ID: 1136479574

View in Genome Browser
Species Human (GRCh38)
Location 16:30533205-30533227
Sequence GTCCCTGTCCACGCGGGCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 2, 1: 0, 2: 0, 3: 4, 4: 107}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136479574_1136479583 13 Left 1136479574 16:30533205-30533227 CCACAGCCCGCGTGGACAGGGAC 0: 2
1: 0
2: 0
3: 4
4: 107
Right 1136479583 16:30533241-30533263 CCCCGACTGCTCCTAGGAGATGG 0: 1
1: 0
2: 1
3: 11
4: 116
1136479574_1136479580 7 Left 1136479574 16:30533205-30533227 CCACAGCCCGCGTGGACAGGGAC 0: 2
1: 0
2: 0
3: 4
4: 107
Right 1136479580 16:30533235-30533257 CTGGACCCCCGACTGCTCCTAGG 0: 1
1: 0
2: 2
3: 18
4: 161
1136479574_1136479586 16 Left 1136479574 16:30533205-30533227 CCACAGCCCGCGTGGACAGGGAC 0: 2
1: 0
2: 0
3: 4
4: 107
Right 1136479586 16:30533244-30533266 CGACTGCTCCTAGGAGATGGAGG 0: 1
1: 0
2: 1
3: 14
4: 292

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136479574 Original CRISPR GTCCCTGTCCACGCGGGCTG TGG (reversed) Intronic
902292811 1:15446424-15446446 GTCCCTGTTCAAGGGGTCTGAGG - Intronic
902435136 1:16393518-16393540 GTCCCAGTCCACCCGGGAAGAGG + Intronic
905104660 1:35557368-35557390 GTCGCTGTCCAGGGAGGCTGAGG - Exonic
916802393 1:168226699-168226721 GTCCCTGTCCTCATGGGATGGGG - Intronic
917910388 1:179638646-179638668 GTCCCTGTTCACGTGGTCTTGGG + Intronic
920378377 1:205521734-205521756 GACCCTTTCCAGGCTGGCTGAGG + Intronic
921165520 1:212504109-212504131 GTCCCTGCCCACACTGGCTCTGG + Intergenic
922748466 1:228060037-228060059 GGCCCCTTCCACGGGGGCTGTGG + Exonic
1065047183 10:21754837-21754859 TTCCCTGTCCCTGCTGGCTGAGG + Intergenic
1065596655 10:27319832-27319854 GCCGCTGTCCCCGCTGGCTGCGG - Intergenic
1067066111 10:43105194-43105216 GTGCTTGTCCGCGCGTGCTGTGG + Intronic
1067374092 10:45711470-45711492 GTCCCTGGCAACACGTGCTGTGG + Intergenic
1067379594 10:45760792-45760814 GTCCCTGGCAACACGTGCTGTGG - Intronic
1067750434 10:48968003-48968025 GTCCCTTTCCATGAGGGCAGGGG - Intronic
1067881920 10:50053224-50053246 GTCCCTGGCAACACGTGCTGTGG + Intergenic
1067887292 10:50101449-50101471 GTCCCTGGCAACACGTGCTGTGG - Intronic
1068908454 10:62352554-62352576 GTCCCTGTCCATGTGGGCCTTGG + Intergenic
1075090449 10:119441377-119441399 GACCCTGCCCAGGTGGGCTGTGG + Intronic
1076761116 10:132606206-132606228 GAGGCTGTCCACGTGGGCTGAGG + Intronic
1076781551 10:132727552-132727574 GGTCCAGTCCACGCTGGCTGTGG + Intronic
1080503571 11:32892529-32892551 GTCCCTTCCCACGCGGGCCGCGG + Intergenic
1081796902 11:45826710-45826732 GTCCGTGTCCAGGCTGGGTGAGG + Intergenic
1081802495 11:45869655-45869677 GGCCCTGGCCAAGTGGGCTGAGG + Exonic
1082000147 11:47389717-47389739 GCCCCTGGCCACTGGGGCTGGGG - Intergenic
1083598367 11:63931104-63931126 GGCCCTGGCCAAGCGGGCAGGGG + Intergenic
1089713759 11:120336608-120336630 GTCCCTGTCACCTCGGGCCGCGG + Intergenic
1091823184 12:3491346-3491368 GCCCCTCTCCACCCGCGCTGCGG - Exonic
1092131210 12:6114547-6114569 GAACCTGTCCACACAGGCTGCGG + Intronic
1092206986 12:6620763-6620785 GGGCCTGTGCACGCGGGCGGCGG + Exonic
1098295652 12:69001462-69001484 GTCCCTTTTCTCGCTGGCTGTGG - Intergenic
1107826253 13:44331522-44331544 CTCCCTCTACACACGGGCTGTGG - Intergenic
1118293735 14:64549876-64549898 GTCCTAGGCCGCGCGGGCTGCGG - Intergenic
1118988733 14:70779065-70779087 GTCCAGGTCCAAGAGGGCTGAGG + Intronic
1119870563 14:78013417-78013439 GTCCCCTTCCACGCACGCTGTGG - Intergenic
1119898739 14:78242644-78242666 GTCCCTGGCCTCCCTGGCTGGGG + Intronic
1120844927 14:89117199-89117221 GTCCCTGTCCACGTGGGGCCAGG - Intergenic
1122871174 14:104639733-104639755 ATCCCTGGCCTCGGGGGCTGAGG + Intergenic
1124570306 15:30856781-30856803 GTCCTTGGCCACACCGGCTGTGG - Intergenic
1128333745 15:66773093-66773115 GGCCCTGTGCAGGCAGGCTGCGG + Intronic
1136479574 16:30533205-30533227 GTCCCTGTCCACGCGGGCTGTGG - Intronic
1136483351 16:30556164-30556186 GTCCCTGTCCACGCGGGCTGTGG - Intronic
1139947989 16:70654695-70654717 GTCCCTGTCCCCGCGTCCCGGGG + Intronic
1141694246 16:85612303-85612325 GTCCCTCTCCGCGCCGCCTGTGG + Intronic
1141846252 16:86610976-86610998 GTTCCTGGCCACGGGTGCTGAGG - Intergenic
1142102995 16:88285480-88285502 GGCCCTGCCCACGCTGGCTGTGG - Intergenic
1142178154 16:88654502-88654524 TTCCCTGTGGACGTGGGCTGTGG + Intronic
1142230037 16:88895792-88895814 GGCCCTGCCCTCGAGGGCTGGGG + Intronic
1142863461 17:2776972-2776994 GTCCCGATCCAGGCTGGCTGCGG - Intergenic
1144684385 17:17216357-17216379 GTGCGTGCCCCCGCGGGCTGTGG - Intronic
1144944634 17:18963668-18963690 ATCTCTGTCCACACGGGCAGTGG - Intronic
1145778016 17:27543102-27543124 GTCCCTGTCCACACACCCTGTGG + Intronic
1145932413 17:28695425-28695447 GTTCCTGTCCATGAGGTCTGAGG - Exonic
1145993583 17:29093266-29093288 CTCCCTGCCCATGCGGCCTGAGG - Intronic
1149486468 17:57046441-57046463 GTGCCGGCCCACGCGGGCTCAGG - Intergenic
1149491132 17:57085714-57085736 GTCACTGTCCTCGGGGGCGGGGG + Exonic
1151746734 17:76015541-76015563 GTTTCTGTCCACGCGGCCCGTGG - Exonic
1152870610 17:82751513-82751535 CTCCCCGTCCACGCATGCTGAGG + Intergenic
1157395508 18:47337668-47337690 CTCCCTGTCCCCGTGGGTTGGGG + Intergenic
1160827134 19:1085834-1085856 GTCCCCGTCCTCCCGGGCTGTGG - Exonic
1160947856 19:1651952-1651974 GTCCCCGTGCGCCCGGGCTGGGG + Intronic
1161014678 19:1977889-1977911 GTCCCTGTCCATCTGTGCTGGGG + Intronic
1161397545 19:4052531-4052553 GTTCCTGTCCCCACGGGGTGGGG + Intronic
1161855219 19:6760729-6760751 GTCCCAGGCCACAGGGGCTGTGG - Exonic
1162527575 19:11215383-11215405 CTACTTGTCCACGCGGTCTGAGG + Exonic
1164389100 19:27802387-27802409 CTCCCTTTCCCCGCGGGGTGGGG - Intergenic
1167035514 19:46993039-46993061 GTCCCTGTCCACACGGGGCCTGG - Intronic
1167376367 19:49114459-49114481 GGCCCTGCCCACCCGGGCCGCGG + Intronic
925018953 2:553646-553668 GTCCCTGTCCACCCAGGAGGAGG + Intergenic
925912522 2:8582984-8583006 GTTCCTGCCCATGCTGGCTGAGG - Intergenic
929600837 2:43203761-43203783 GTCTCTGTCCACTAGGGATGAGG + Intergenic
931882427 2:66581617-66581639 CTCCTTCTCCCCGCGGGCTGGGG + Intergenic
941709508 2:168697228-168697250 GTCCCTGTCAAAGCGAGCTTGGG + Intronic
946408776 2:219506354-219506376 CTCACTGTCCATGCGGGCTCGGG - Exonic
948872834 2:240812243-240812265 GTCCCTGTGGAAGGGGGCTGGGG + Intronic
1174362986 20:50040138-50040160 CTCCCTGTCCCCGGAGGCTGAGG + Intergenic
1175123104 20:56731666-56731688 GTTCCTGTCCACTAGGGATGAGG - Intergenic
1175302576 20:57953219-57953241 GTTCCCGTGCACGTGGGCTGTGG - Intergenic
1175954018 20:62599060-62599082 CTCACTGTCCACGCGCTCTGTGG + Intergenic
1180979320 22:19871354-19871376 GTCCCTCTGCGCCCGGGCTGAGG - Intergenic
1183669779 22:39265685-39265707 CTCCCTGCTCGCGCGGGCTGGGG + Intergenic
1184167015 22:42735701-42735723 CTCACAGTCCACGTGGGCTGGGG - Intergenic
1184702894 22:46188737-46188759 GTCCCAGTGCACTGGGGCTGTGG + Intronic
1185324043 22:50216968-50216990 GTCCTTGTCCAGCCGGGCTCTGG - Exonic
951072929 3:18353197-18353219 GTCACTGGCCACCCGGGGTGAGG - Intronic
961379316 3:126487002-126487024 GTCCCTGTCCACAGAGTCTGGGG + Intronic
966862762 3:184239701-184239723 GTCCCAGTCCATAGGGGCTGGGG - Exonic
968650147 4:1757214-1757236 CTCCCGCTCCAAGCGGGCTGAGG - Intergenic
975584742 4:75939227-75939249 GTCTGTGTCCACCAGGGCTGGGG - Intronic
977231143 4:94452251-94452273 GTCCCGGTCGGCCCGGGCTGCGG - Intronic
997673464 5:135695202-135695224 GTCCCTGTCCATCCAGTCTGAGG + Intergenic
997963358 5:138338628-138338650 CTGCCTGTCCCCGCGGGGTGGGG - Intronic
1000190807 5:158908884-158908906 CTACCTGTCCAGCCGGGCTGTGG + Intronic
1001094027 5:168762465-168762487 GACCCTGCCCACGCTGGCTCCGG + Intronic
1001867095 5:175115143-175115165 GTCCTTGTCCAGGCTGGGTGAGG + Intergenic
1013808714 6:114020511-114020533 GTCCCGGTGCAGGCAGGCTGGGG + Intergenic
1019547936 7:1587385-1587407 GTCCCTGCCCACCCCGGCCGCGG + Intergenic
1023230531 7:38023126-38023148 GTCCCAGTCCAAGGGGGCTGAGG - Intronic
1023965725 7:44962265-44962287 GTCCCTGTCCCTGCTGGATGTGG - Intergenic
1031042169 7:116849905-116849927 GTCCCTTCCCACCTGGGCTGAGG + Intronic
1034474358 7:151274158-151274180 GTCCCTGTCCTCAGGGCCTGCGG - Intronic
1035085611 7:156254970-156254992 GTCTCAGTCCATGCAGGCTGCGG - Intergenic
1044927388 8:97221209-97221231 GTCCCTGTCCAATCCAGCTGGGG - Intergenic
1048016988 8:130506564-130506586 CTCCCTTTCCACGCAGTCTGTGG + Intergenic
1049435752 8:142585530-142585552 GTCCCTGCCCACCCAGGCCGCGG + Intergenic
1049845547 8:144799119-144799141 GCCCCGGTCCATGCTGGCTGTGG + Intronic
1051362311 9:16291997-16292019 GTCCCTGACTACCCTGGCTGTGG - Intergenic
1051482880 9:17578852-17578874 GTTCCTGCCCCCGGGGGCTGCGG - Intergenic
1057843232 9:98502715-98502737 GTCCCTTTCCAGGCTGACTGGGG - Intronic
1061464509 9:130766950-130766972 GGCCCAGACCACGCAGGCTGTGG - Intronic
1062133809 9:134914271-134914293 GTCCCTGTCAATCCAGGCTGTGG - Intronic
1062549073 9:137077756-137077778 GGCCCTGCCCACGCGCTCTGGGG - Exonic
1062600052 9:137315514-137315536 GACCCGGTCCAGGAGGGCTGGGG + Intronic
1200061292 X:153484928-153484950 GACCCTAGCCACGGGGGCTGAGG + Intronic