGTCTGCAGCAGGG + Intergenic
937576796 2:123433373-123433395 CAAATGTGAAATCATCAGCAAGG + Intergenic
938832786 2:135070247-135070269 CAAAGTTGAGGACTGCAGCCCGG - Intronic
938977221 2:136491610-136491632 GAAATGTGTGGCCTGGAGCAGGG + Intergenic
941194805 2:162436203-162436225 CAAATGTCAGCTCCTCAGCAAGG - Intronic
942928270 2:181458106-181458128 CAGATGTGCAGTCCGCAGCAGGG - Intronic
943053813 2:182949863-182949885 TATGTGTTAGGTCTGCAGCAAGG + Intronic
944093994 2:195946191-195946213 CAAAAGTGGGGTCTGCAGAAGGG - Intronic
944492951 2:200276844-200276866 CAGCTGTGATGTCTGCAGAATGG - Intergenic
945692542 2:213056881-213056903 GAAATGTGACGTCTGTGGCATGG - Exonic
947273064 2:228360737-228360759 CAAATGTGAAGTGTGAAGCATGG - Intergenic
948196860 2:236103124-236103146 CACATGTGCTGTCTGGAGCAGGG - Intronic
1169566600 20:6860275-6860297 CAGATGAGAGCTGTGCAGCATGG + Intergenic
1169629653 20:7616112-7616134 AAAATGTGAGGTCTGTATCTAGG - Intergenic
1171414797 20:24970168-24970190 CAAATGGGAGACCTGGAGCAAGG + Intronic
1171416735 20:24986596-24986618 AACCTGAGAGGTCTGCAGCAGGG + Intronic
1173566361 20:44041194-44041216 CAGTGGTGAGGTCTGCTGCAAGG + Intronic
1173680755 20:44879547-44879569 CAAAGTTGAGGACTGCAGCCAGG - Intergenic
1175363007 20:58429521-58429543 CATCTGTAAGGTCTGCAGTAAGG + Intronic
1177368215 21:20166982-20167004 CAAATGTAAGGACTTCAACATGG + Intergenic
1180054535 21:45351111-45351133 CAAAGCTGAGGTGGGCAGCACGG + Intergenic
1180694803 22:17744791-17744813 CAAAGGTGAGCCCTGCAGCTGGG + Intronic
1182129626 22:27841345-27841367 CAAGTGTGAGGTCTCCAGGCTGG - Intergenic
1184196121 22:42929888-42929910 CAAATGTCAGCTCTGCTGCCTGG + Intronic
1184370839 22:44081055-44081077 CAAAGGTGCAGTCTCCAGCAGGG + Intronic
953100391 3:39820014-39820036 CAGATGTGTGATCTGCAGCCGGG + Intronic
953234080 3:41090988-41091010 CAGAAGCGAGGTCTGCAGCCAGG + Intergenic
953244778 3:41180966-41180988 CAAACGTGAGGTCTGGAACCTGG - Intergenic
953911987 3:46897961-46897983 CAAAGGTGAGGCCTGCTGGAAGG + Exonic
955127766 3:56131140-56131162 CAATTGGGAGGTCTGCAAAATGG - Intronic
955257274 3:57345213-57345235 ATAAATTGAGGTCTGCAGCATGG - Intronic
955937159 3:64112998-64113020 CAAAAGTGAGTCCTGCTGCAGGG - Intronic
956735143 3:72232568-72232590 TTATTGTCAGGTCTGCAGCAGGG + Intergenic
956750464 3:72340483-72340505 CACCTGTGTGGTCTCCAGCAGGG + Intergenic
961544591 3:127623576-127623598 GAAATGTGAAGTCTGCAGGCAGG + Intergenic
961572954 3:127813493-127813515 CAAATGTCCGGTTTGGAGCAGGG - Intronic
961658107 3:128454273-128454295 CAAACCTGAGGTCTCCAGCAGGG + Intergenic
961934630 3:130570162-130570184 TAAATCTGAGGTCAGCACCATGG - Intronic
961967323 3:130919073-130919095 CAAGTGTGGGGTCTGCGGGAGGG - Intronic
962002911 3:131317864-131317886 TAAAAATGAGGTCTGCAGTAGGG - Intronic
962631806 3:137283989-137284011 AAAATGTAATGTCTCCAGCAAGG + Intergenic
962939325 3:140111322-140111344 CATCTGTGAAGTCTTCAGCATGG - Intronic
968700883 4:2058063-2058085 CAAGTTTGAGGACTGCAGCGTGG - Intergenic
970601404 4:17643420-17643442 CAAAGGTGAGGGCTGGTGCATGG + Intronic
971699657 4:29954342-29954364 CAAATGTGAGTTCTCAAACAAGG - Intergenic
972145944 4:36025596-36025618 CGAATTTGAGATCTGTAGCAAGG + Intronic
972250096 4:37290710-37290732 AAAAGGTGAAGTCTGCAGAAAGG + Intronic
974375150 4:61066497-61066519 CAAATCTGAGCTCTTCACCAAGG - Intergenic
975190509 4:71455259-71455281 CCAGTGAGAGATCTGCAGCATGG + Intronic
977054781 4:92178260-92178282 AAAATGTGTGGTCTTGAGCAAGG - Intergenic
977163587 4:93667528-93667550 CAAAAGAGAGGTCTGCAGATGGG + Intronic
978600038 4:110418275-110418297 CAAATGTGATGATTGCGGCAAGG + Intronic
980725592 4:136756258-136756280 AAAATGTTAGTTCTTCAGCATGG + Intergenic
982177160 4:152716596-152716618 CAAATGTGATGTGTGCTGGATGG - Intronic
983217792 4:165018207-165018229 AAAGTGTGACATCTGCAGCAAGG + Intergenic
984193506 4:176632237-176632259 AAAATGTGTGATCTTCAGCACGG + Intergenic
984769964 4:183428917-183428939 CAAATTTGAGGACTGCAACCTGG - Intergenic
985759076 5:1735556-1735578 CAACTCTGTGGTCAGCAGCAGGG + Intergenic
986302992 5:6493208-6493230 CAAATGTCAGGTTTCCAGGATGG - Exonic
986547177 5:8910624-8910646 AAAATGAGAGGTCTTCAGAATGG + Intergenic
988647327 5:33108680-33108702 CCATTCTGAGGTCTGCAGGATGG - Intergenic
989959937 5:50400909-50400931 CAAATGTGAGCTCAGAAGAATGG + Intronic
990109220 5:52303505-52303527 TAAGTGTTAGGTCTTCAGCAAGG + Intergenic
991674914 5:69081139-69081161 CAAGGTTGAGGACTGCAGCATGG + Intergenic
992074682 5:73180713-73180735 CAACAGTGAGGTTTGCTGCATGG - Intergenic
995187959 5:109290888-109290910 GGAATGTGAGGGCTGCTGCATGG - Intergenic
996251641 5:121342408-121342430 CAATTGTGAGGACAGCACCAAGG + Intergenic
997014581 5:129917851-129917873 TACAGGTGAGGCCTGCAGCATGG + Intronic
1002639222 5:180622770-180622792 CAAGTGTGTGGTCTCCAACAAGG - Exonic
1003976588 6:11350750-11350772 CCACTGTGAGGTCAGCGGCAGGG - Intronic
1004456189 6:15793526-15793548 CACCTGTGAGCTCTGCAGCTGGG - Intergenic
1005764247 6:28995315-28995337 CAAATGTGAGGTATGTGGAATGG - Exonic
1006337929 6:33430668-33430690 CATATGTGAGCTCTGCAACAAGG - Intronic
1006363973 6:33603987-33604009 CCATTCTGAGGTCTGGAGCATGG + Intergenic
1008384209 6:50869533-50869555 CAAATGTGGGGGCAGCAACATGG + Intergenic
1009420179 6:63456318-63456340 CAAGTTTGAGGTCTGCAACCTGG - Intergenic
1009780515 6:68262609-68262631 AATATGTGATGTCTGCAGCAAGG + Intergenic
1010823121 6:80439732-80439754 CAAATGTATGCTCTACAGCAGGG + Intergenic
1011760018 6:90553548-90553570 AAAATGTGACGTCTTCAGCTGGG - Exonic
1013300715 6:108802781-108802803 CCAATGTCATGTCTTCAGCAAGG - Intergenic
1013448614 6:110256649-110256671 CATCAGTGAGGTCTGAAGCAAGG - Intronic
1015012117 6:128362282-128362304 CAATTGTGAGGACAGCACCAAGG + Intronic
1019856732 7:3616298-3616320 TGAATGTGAGGTGGGCAGCATGG + Intronic
1022532892 7:31078204-31078226 CACATGTGAGCTCAGGAGCAGGG - Intronic
1024168268 7:46756820-46756842 TACATGTGAGGTTTGGAGCATGG - Intronic
1026481239 7:70781437-70781459 CAAATGTCAGATCTGCAGGCCGG - Intronic
1027627500 7:80564006-80564028 AAAATGTGAGGGCTGGTGCATGG + Intronic
1027906015 7:84183219-84183241 TAGGTGTGAGGACTGCAGCATGG - Intronic
1029043930 7:97607283-97607305 CAAATTTGAGGACTGCAACTGGG + Intergenic
1029294166 7:99526246-99526268 CAAATGTCAGGTGTGCGGAAAGG + Exonic
1030016786 7:105230603-105230625 CAAATGTGAGTGGTGAAGCAAGG - Intronic
1030125563 7:106149725-106149747 CAAATTTGAGGATTGCAGCCAGG + Intergenic
1030762633 7:113370211-113370233 CAAATGTGACGTTTTCAGAAGGG - Intergenic
1030875142 7:114804969-114804991 CACAGGTGAAGTCTGCAGAAAGG - Intergenic
1031148649 7:118026958-118026980 CAAAGGTCCAGTCTGCAGCATGG + Intergenic
1035627581 8:1083219-1083241 CAAATGTCAGCTCTCCAGCAAGG + Intergenic
1036137670 8:6176543-6176565 CCATTGTGAGTTCTGCTGCAAGG - Intergenic
1039962674 8:42261714-42261736 CAAAGTTGAGGACTGCAGCCCGG - Intergenic
1041394360 8:57376189-57376211 CAACTGTGAGACATGCAGCAGGG + Intergenic
1042791269 8:72608633-72608655 CAATGGTGAGGTATCCAGCAGGG + Intronic
1043265911 8:78267215-78267237 CAATTCTGAGGTCTGGAGGATGG - Intergenic
1044868437 8:96595099-96595121 GAAATTTGTGGTCAGCAGCATGG + Intronic
1049331269 8:142055194-142055216 AACATGTGAAGTCCGCAGCATGG - Intergenic
1056728281 9:89141851-89141873 GAAATGCGTTGTCTGCAGCAGGG + Intronic
1056944835 9:90985384-90985406 CTACTGTGAGGTCTAGAGCAGGG - Intergenic
1059493637 9:114691173-114691195 CAAATGCGAAGGCTGCAGCAGGG + Intergenic
1060593157 9:124832049-124832071 CAAATGTGAAGCCTTTAGCAGGG - Intergenic
1061856709 9:133445504-133445526 CAAAGGTGGGGTGTGCAGCAAGG + Intronic
1062637404 9:137498761-137498783 CGAGGGTGAGGGCTGCAGCAGGG + Intronic
1186601110 X:11038426-11038448 CAAATGTTAACTCTGAAGCATGG + Intergenic
1187943991 X:24408795-24408817 CAAATGTCAGAGCTGCATCATGG + Intergenic
1188305678 X:28557938-28557960 CAATTCTGAGGTCTGGAGGATGG + Intergenic
1195203111 X:102568245-102568267 CAAAGGTGGACTCTGCAGCAGGG + Intergenic
1197656162 X:129118133-129118155 CAAATGGGAGGGCTGCAGTTGGG - Intergenic
1201598988 Y:15706607-15706629 CAAATCTGAAGTTTGCAGAAGGG + Intergenic