ID: 1136479365

View in Genome Browser
Species Human (GRCh38)
Location 16:30532319-30532341
Sequence GGCAGCGGGGAGCAAGGTGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 495
Summary {0: 1, 1: 1, 2: 5, 3: 38, 4: 450}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136479352_1136479365 12 Left 1136479352 16:30532284-30532306 CCCTGCCTCAGCAAAGGGGGCCT 0: 1
1: 0
2: 2
3: 14
4: 298
Right 1136479365 16:30532319-30532341 GGCAGCGGGGAGCAAGGTGCTGG 0: 1
1: 1
2: 5
3: 38
4: 450
1136479358_1136479365 -8 Left 1136479358 16:30532304-30532326 CCTTGGAGAGCCCAGGGCAGCGG 0: 1
1: 0
2: 4
3: 55
4: 363
Right 1136479365 16:30532319-30532341 GGCAGCGGGGAGCAAGGTGCTGG 0: 1
1: 1
2: 5
3: 38
4: 450
1136479347_1136479365 18 Left 1136479347 16:30532278-30532300 CCTCAGCCCTGCCTCAGCAAAGG 0: 1
1: 0
2: 2
3: 44
4: 458
Right 1136479365 16:30532319-30532341 GGCAGCGGGGAGCAAGGTGCTGG 0: 1
1: 1
2: 5
3: 38
4: 450
1136479353_1136479365 11 Left 1136479353 16:30532285-30532307 CCTGCCTCAGCAAAGGGGGCCTT 0: 1
1: 0
2: 1
3: 11
4: 313
Right 1136479365 16:30532319-30532341 GGCAGCGGGGAGCAAGGTGCTGG 0: 1
1: 1
2: 5
3: 38
4: 450
1136479355_1136479365 7 Left 1136479355 16:30532289-30532311 CCTCAGCAAAGGGGGCCTTGGAG 0: 1
1: 0
2: 1
3: 19
4: 250
Right 1136479365 16:30532319-30532341 GGCAGCGGGGAGCAAGGTGCTGG 0: 1
1: 1
2: 5
3: 38
4: 450

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136479365 Original CRISPR GGCAGCGGGGAGCAAGGTGC TGG Exonic
900100359 1:959856-959878 GGTAGCGGGAAGGAAGGCGCCGG - Intergenic
900127418 1:1074661-1074683 GGCAGCAGTGAGCAAAGGGCAGG - Intergenic
900176880 1:1294946-1294968 GGCCGGGGGGAGCCAGCTGCAGG + Intronic
900254825 1:1692669-1692691 GGCAGCGAGGAGCCCGATGCAGG - Intronic
900263576 1:1745944-1745966 GGCAGCGAGGAGCCCGATGCAGG - Exonic
900501244 1:3005742-3005764 CGCAGGGGGAAGGAAGGTGCAGG - Intergenic
900622521 1:3593824-3593846 GGCAGCAGGGAGGGGGGTGCTGG - Intronic
900665347 1:3811351-3811373 GACTGCAGGGAGGAAGGTGCTGG - Intergenic
900784088 1:4636770-4636792 GGCAGCGCTGAGGAAGGAGCGGG + Intergenic
901175311 1:7294454-7294476 GGCTGCGGGCAGCAGTGTGCGGG + Intronic
901198428 1:7453315-7453337 GACAGTGGGGAGGGAGGTGCAGG - Intronic
901657875 1:10781058-10781080 GGGAGCGGGGAGACAGGTGAAGG - Intronic
901759133 1:11459313-11459335 GCCAGCAGGGAGCAGGGTGCCGG + Intergenic
902515307 1:16986717-16986739 GGCAGATGGGAGAGAGGTGCCGG - Intronic
904586567 1:31584124-31584146 GGCAGCGGGGAGGCAGGGGCTGG + Intronic
905205214 1:36339466-36339488 GGCTGCGGGGAGCAGGGAGGGGG + Intergenic
905247835 1:36627099-36627121 TGGAGAGGGGAGCAAGATGCGGG - Intergenic
905816199 1:40952849-40952871 GGCAGTGGAGAGCCAAGTGCGGG - Intergenic
905920207 1:41714227-41714249 GGCAGTGGGGAGCAAGGGATGGG + Intronic
907517505 1:55001894-55001916 GGCAGAGGGGAGGAAGGTAAAGG + Intronic
907850754 1:58252617-58252639 AGCAGTGGGGAGCAAGATCCTGG - Intronic
907926286 1:58957910-58957932 GGCAGGTGGGAGAAAGGGGCAGG + Intergenic
908443951 1:64183662-64183684 GGCAGAGGAGAGCAAAGTCCGGG - Intergenic
909495358 1:76271799-76271821 GGCAGCTTGGAGCAGGGTGGTGG + Intronic
909804519 1:79858245-79858267 GGGAAAGGGGTGCAAGGTGCAGG - Intergenic
910410384 1:86937245-86937267 GGAAGGAGGGAGGAAGGTGCAGG - Intronic
911618355 1:100038606-100038628 CGCCGCGGGGAGGAATGTGCGGG + Intronic
912696326 1:111844828-111844850 GGCAGAAGGGACCAAGATGCTGG - Intronic
913208091 1:116559671-116559693 GACAGCTGAGAGCAAGGTCCGGG - Intronic
913551296 1:119919431-119919453 AGTAGCGGGCTGCAAGGTGCAGG + Exonic
914813668 1:151047840-151047862 GGCGGCGGGGACCATGGGGCTGG - Exonic
914995270 1:152538010-152538032 GGCAGTGGTCAGCAAGGTGGGGG - Intronic
916579658 1:166095848-166095870 GGCACAGAGGAGTAAGGTGCTGG + Intronic
916683767 1:167126658-167126680 AGAAGCAGGGAGCAGGGTGCGGG + Exonic
917583962 1:176405998-176406020 GTCACCTGGGAGCTAGGTGCTGG + Intergenic
919077416 1:192830398-192830420 GGCAGTGGGGAGCTAGGGGAGGG + Intergenic
919763517 1:201112536-201112558 GGCAGCGGGGAGCCGAGTGGAGG - Exonic
919802473 1:201361944-201361966 GGCTGAGAGGAGGAAGGTGCTGG - Exonic
920303927 1:205006814-205006836 GGCAGGGGGCAGGAAGATGCAGG + Intronic
920322405 1:205134592-205134614 GGCAGTGGGCAGCATGGTGAGGG - Intergenic
920513319 1:206566561-206566583 TGCAGTGGGGAGCAAGAGGCAGG + Intronic
920556188 1:206906730-206906752 GTCAGCTTGGAACAAGGTGCAGG + Intronic
920886918 1:209938291-209938313 GACAGCGGGGAGCGAGGACCGGG + Intronic
922757043 1:228102471-228102493 GGCTGGGGAGCGCAAGGTGCGGG - Exonic
924311455 1:242747877-242747899 GGCAGGGAGGAGCAGGGTGTGGG - Intergenic
1063117450 10:3081677-3081699 GGCAGTGGAGAGCTAGGTGGAGG + Intronic
1064554857 10:16538084-16538106 GGAAGCTGGGACCAAGGTGCCGG - Intergenic
1065001409 10:21340866-21340888 GACAGTAGGGAGCAAGGGGCAGG + Intergenic
1065373821 10:25016671-25016693 GGGACCGGGGAGCTAGCTGCAGG + Exonic
1065993257 10:31032497-31032519 GGGAGCCGGGAGCCAGGGGCGGG - Intergenic
1067281427 10:44876486-44876508 GCGAGTGGGGAGGAAGGTGCTGG - Intergenic
1067796083 10:49323240-49323262 GGCTGCTGGGAGGAAGCTGCTGG - Exonic
1068647602 10:59485412-59485434 GGCAGAGGGGAGCAGGGGGAGGG - Intergenic
1069707101 10:70465808-70465830 GACAGCAGGGAGAAAGGTCCTGG + Intergenic
1069753692 10:70760816-70760838 GGCAGCAGGGAGGCTGGTGCCGG - Exonic
1069876739 10:71567752-71567774 AGCAGCTGGGAGCAAGGAGAGGG - Intronic
1070579713 10:77710409-77710431 GGCTGTGGGGAGGGAGGTGCGGG - Intergenic
1071911800 10:90244527-90244549 GACAGCGGGGTGAAAGCTGCAGG + Intergenic
1073146275 10:101284104-101284126 GGGAGCGGGGAGCGAGGGGCGGG + Intergenic
1073216652 10:101840240-101840262 GGGGGCGGGGTGCAGGGTGCGGG - Intronic
1073477871 10:103766183-103766205 GCCAGGGGTTAGCAAGGTGCAGG + Intronic
1074190203 10:111128894-111128916 GGCAGGGGGGAGGAAGGGGGAGG - Intergenic
1074690713 10:116001931-116001953 GCCAGAGGGGAGCGAGGGGCAGG - Intergenic
1075089098 10:119433275-119433297 GGCAGTGGGGAGGAAGGTTTCGG - Intronic
1076353167 10:129832530-129832552 TGCAGGGGTGAGAAAGGTGCAGG + Intergenic
1077062665 11:624765-624787 GGCGGCGGGGAGCCAGGGGCTGG - Intronic
1077094002 11:791777-791799 GGCAGCAGGGGGCAGGGTGCAGG - Exonic
1077236216 11:1483209-1483231 GGGAGCTGGGAGCAGGGCGCAGG - Intronic
1077253964 11:1572435-1572457 GGGGGCGGGGTGCAGGGTGCGGG + Intergenic
1077325344 11:1961457-1961479 GGCAGAAGGGAGCAGGGAGCTGG - Intronic
1077341158 11:2027007-2027029 GGCAGCGGGCAGCACGGCGGGGG - Intergenic
1077484259 11:2831689-2831711 GGCAGCGGGGAGAAGGGTGCTGG - Intronic
1077562321 11:3271545-3271567 GGCAAAGGGGAGCAGGGGGCAGG - Intergenic
1077568215 11:3317365-3317387 GGCAAAGGGGAGCAGGGGGCAGG - Intergenic
1080802146 11:35618808-35618830 GGCAGAGGGAAGCGAGGCGCGGG - Exonic
1080902636 11:36510273-36510295 GGCTGCGGGGAGCGAGGGGCAGG + Intergenic
1081068598 11:38579961-38579983 GGGAGTGGGGAGCAAGGGGAGGG - Intergenic
1081606149 11:44528224-44528246 GTCACCCGGGAGCATGGTGCGGG + Intergenic
1081992164 11:47343660-47343682 GGCCTGGGGGAGCAGGGTGCGGG - Intronic
1083301117 11:61740041-61740063 GACAGCTGTGAGCAAGGTGGGGG + Intronic
1083310866 11:61783048-61783070 GGCTGCGAGGAGCAGCGTGCTGG + Intronic
1083592369 11:63903247-63903269 GGGAGCAGGGAGCAATGCGCTGG - Intronic
1083617975 11:64035821-64035843 GGCGGCGGCGAGCAGGGCGCGGG - Intronic
1083631337 11:64097050-64097072 GGCAGCAGGGAGACAGGAGCAGG - Intronic
1083651863 11:64208714-64208736 AGCAGGGAGGAGCAAGGTGGTGG + Intronic
1083886564 11:65576147-65576169 GGCAGCGGAGAGCGCGGTCCCGG + Exonic
1083897495 11:65627387-65627409 GGCAGCTGTGGGCAAGGGGCAGG - Exonic
1084184556 11:67464771-67464793 GGCACCGGGGCGGAAGGGGCGGG - Intronic
1084284347 11:68121618-68121640 GGGAGAGGGGAGCGAGGCGCGGG + Intergenic
1084939232 11:72603475-72603497 GGCAGCGGGGAGCAGCCTGCAGG - Intronic
1086780179 11:90894237-90894259 GGGGGTGGGGAGCAAGGTGAGGG - Intergenic
1086970965 11:93080384-93080406 GGCAGTGGGGAGCCAGGACCTGG - Intergenic
1087981278 11:104617559-104617581 GGAAGCGGGCAGCGAAGTGCTGG - Intergenic
1088624649 11:111721035-111721057 GGCAGCTGCTAGCAAGGTCCTGG - Exonic
1089285785 11:117407184-117407206 GTCAGCAGAGAGCAAGGGGCTGG + Intronic
1089729644 11:120512051-120512073 GGGAGCGGGGAGGAGGGCGCGGG - Intronic
1090124945 11:124075688-124075710 GGCTGAGGGCAGCTAGGTGCTGG - Intergenic
1090228772 11:125087037-125087059 GGAAGAGGGGAGCAGGGGGCTGG + Intronic
1090437453 11:126698503-126698525 GGCTGCAGGGAGAAAGGGGCTGG + Intronic
1091007605 11:131967555-131967577 GCCAGGGAGGAGCAAGGAGCAGG + Intronic
1202808325 11_KI270721v1_random:16636-16658 GGCAGAAGGGAGCAGGGAGCTGG - Intergenic
1202824143 11_KI270721v1_random:82196-82218 GGCAGCGGGCAGCACGGCGGGGG - Intergenic
1092229154 12:6767091-6767113 GGCAGCGGGGCGCAGGGAGGGGG - Intronic
1092231903 12:6780664-6780686 GGCTGTGGGGAGCAGGGTCCTGG - Intergenic
1092247777 12:6873085-6873107 GGCAGCGAGGAGGGAGGAGCGGG - Intronic
1093200147 12:16176920-16176942 GGCAGCAGGGAGCAGCGTGGAGG - Intergenic
1094026926 12:25969067-25969089 GGCTGGGGGGAGCAAAGGGCTGG + Intronic
1096580500 12:52581672-52581694 GGCAGCGTGGAGCAAGGGTGGGG + Intergenic
1097185865 12:57196010-57196032 GGCAGAGGGGAGCCAGGTCTGGG - Intronic
1097430000 12:59493737-59493759 GGCAGAGGGGAGCAAGCTGCTGG + Intergenic
1100565490 12:95790461-95790483 GGCAGCTGGGAGCCAGGGGCCGG + Exonic
1101409528 12:104457221-104457243 GGCAGGGGTGTGGAAGGTGCCGG - Exonic
1102506798 12:113389011-113389033 TGCAGCTGGGAGAAGGGTGCTGG - Exonic
1103631555 12:122265890-122265912 AGCAGCAGGTTGCAAGGTGCAGG + Intronic
1103944260 12:124517550-124517572 GGCAGGGGAGAGCCAGGTGCAGG - Intronic
1104035828 12:125096554-125096576 GGCTGGAGGGAGCCAGGTGCAGG + Intronic
1104718357 12:131031097-131031119 GGCCCCGGGGAGCCAGGGGCTGG + Intronic
1105014182 12:132776184-132776206 AGCAGCAGGGAGGAAGGAGCTGG - Intronic
1105014213 12:132776343-132776365 AGCAGCAGGGAGGAAGGAGCTGG - Intronic
1105014230 12:132776420-132776442 AGCAGCAGGGAGGAAGGAGCTGG - Intronic
1105014264 12:132776578-132776600 AGCAGCAGGGAGGAAGGAGCTGG - Intronic
1106432414 13:29693783-29693805 GGCAGGGTGGAGCCAAGTGCAGG + Intergenic
1106928160 13:34634544-34634566 GGAAGCTTGGAGCCAGGTGCCGG + Intergenic
1107307376 13:39037683-39037705 GGCGGCGGGGAGGGAGGCGCCGG + Exonic
1107481553 13:40789716-40789738 GGGAGCGGGGAGCGGGGCGCGGG + Intronic
1108677953 13:52753794-52753816 GGCAGAGTGGAGCAAGCTGGTGG + Intergenic
1110655690 13:77996010-77996032 GGGAGTGGGGAGCAAGGGGAGGG + Intergenic
1110725348 13:78816670-78816692 AGAGGCGAGGAGCAAGGTGCAGG + Intergenic
1110999960 13:82165669-82165691 GGCAGCGGGAGGCAAAGTCCTGG - Intergenic
1111161453 13:84399693-84399715 GGCAGGGGGGAGCCAGGAACTGG + Intergenic
1112086246 13:96034856-96034878 GCCAAGGGGGAGCCAGGTGCAGG - Intronic
1112290593 13:98142354-98142376 CGGAGCGGGGAGCAAGATTCAGG - Intergenic
1113119036 13:106906620-106906642 GGCAGCAGGGAGCAGGCGGCGGG + Intergenic
1113955518 13:114098316-114098338 GGCAACAGGGACCCAGGTGCGGG + Intronic
1113985303 13:114310194-114310216 GGCAACTGGGAGCCTGGTGCTGG - Intergenic
1114906627 14:27136207-27136229 GGCAGCTAGTAGCAAGATGCTGG - Intergenic
1116776198 14:49183658-49183680 GGGAGTGGGGAGCAAGGGGAGGG + Intergenic
1117278995 14:54219496-54219518 GGCTGCGGAGAGCAAGGGTCAGG - Intergenic
1118471260 14:66077288-66077310 GGCAGTGGGGATGAAGGGGCAGG - Intergenic
1119658486 14:76434242-76434264 GGCAGGGGGAAGAAAGTTGCTGG - Intronic
1119659307 14:76439165-76439187 CGCAGCCGGGAGCAAGTTTCTGG - Intronic
1119769496 14:77211575-77211597 GGAAGTGGGAAGCAAAGTGCTGG + Intronic
1120898892 14:89558752-89558774 GCCAGAGGTGAGCAAGGAGCAGG + Intronic
1121027825 14:90629570-90629592 GGCAGCCCGGGGCCAGGTGCTGG + Intronic
1121120714 14:91374118-91374140 GGCTGCGGGGAGGAAGGCTCTGG + Intronic
1121190643 14:92026466-92026488 GGCTGCGGCGAGCAAGGAGGCGG - Intronic
1121328227 14:93034143-93034165 GGCACCTGGGAGGAAGGTGTCGG - Intronic
1121463579 14:94100347-94100369 GGCAGCTGGGACCAAAGTTCTGG - Intronic
1122273715 14:100580432-100580454 GGCAGCGGGGAGCACGGGGCGGG - Intronic
1122318740 14:100840805-100840827 GGCTGCGGGGAGAGAGGTCCAGG + Intergenic
1122403381 14:101480905-101480927 GGGAGCAGGGAGCAGGGAGCTGG + Intergenic
1124376616 15:29132848-29132870 GGCAGAGGGGTCCAAGGGGCAGG + Intronic
1125021743 15:34992980-34993002 GGCAGCTGGGAGCAGGGAGAGGG + Intergenic
1127279291 15:57475234-57475256 GGCAGGTGGGAGCCAGGTGGTGG - Intronic
1127609167 15:60620615-60620637 AGCAGCTGGGACCAAGGGGCTGG + Intronic
1128077357 15:64835916-64835938 GGCAGCAGGGAGCAGAGTGTCGG - Intergenic
1128847822 15:70917157-70917179 GGCTGAGGGCAGCTAGGTGCTGG + Intronic
1129706493 15:77797602-77797624 GGCTGCTGGGAGCCAGGTGCTGG - Intronic
1130052596 15:80496289-80496311 GGGAGCAGGGAGAAGGGTGCTGG - Intronic
1130380803 15:83371064-83371086 GGGAGCGGGGAGCAGAGAGCAGG + Intergenic
1132609299 16:807393-807415 GGGAGCGGGAGGGAAGGTGCGGG - Intronic
1132724124 16:1331497-1331519 GGCAGGGGTGAGCAGGGTGCTGG + Intergenic
1132725221 16:1335472-1335494 GGCAGGAGTGAGCCAGGTGCAGG - Intronic
1133253680 16:4502613-4502635 GGCAGCAGAGAAAAAGGTGCTGG - Intronic
1134208871 16:12259489-12259511 AGCTGCGGGGAGCCAGGTGGGGG - Intronic
1135158513 16:20073823-20073845 GGGCGCGGGGCGCAGGGTGCGGG + Exonic
1136479365 16:30532319-30532341 GGCAGCGGGGAGCAAGGTGCTGG + Exonic
1136483070 16:30555013-30555035 GGCAGTGGGGAGCAAGGTGCTGG + Exonic
1136577668 16:31133960-31133982 AGCATCGGGGAGCATGGTGGAGG - Intronic
1137300444 16:47143721-47143743 GGGAGCGGGGAGGCAGCTGCTGG - Exonic
1138105745 16:54286376-54286398 GGCAGTGAGGAGCGAGGAGCGGG - Exonic
1138291354 16:55849806-55849828 TGCAGCGCGGAGCAGGGGGCTGG + Intronic
1138360517 16:56424710-56424732 GGCAGTGGGGAGGAACGGGCTGG - Intronic
1138591383 16:58001179-58001201 AGCAGCGGGCAGAAAGGTGAGGG + Intronic
1139296442 16:65905609-65905631 GGCTGCGGGGAGCAACAGGCAGG - Intergenic
1139432878 16:66920547-66920569 GGCAGCCTGGGGCAAGGTGGGGG - Intergenic
1139548578 16:67661159-67661181 GGTGGCGGGGACCAAGGAGCTGG - Intronic
1139597415 16:67966571-67966593 GGCAGGGGGTAGGGAGGTGCTGG - Intronic
1140148238 16:72333157-72333179 GGCAGCAGGGGGCAGGATGCTGG + Intergenic
1141425302 16:83940888-83940910 GGTAGCAGGGAGCAGGGGGCAGG + Intronic
1141509166 16:84501498-84501520 GACAGCCGGGAGAAAGGTGCAGG + Intronic
1141523835 16:84598799-84598821 GGCGGCGGGGACCAAGCGGCAGG + Intronic
1142008314 16:87700794-87700816 GGCAGAGGGGAGGAGGTTGCAGG + Intronic
1142667275 17:1470294-1470316 GGCAGCGGGGGGCGTGGCGCAGG + Exonic
1142689108 17:1594206-1594228 GCCAACGGGAAGCAAGGTCCGGG + Intronic
1142746024 17:1958701-1958723 GGCAGCTGGCAGCAGCGTGCGGG + Intronic
1142879610 17:2874241-2874263 GGCAGAGGGGAGAAAGGGGAGGG - Intronic
1143099717 17:4498621-4498643 CGGAGCTGGGAGCAGGGTGCTGG - Intergenic
1143703063 17:8675808-8675830 GGCAAAGGGGAGCCAGGTGAAGG - Intergenic
1143830577 17:9647268-9647290 GGCAGGAGGGAGGAAGGTGGGGG - Intronic
1144423431 17:15118578-15118600 GGAAGCGAGAAGCAAGGTGAGGG - Intergenic
1144442002 17:15292120-15292142 GGAGGCGGGGAGCAAGGTTAAGG - Intergenic
1144557415 17:16294452-16294474 GGCAGCGGGGAGAACCGTACTGG - Intronic
1144757001 17:17685917-17685939 GGCGGCAGGGAGGAAGGTGAGGG - Intronic
1145415441 17:22710396-22710418 GGCAGTGGGAAGCAAAGTGGAGG + Intergenic
1146198376 17:30832335-30832357 GGAAGCGGGGAGTATGGTGGGGG + Exonic
1146399528 17:32492224-32492246 GCCAGCGGAGTGAAAGGTGCTGG - Intergenic
1146692716 17:34887791-34887813 GGCAGTGGAGACCAGGGTGCTGG - Intergenic
1146896472 17:36545273-36545295 GGCGGCGGGGAACAGGCTGCGGG + Intronic
1146901371 17:36591775-36591797 GGCAGAGGGGCGGAAGGGGCGGG + Intergenic
1147254666 17:39174691-39174713 GGAAGCTGGGAGGAAGGGGCAGG + Exonic
1148052440 17:44775817-44775839 GCCAATGGGGAGCAAGGGGCGGG + Intronic
1148760600 17:49997913-49997935 GACAGCGGGAAGCATGGGGCAGG + Intergenic
1148852630 17:50562138-50562160 GGCGGTGGGGAGGAAGCTGCGGG + Intronic
1149460067 17:56821541-56821563 GCCAGCTGGGAGCCTGGTGCTGG - Intronic
1149656220 17:58310831-58310853 GGTACCTGGGAGCAAGGTGCTGG + Exonic
1150640157 17:66944230-66944252 GGCAGCGGGGAGCTGGGACCAGG - Intergenic
1150654376 17:67030436-67030458 GGAAGCGGGGAGCGGGGAGCGGG - Intronic
1151243369 17:72775436-72775458 GGCACTGGGGAGTCAGGTGCAGG + Intronic
1151871559 17:76840349-76840371 GGGTGCAGGGAGCGAGGTGCTGG - Intergenic
1152067140 17:78118046-78118068 GGCTGCAGGGAGCAGGGTCCAGG - Intronic
1152157323 17:78643491-78643513 TGCTGCGGGGAGCTAGGGGCTGG - Intergenic
1152436573 17:80279961-80279983 GGCTGGGGGGAGCGCGGTGCGGG - Intronic
1152607051 17:81296834-81296856 GGAAGAGGGGAAGAAGGTGCTGG - Intergenic
1152644120 17:81460990-81461012 GGCAGCGGCCAGCAAGGGGCCGG + Exonic
1152722173 17:81928446-81928468 GTGAGCGGGGAGGAAGGGGCGGG + Intergenic
1152772347 17:82177933-82177955 GGCAGAGGGAAGCGGGGTGCAGG - Intronic
1152793354 17:82293494-82293516 GGCTGCGGGGAGGGAGGGGCGGG + Intergenic
1153872619 18:9334720-9334742 AGGGGCGGGGAGCAAGGAGCCGG + Intergenic
1154356458 18:13625781-13625803 GGCTGAGGGGAGGAGGGTGCTGG - Intronic
1154449356 18:14461561-14461583 GCCAGTGGGGAGGAAGCTGCGGG - Intergenic
1154470053 18:14692057-14692079 GGCAGCTGGAGACAAGGTGCAGG - Intergenic
1157286483 18:46380644-46380666 GGGAGCTGGGAGCAGGGAGCAGG + Intronic
1157323186 18:46649622-46649644 GGAAGCTGGGAGCTGGGTGCAGG - Intronic
1157485505 18:48084239-48084261 GGCAGTGGGGAGCAAAGATCAGG + Intronic
1157516398 18:48314777-48314799 GACAGCTGGGAGAAGGGTGCAGG + Intronic
1157762592 18:50275426-50275448 GCAGGCGGTGAGCAAGGTGCTGG + Intronic
1158454366 18:57593446-57593468 AGCAGCGGGAGGCAAGGGGCAGG + Intergenic
1158967212 18:62632971-62632993 GATAGCGAGGAGCAAAGTGCAGG + Intergenic
1159792957 18:72806689-72806711 GACAGTGGGAAGCAAGGTGAAGG - Intronic
1160724239 19:610596-610618 GGCAGCGGGAAGCAAGGCGGGGG - Intronic
1160744512 19:704286-704308 GGGAGTGGGGACCGAGGTGCAGG + Intergenic
1160919455 19:1513023-1513045 AGCGGCGGGGCCCAAGGTGCTGG + Exonic
1160930130 19:1566558-1566580 GTCAGCGGGGACCCAGGAGCGGG + Intronic
1161045050 19:2130228-2130250 GGCAGCCAGGAGGGAGGTGCTGG - Intronic
1161299096 19:3534328-3534350 AGGAGAGGGGAGCAAGGTGTCGG - Intronic
1161300062 19:3538171-3538193 GGAAGCGGAGACCAGGGTGCAGG + Intronic
1161327564 19:3670963-3670985 CGCGGCGGGGCGGAAGGTGCTGG + Intronic
1161332133 19:3693404-3693426 GGTGGCGGGGAGGCAGGTGCAGG + Intronic
1161688959 19:5719849-5719871 GGCGGCGCGGAGGAAGGAGCCGG - Exonic
1161730804 19:5959447-5959469 GGCTTCGGGGAGCATGGTGGGGG - Intronic
1162494309 19:11014579-11014601 GGCAGAGGGGAGCCAGGAGGTGG - Intronic
1162786713 19:13039625-13039647 TGCAGAGGGGAGCAATCTGCTGG + Intronic
1163442480 19:17328812-17328834 GGCGGCGGGGCGCAGGGCGCCGG + Exonic
1163666698 19:18606888-18606910 GGCGGCGGGGAGGCCGGTGCGGG - Intronic
1164394528 19:27851418-27851440 TGCAGCGGGGAGCTGGGTTCGGG + Intergenic
1165871643 19:38976790-38976812 TGCAGCGCGGAGCACAGTGCTGG + Intergenic
1167072346 19:47228261-47228283 GGCAGCGGGCAGCAGGGTGGGGG + Exonic
1167240310 19:48339443-48339465 GGGTGCGGGGAGCAAGGTGCGGG - Intronic
1167671306 19:50855241-50855263 AGCAGCTGGGAGCAGGGAGCTGG - Intronic
1167795258 19:51704505-51704527 GACAGCGGGGAGCTAGATGCTGG - Intergenic
1168401492 19:56088226-56088248 GGCGGCGGGGGGCGAGGAGCCGG - Exonic
925336459 2:3102333-3102355 GGCAGCTGTGAGCAGCGTGCGGG - Intergenic
926344134 2:11930260-11930282 GGCAGGGGTGAGCACGTTGCTGG + Intergenic
927171575 2:20374975-20374997 GGCAGCGAGGAGCAAGCGACGGG + Intergenic
927362813 2:22256172-22256194 GGCAGGAGGGAGCAAGGGGAAGG - Intergenic
928630925 2:33191126-33191148 GGAAACGGGGAGAAAGGTACTGG - Intronic
929002589 2:37362806-37362828 GGCAGAGGTGAGGAAGGGGCTGG + Intronic
929919131 2:46160203-46160225 GGCAGCAGGAAGGATGGTGCTGG + Intronic
930383294 2:50659075-50659097 GCCAGTGGGGAGCAAAGTGGAGG - Intronic
930685755 2:54306497-54306519 GCCACTGGGGAGAAAGGTGCAGG - Intergenic
930728802 2:54708895-54708917 AGCAGCGGTAGGCAAGGTGCAGG - Intergenic
930921846 2:56765386-56765408 GGCAGGGGGCACCAAGGAGCAGG - Intergenic
931787198 2:65630966-65630988 GGCAGTGGGCAGCAAGCTGAGGG - Intergenic
932114623 2:69035151-69035173 GGCAGCGGGGGGCGGGGTGGGGG + Intronic
932258108 2:70303989-70304011 GGCATGGGGGTGCAAGGTGGGGG + Intergenic
933810190 2:86028237-86028259 GGAAGCGGGAAGCAGGATGCAGG - Intronic
933816580 2:86073507-86073529 GGCAACTGTGAGCCAGGTGCTGG - Intronic
934058145 2:88269783-88269805 GAGAGGGGTGAGCAAGGTGCTGG + Intergenic
934187843 2:89762763-89762785 GGCAACTGGGAGCACAGTGCAGG - Intergenic
934656019 2:96117058-96117080 GGGAGCGGGGAGCGGGGAGCCGG + Intergenic
934725200 2:96612464-96612486 GGCAGTGAGAAGCAAAGTGCTGG - Exonic
934768987 2:96895968-96895990 GGGAGGGGGGAGGAAGGTTCTGG + Intronic
934916380 2:98304147-98304169 GGGAGGTGGGAGCAAGGGGCTGG + Intronic
935645297 2:105329590-105329612 GGCGGCGGGGCGCGGGGTGCGGG - Intronic
937206269 2:120238968-120238990 TGCAGCGGGGAGCGGGGAGCGGG - Intergenic
937279297 2:120706269-120706291 GGCAGCTGGCAGCAAGGAGAGGG - Intergenic
937412032 2:121685100-121685122 AGCTGCCGGGAGCAAGGTGGTGG + Intergenic
938909779 2:135875821-135875843 CGCAGCCGGGAGCATGGTGCTGG - Intronic
941607968 2:167623602-167623624 GGGAGTGGGGGGCAAGGTGAGGG + Intergenic
941706209 2:168661031-168661053 GGCAGCGGGGAGCAGAGAGGCGG + Intronic
941858364 2:170253196-170253218 GGCAGCTTGGACCAAGGTGAAGG + Intronic
941935104 2:170975796-170975818 GCCTGCTGGGAGCTAGGTGCTGG - Intergenic
942249815 2:174037970-174037992 GGCAGCAGGGAGAAAGGTATAGG + Intergenic
942428388 2:175883638-175883660 GGGAGCTGGGAGCAGGATGCTGG + Intergenic
943526637 2:189024779-189024801 GGTAGCTGGAAGGAAGGTGCTGG - Intergenic
946360962 2:219219049-219219071 GGGAGCGGGGGGAATGGTGCAGG + Intronic
946843198 2:223837632-223837654 GGCAGCGGGGAGGAGCGTGCAGG - Intronic
946843206 2:223837660-223837682 GGGAGCGGGGAGGAGGGCGCGGG - Intronic
947124347 2:226851608-226851630 GGTAGTGGTGAGCGAGGTGCAGG - Intronic
947641154 2:231708570-231708592 GGCTGCGGCGAGCAAGGAGGCGG - Exonic
948266789 2:236640902-236640924 GGCAGGTAGGAGCAAGGTCCAGG + Intergenic
948280206 2:236741017-236741039 GGAAGCGTGGAGGAAGCTGCAGG + Intergenic
948673282 2:239582077-239582099 GGGAGCAGGGAGCCAGGTGAGGG + Intronic
948694197 2:239724991-239725013 GGCAGCGGGGAGACAGGCGTCGG - Intergenic
948772311 2:240257992-240258014 GGCGGCGGAGAGCCAGGAGCGGG + Intergenic
949045639 2:241871596-241871618 GGCAGGGGGCAGCGAGGCGCTGG + Intronic
1169434188 20:5570574-5570596 GGCAGTGGGCAGCAATGTGTGGG - Intronic
1170623323 20:18011835-18011857 GGCTGCGGCGAGCAAGGAGCCGG - Intronic
1170628039 20:18044436-18044458 GGCAGCTGGGAGCAGGTGGCAGG + Intronic
1170763756 20:19273494-19273516 GGCAGAGGGCTGCAAGGTTCAGG - Intronic
1172545418 20:35757147-35757169 GGCATTGGGCAGCCAGGTGCTGG - Intergenic
1173523840 20:43717401-43717423 GGCTGCGGGGTGCGGGGTGCAGG - Intergenic
1173750352 20:45470799-45470821 GGCCGCGGGGAACAATGTCCCGG - Intronic
1173801631 20:45898044-45898066 GACAGCGGGGAGCAGATTGCCGG + Exonic
1174199689 20:48798542-48798564 TGCAGCGGGGAGGCTGGTGCTGG - Intronic
1174295102 20:49540157-49540179 GGCAGGAGGGAGCCCGGTGCTGG + Intronic
1174668987 20:52288364-52288386 GGCAGCCTGGACCAAGGTGGTGG + Intergenic
1175161309 20:57009885-57009907 GGCAGCGGGGAGCAAGTGAAGGG - Intergenic
1175247248 20:57589605-57589627 GGCAGTGGGCAGCAAGAAGCTGG - Intergenic
1175358610 20:58389532-58389554 GGCCGCGGGCAGGAAGGTGGCGG - Intronic
1175683253 20:61006653-61006675 GGCAGCTGAGAGCAAGGCCCTGG - Intergenic
1175785303 20:61708325-61708347 GGCAGAGGGGACCAAGCTGCTGG - Intronic
1175831659 20:61967831-61967853 GGGAGGGGGAAGGAAGGTGCAGG - Intronic
1175910621 20:62403631-62403653 GGCGGCGGGGAGGAGGCTGCAGG + Intronic
1176015139 20:62927004-62927026 GGCAGCGAGGGGCGAGGTCCAGG + Intronic
1176048192 20:63103303-63103325 GGGAGCGGGGAGGAAGGAGTGGG + Intergenic
1176048216 20:63103362-63103384 GGGAGCGGGGAGGAGGGAGCGGG + Intergenic
1176048221 20:63103376-63103398 GGGAGCGGGGAGGAAGGAGTGGG + Intergenic
1176060667 20:63171353-63171375 GGCAGCTGGGCACAAGGAGCAGG + Intergenic
1176235393 20:64051315-64051337 GGCAGCTGGCAGGAGGGTGCAGG + Intronic
1176902858 21:14464522-14464544 GGCAGTGGGGAGGAAGGGGAAGG + Intergenic
1178404718 21:32314885-32314907 GTCATCAGGGTGCAAGGTGCTGG + Exonic
1179483334 21:41692528-41692550 GGCAGTGGGGAGCTTGGTGGTGG + Intergenic
1180911172 22:19451628-19451650 GTTAGTGGGGAGCCAGGTGCAGG - Intronic
1180947227 22:19702920-19702942 GTCAGCGAGGAGCAAGGAGGAGG + Intergenic
1181023127 22:20113730-20113752 GGATGCGGGGAGCATGGTGCTGG - Exonic
1181316615 22:21974723-21974745 GGCTGCCGGGAGCCAGGAGCAGG + Intronic
1182352006 22:29704469-29704491 GGCGAAGGGGAGAAAGGTGCAGG + Intergenic
1182681402 22:32082728-32082750 GGCAGGGAGGAGCAAAGAGCTGG - Intronic
1183442268 22:37830030-37830052 GGCAGAGGGGAGGCAGGGGCAGG - Intergenic
1184355894 22:43979405-43979427 GGCAGCCGGGTGCACTGTGCAGG - Intronic
1184368593 22:44068398-44068420 GGAAAGGGGGAGCAAGTTGCCGG + Intronic
952529544 3:34249159-34249181 AGCAGCGGGGAGCAAAGAACTGG - Intergenic
952887044 3:38018358-38018380 GGCTGCAGGGAGCCAGGTCCAGG - Intronic
952906017 3:38139535-38139557 GGCAGATGTGAGCAAGGGGCTGG - Intronic
953427021 3:42804072-42804094 GACGGCGGGGAGCGAGGAGCGGG - Intronic
953874888 3:46661054-46661076 GGCAACGGGGACCGAGCTGCAGG - Intergenic
953902580 3:46851679-46851701 GGCAGTGGAGAGGAGGGTGCAGG + Intergenic
953912356 3:46899466-46899488 CACAGCGGGTAGCGAGGTGCCGG + Intronic
954151873 3:48661986-48662008 GGCAACAGGGAGCAAGGGTCAGG - Exonic
954385606 3:50242293-50242315 GGCAGATGGGGGCAAGGTACAGG + Intronic
954424260 3:50435031-50435053 GGCACCAGGGAGGAAGGGGCAGG + Intronic
955879935 3:63532544-63532566 GGCAGCTGAGAACAAGCTGCAGG + Intronic
958026982 3:88059668-88059690 GGGGGCGGGGAGCAAGGCGAGGG + Intronic
960058625 3:113296046-113296068 AGCAGCGGGGAGGATGGTGGGGG - Intronic
960404218 3:117239218-117239240 GCCACCCGGGAGCAAGGTCCTGG - Intergenic
961520854 3:127466660-127466682 GGCAGAGGGGTGCAGGTTGCAGG + Intergenic
963746524 3:149129828-149129850 GGCGGCGGGCTGCAAGGTGGAGG + Exonic
967928827 3:194675200-194675222 CGGAGGGTGGAGCAAGGTGCTGG + Intergenic
968393742 4:213860-213882 GGCAGCCGGCAGCAGGGTGCGGG - Intergenic
968715637 4:2157137-2157159 GGCTGTGGGGAGCTTGGTGCGGG + Intronic
968817386 4:2829096-2829118 AGCAGCTGGGAGGAAGGTGAAGG - Intronic
969021766 4:4143812-4143834 GGCATAGGCGAGGAAGGTGCGGG - Intergenic
969111517 4:4847232-4847254 GGCAGGGGGGTGGAGGGTGCAGG - Intergenic
969438451 4:7202082-7202104 GGGAGCGGGGAGAGAGGTACAGG - Intronic
969732102 4:8963603-8963625 GGCATAGGCGAGGAAGGTGCGGG + Intergenic
970427953 4:15962966-15962988 AGCAGCTTGGGGCAAGGTGCTGG - Exonic
972000419 4:34025096-34025118 GGCAGTGGGGAGCTAGGGGAGGG - Intergenic
973137338 4:46724501-46724523 GGCGGCGGGGCGCTGGGTGCCGG + Intergenic
974957039 4:68654594-68654616 GGCAGCAGGGAGTAGGGTGGAGG + Intronic
977354422 4:95927083-95927105 GGCTGTGGGGAGCAAGGGGAGGG - Intergenic
978400324 4:108324202-108324224 GGGAGTGGGGAGCAAGTTGCAGG - Intergenic
978619215 4:110622400-110622422 AGCAGCGGGGACCAAGCTGTCGG - Exonic
978692542 4:111532500-111532522 GGAGGCGGGGGGCAAGGTGGAGG + Intergenic
981885566 4:149668509-149668531 GGCAGCGGGGGGCAAGGGGAGGG + Intergenic
982114808 4:152089522-152089544 GGCAGCTTGGAGCAAGGTGGTGG + Intergenic
982521378 4:156420638-156420660 GGCTGAGGGGAGTGAGGTGCAGG + Intergenic
982560182 4:156920026-156920048 GGGAGAGGGGAGCAAGATGGAGG - Intronic
983927359 4:173416337-173416359 GGCAGCGGGGAGCATCGTTTGGG - Intergenic
983938436 4:173518845-173518867 GGAAGCGGGGAGCAGGGGGCGGG - Intergenic
985659216 5:1147521-1147543 GGCTGTGGAGACCAAGGTGCTGG - Intergenic
985777639 5:1853050-1853072 GGAAATGGGGAGCAAGGTGACGG - Intergenic
986089748 5:4492755-4492777 GGCAGCAGGGGGCCAGGTCCAGG + Intergenic
986137099 5:4990575-4990597 GGCAGTGGGGAGCCAGGAACTGG + Intergenic
986693740 5:10333965-10333987 GGCAGCGGCGACCCAGGGGCTGG + Intergenic
987323921 5:16795093-16795115 GTCAGCGGGGAGCAGGGATCTGG - Intronic
988755568 5:34244889-34244911 GGGGGCGGGGAGCAGGGTGAGGG + Intergenic
989099540 5:37811171-37811193 AGGACGGGGGAGCAAGGTGCAGG + Intergenic
989375518 5:40756155-40756177 GTCAGTGGGGAACAAGGTGAGGG + Intergenic
990825629 5:59894197-59894219 GGCAGTGGGGAGCAGTGTGGAGG - Intronic
991484502 5:67120355-67120377 TGCAGAGGGGAGCAAAGAGCTGG + Intronic
992769599 5:80035200-80035222 GGCCGCAGGGAGAAAGGCGCGGG - Intronic
992785373 5:80165690-80165712 GGGAGTGGGGAGCAGGGAGCAGG - Intronic
994154344 5:96486181-96486203 GTCAGCAGTGAGCAAGGTGTGGG + Intergenic
994721849 5:103389593-103389615 GGCAGTGGGGAGGAAGAGGCAGG + Intergenic
994886050 5:105563716-105563738 GGAAGCGGGGAACGAAGTGCTGG + Intergenic
995724666 5:115170212-115170234 GGCAGCGGGGAGCGGTGGGCGGG + Intronic
996082033 5:119267880-119267902 GGCAGCGGGGGGCAGAGGGCTGG - Intergenic
996260430 5:121460371-121460393 GGCAGTGGGAAGGAAGGTGCAGG + Intergenic
998410559 5:141907596-141907618 AGTAGCTGGGAGCAAAGTGCCGG + Intergenic
998940804 5:147280333-147280355 GGGAGCGGGGAGCCTGGGGCAGG + Intronic
998951079 5:147393620-147393642 GGGAGCCTGGAGCAAGGTGGAGG - Exonic
999380225 5:151116371-151116393 GGGTGCTGGGATCAAGGTGCAGG + Intronic
999768170 5:154756040-154756062 GGCGGCGGCGAGCCAGGCGCTGG + Intronic
1001267598 5:170285922-170285944 GGGAGCAGGGAGCACAGTGCTGG - Intronic
1002327225 5:178417706-178417728 TGAAGCGGGCAGCAAGGTGAGGG - Intronic
1002441111 5:179265051-179265073 GGCAGCGGGCAGTTTGGTGCAGG - Intronic
1002447972 5:179301784-179301806 GGCAGCAGGGCACATGGTGCAGG - Intronic
1002524066 5:179806089-179806111 GGCAGCAGGCAGCAGGGTGGGGG + Intronic
1003146126 6:3512066-3512088 GGCAGCTGGGACACAGGTGCTGG - Intergenic
1004470381 6:15923630-15923652 GGCAGCTGGGAGAAAGGAGGAGG + Intergenic
1004512541 6:16294669-16294691 AGCAGAGGGGAGCACGTTGCTGG + Intronic
1005554203 6:26956662-26956684 GGGGGCGGGGAGCAGGGTGAGGG + Intergenic
1005643990 6:27824229-27824251 CGCCGCGGCGAGCAAGGCGCCGG - Exonic
1005645207 6:27831401-27831423 CGCCGCGGCGAGCAAGGCGCCGG + Exonic
1005826249 6:29633070-29633092 GGGAGCGGGGAGCGGGGAGCCGG + Exonic
1006363083 6:33598240-33598262 GGCAGAGAGGAGCAAGGGGCAGG + Intergenic
1006618004 6:35342775-35342797 GGCGGCGGGGAACGGGGTGCGGG + Intronic
1007275600 6:40671317-40671339 GGCAGGGGGGAGCCAGGAACTGG - Intergenic
1007602453 6:43091031-43091053 GGAAGCGGGGAGCAAGGAGGGGG - Intronic
1008450162 6:51641895-51641917 GGGAGTGGGGAGCAAGGGGAGGG + Intronic
1008582908 6:52922460-52922482 AGCTGCCGGGAGCAAGGTGGCGG - Intergenic
1009978664 6:70700923-70700945 GTCATCGGGGAGCTAGGTCCTGG + Intronic
1010251588 6:73713078-73713100 GGCAGCGGGGAGGAGAGTGGGGG - Intronic
1010858587 6:80876138-80876160 GGTAGTGGGGAGCAAGGGGAGGG - Intergenic
1012000400 6:93647243-93647265 GGCAGTGGGGAGCAAGGGGAGGG - Intergenic
1012293998 6:97496520-97496542 GGTAGCGGGGACCCAGGGGCAGG + Intergenic
1015942269 6:138464241-138464263 GGCAGAGAGGAGGACGGTGCCGG - Intronic
1017488631 6:154925030-154925052 GGTAGAGGGGAGCAATGTGCTGG - Intronic
1018650080 6:165986101-165986123 AGCAGCGAGGAGCAAGGTAGGGG - Intronic
1019446401 7:1073842-1073864 GGCAGCGGGGTGCAGGGTTGGGG - Intronic
1019446483 7:1074087-1074109 GGCAGCGGGGTGCAGGGTTGGGG - Intronic
1019486842 7:1293301-1293323 GGCAAAGGGGTGCAGGGTGCTGG + Intergenic
1020238503 7:6374621-6374643 GGCGGCGGGGCGCTGGGTGCCGG - Exonic
1020244747 7:6421765-6421787 GTCAGCGGAGAGTGAGGTGCTGG - Exonic
1021091340 7:16486558-16486580 GGCAGTGGGGGGCAAGGGGAGGG + Intronic
1022185228 7:27960792-27960814 GGCTGCTGGGAGAAAAGTGCAGG + Intronic
1022875513 7:34524390-34524412 GGCAGTGGGGAGGATGCTGCGGG - Intergenic
1023081939 7:36534193-36534215 GGCAGCGTGGAGCAAGGCCAGGG - Intronic
1024727091 7:52210523-52210545 GACAGCAGGGAGCCAGGGGCAGG - Intergenic
1026175592 7:67994025-67994047 GGTAGCTGGGACTAAGGTGCAGG + Intergenic
1027390447 7:77697624-77697646 CGCAGCGGAGAGTAGGGTGCAGG - Intronic
1028160099 7:87475693-87475715 GGCCGCGGCGAGCAAAGTCCAGG - Exonic
1028184800 7:87769794-87769816 GGCAGTGGGGAGCAAGGGAAGGG - Intronic
1029458305 7:100681998-100682020 GGCAGCGGAGAGGAGGGTGAAGG + Intronic
1029458602 7:100683148-100683170 GGGGGCGGGGAGCTGGGTGCGGG + Exonic
1032322994 7:130901341-130901363 GCCTGCGGGGAGCAGGGAGCAGG - Intergenic
1032455043 7:132066823-132066845 GGCAGACGGGAGCAGGGTCCTGG + Intergenic
1034589681 7:152128846-152128868 GGGAGCGGGGAGCGGGGAGCGGG + Intergenic
1034992278 7:155555385-155555407 GGCAGCCGGCAGGAGGGTGCTGG + Intergenic
1035029401 7:155847757-155847779 GGCTGCGGGGAGGAAGGTGTGGG - Intergenic
1036733269 8:11284686-11284708 GGCCGCGGGGAGACAGGGGCTGG - Exonic
1036815917 8:11902751-11902773 GGCAGCGGAGATGGAGGTGCAGG - Intergenic
1037688290 8:21162320-21162342 GGTAGCTTGGAGCAAGGTGGTGG - Intergenic
1037772819 8:21812373-21812395 GGCAGCAGAGAGCAGGGTGCGGG - Intergenic
1037930519 8:22877593-22877615 GGCAGCGGGGAGGAGGCTCCTGG + Intronic
1038056102 8:23859174-23859196 GGGTGCGGGGAGCAGGGTACAGG + Intergenic
1039048503 8:33472276-33472298 TGCAGCAGGGAGCAGGGGGCAGG + Intronic
1039068782 8:33632008-33632030 GGCGGCGTGGAGCAAGGAGCGGG - Intergenic
1039419174 8:37421280-37421302 GGCAGCAGGGAGCAGGGTGCTGG - Intergenic
1042495920 8:69454489-69454511 GGCAGCGAGAAGAAAGCTGCTGG + Intergenic
1042852007 8:73226032-73226054 GGCAGGGGAGATCAAGGTTCTGG - Intergenic
1043428424 8:80171418-80171440 GACCGCGGCGAGCAAGGTGAGGG - Intronic
1043815382 8:84794701-84794723 GGCAGCAGTGAGGATGGTGCTGG - Intronic
1044038032 8:87331207-87331229 GTCAGCGGGGTGCAAGGGGTGGG - Intronic
1044335981 8:90985242-90985264 GGCGGCGGGGGGCGAGGGGCGGG + Exonic
1044632531 8:94293182-94293204 GACAGCAGGGAGCAGGGAGCAGG + Intergenic
1046946483 8:119978948-119978970 GGGAGCAGGGAGCAGGGAGCAGG - Intronic
1048572025 8:135664426-135664448 TGCAGCAGCCAGCAAGGTGCCGG - Intergenic
1048937873 8:139371789-139371811 GGCTGTGGGGAGCATGATGCAGG + Intergenic
1048974907 8:139665840-139665862 GGCAGCGGGGTGGATGGTGGAGG - Intronic
1049364468 8:142230321-142230343 GGGAGCAGGGAGCAAGGGACAGG + Intronic
1049585666 8:143431333-143431355 GGCACCGGGAAGCACGGGGCGGG + Intergenic
1049679403 8:143910954-143910976 GGCAGCGGGAGGGAAGGTGGGGG + Intergenic
1052033932 9:23659089-23659111 GGCAGCGTGGAGCACGATGATGG + Intergenic
1053353829 9:37430423-37430445 GGGAGTCGGGAGCAAGGGGCTGG + Intronic
1053435349 9:38069988-38070010 GCCGGCGGGGAGCAAGTTGTGGG + Intergenic
1055670961 9:78605788-78605810 GGCTGCAAGGGGCAAGGTGCTGG + Intergenic
1055945527 9:81688711-81688733 GGCGGCGGCGGGCGAGGTGCAGG + Exonic
1056760909 9:89414441-89414463 GGAAGCAGGCAGCCAGGTGCTGG + Intronic
1057276912 9:93680919-93680941 GGCTGCGGGGCTGAAGGTGCAGG - Intergenic
1057358022 9:94347659-94347681 AGCCGCGGCGAGCAAGGAGCTGG + Intergenic
1057649727 9:96909958-96909980 AGCCGCGGCGAGCAAGGAGCTGG - Intronic
1058110794 9:101029159-101029181 GGCAGCGCGGGGCAAGCTCCTGG + Intronic
1058226678 9:102372365-102372387 GGCAAAGGGGAGCAAGATGGTGG - Intergenic
1060278294 9:122198583-122198605 GGCAGCTGGAAGGACGGTGCAGG + Intronic
1060418988 9:123454151-123454173 TGCAGCAGGGAGCAGGGTACAGG - Intronic
1061096052 9:128457133-128457155 GGCAGAGGGGAGGAAGGGGAGGG - Intronic
1061108704 9:128552221-128552243 GGTGGCGGGGCGCAAGCTGCGGG + Intergenic
1061144773 9:128791203-128791225 GGCAGTGGGGAGGAAGGGGGAGG + Intronic
1061578470 9:131522499-131522521 GGGAGCAGGGAGCAAGGCCCAGG + Intronic
1061710835 9:132486708-132486730 GGCAGCGAGCAGCGAGGTGCGGG - Intronic
1062357026 9:136169939-136169961 GGCTGGGGGAAGCAAGGTGGAGG - Intergenic
1188106395 X:26152469-26152491 GTCAGTGGGGAGAATGGTGCTGG + Intergenic
1190106799 X:47566926-47566948 GGCAGCGGGGGTCAGGGTGCAGG - Intronic
1194626288 X:96230019-96230041 GTCATCTGGGAGCAAGGTCCTGG - Intergenic
1195344339 X:103934481-103934503 GGGAGCGGGGGGCAAGGGGAGGG - Intronic
1195345631 X:103948039-103948061 GGGAGCGGGGGGCAAGGGGAGGG + Intronic
1195360992 X:104084022-104084044 GGGAGCAGGGAGCAGGGAGCAGG + Intergenic
1196800771 X:119541299-119541321 AGCAAGGGGTAGCAAGGTGCTGG - Intronic
1198215230 X:134549463-134549485 GGTTGCGGGGCGCGAGGTGCTGG + Intergenic
1199656984 X:150005988-150006010 GGTAGAGTGGAGTAAGGTGCAGG - Intergenic
1199929984 X:152508189-152508211 GGCGGAGGGGAGCATGCTGCTGG - Intergenic
1200054237 X:153450439-153450461 GGCAGCGGGGTGCCAGGGACAGG - Intronic