ID: 1136480046

View in Genome Browser
Species Human (GRCh38)
Location 16:30535438-30535460
Sequence CAGGAAGACGTGAAGCAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 613
Summary {0: 1, 1: 2, 2: 9, 3: 74, 4: 527}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136480046 Original CRISPR CAGGAAGACGTGAAGCAGGA AGG Intronic
900154727 1:1199323-1199345 CAGGGAGGGGTGAAGCAGGAGGG + Intergenic
900410422 1:2510149-2510171 CAGGATGACCTGCAGGAGGAGGG + Exonic
901019828 1:6249932-6249954 CAGGAAGGCGGGCAGCGGGACGG + Exonic
901203436 1:7479726-7479748 AAGAAAGACATGAGGCAGGATGG - Intronic
901420325 1:9146338-9146360 CAGGAAGAGGAGGAGGAGGAAGG - Intergenic
902798220 1:18813395-18813417 TTGGGAGACGTGAAGGAGGATGG + Intergenic
902997769 1:20240214-20240236 CAGGACAACTTGAAGCAGGGTGG - Intergenic
903230680 1:21920629-21920651 CAGGAATGTGTGAAGCAGGCAGG - Intronic
905029014 1:34869024-34869046 CAGGCAGACCTGGAGCTGGAGGG - Exonic
905389686 1:37628480-37628502 CAGGGAAACATGAAGCAAGAGGG + Intronic
905506867 1:38486658-38486680 CAGGAGGAAGGGAAGAAGGAAGG + Intergenic
906145464 1:43557908-43557930 CAGAAAGGCGTGCCGCAGGAGGG + Intronic
906191973 1:43904758-43904780 CAGGAAGAGGAGCAGGAGGAGGG - Intronic
906192249 1:43905754-43905776 CAGGAAGAGGAGCAGGAGGAGGG - Intronic
906192337 1:43906081-43906103 CAGGAAGAGGAGCAGGAGGAGGG - Intronic
906192381 1:43906225-43906247 CAGGAAGAGGAGCAGGAGGAGGG - Intronic
906314153 1:44775655-44775677 CAGTAGGCTGTGAAGCAGGATGG - Intronic
906790196 1:48652478-48652500 GAGGAGGAGGTGAGGCAGGATGG + Intronic
907667363 1:56445098-56445120 GAGGAAGACATGAGCCAGGAAGG - Intergenic
907886468 1:58596727-58596749 CAGGAGGAAGTGAAGCCAGAGGG - Intergenic
908313974 1:62914695-62914717 CAGCAAGTCCTGAGGCAGGATGG + Intergenic
911991649 1:104705766-104705788 CAGGAAGACTCAAAGGAGGAGGG - Intergenic
912412731 1:109489570-109489592 CAGGAATATGTGATGCAAGAAGG + Intronic
913099785 1:115552364-115552386 TAGGAGGACTTTAAGCAGGAGGG - Intergenic
914170205 1:145215893-145215915 GAGGAAGAGGTGGAGGAGGAGGG + Intergenic
915604098 1:156940007-156940029 CAGGCACAGGTGAAGCTGGAGGG + Intronic
915843831 1:159240940-159240962 CAGGATGATGGGCAGCAGGAAGG - Intergenic
915882738 1:159689315-159689337 CAGGAAGATGTGGAGCAGGAAGG - Intergenic
916348989 1:163827276-163827298 CAGGAGGAAATGAAGAAGGAGGG - Intergenic
916738640 1:167629843-167629865 GAGGAAGAAGGAAAGCAGGAAGG + Intergenic
917166145 1:172115373-172115395 GAGAAAGAGGAGAAGCAGGAGGG - Intronic
918149149 1:181783083-181783105 AAGGATGAGGTGGAGCAGGATGG - Intronic
918690166 1:187469332-187469354 CAGGACAACTTGAAGCAGGGAGG - Intergenic
918892682 1:190295571-190295593 CAGGTAGTGGTGAAGCAGGCTGG + Intronic
919400688 1:197112693-197112715 CAGGAAGACCCAAAGCAGGGAGG - Intronic
919518899 1:198562600-198562622 GAGGAAGATGTATAGCAGGAAGG - Intergenic
919988821 1:202694700-202694722 AAGGAAGAGGAGAAGGAGGAGGG - Intronic
920360871 1:205415252-205415274 CAGGAAGAAGCGAGGAAGGAAGG + Intronic
920860126 1:209699106-209699128 CAGGAGGAAGGGAAGGAGGAGGG + Intronic
921366531 1:214379752-214379774 CAGGAAGACTTGAAGTAGGGAGG - Intronic
921389823 1:214606442-214606464 CAGGAAGGCGTGAAGCATTCAGG - Intronic
922451095 1:225737937-225737959 CAGGACCAGGTGAAGGAGGAAGG - Intergenic
923467835 1:234265066-234265088 CAGGGAGACATGAGACAGGAGGG - Intronic
923879817 1:238091459-238091481 AAGGAAGAGGTGGAGCAAGAAGG - Intergenic
923978679 1:239295215-239295237 CAGAAAGACATAAAGTAGGAAGG - Intergenic
1063101064 10:2950706-2950728 CAGGAAGCCGGGGAGGAGGAGGG - Intergenic
1063102741 10:2964553-2964575 CAGGACGTCTTGAAGCAGGAGGG - Intergenic
1063427085 10:5958942-5958964 GAGGAAGAAGGGAAGCAGGCAGG - Intronic
1064119821 10:12609041-12609063 CAGGAAGACCAGAACCTGGAAGG - Intronic
1064910871 10:20400612-20400634 AAGGAAGAAATGGAGCAGGATGG + Intergenic
1065172310 10:23043611-23043633 CAGGAAGATGTGCAGAACGAGGG + Intergenic
1065246182 10:23760462-23760484 CAGGAATAAGCAAAGCAGGAGGG + Intronic
1066044616 10:31584441-31584463 GAGGAAGAGGAGGAGCAGGATGG + Intergenic
1066258403 10:33704298-33704320 CAGGAAGGAGAAAAGCAGGAGGG - Intergenic
1066647574 10:37625200-37625222 CAGGTAGAGGTGAGGTAGGAGGG - Intergenic
1066650051 10:37646107-37646129 AAGGAAGACCTTCAGCAGGAAGG - Intergenic
1067032947 10:42891600-42891622 AAGGAAGACCTTCAGCAGGAAGG - Intergenic
1067326590 10:45274378-45274400 CAGGAAGACTTCAAGCAGGGAGG - Intergenic
1067410004 10:46055821-46055843 CAGGACAATGTGAAGCAGGCAGG + Intergenic
1068158640 10:53235000-53235022 CAGGAAGACTGGAAGCAGGGAGG + Intergenic
1069240298 10:66130016-66130038 CTGGCAGAGGTGAAGCAGGCAGG - Intronic
1070669630 10:78368955-78368977 CAAGAGCACGTGGAGCAGGACGG + Intergenic
1071689077 10:87796455-87796477 CAGGACAACTTGAAGCAGGGAGG - Intronic
1071718923 10:88123452-88123474 CAGGAAGAGGTATAGCACGAAGG - Intergenic
1073054568 10:100690851-100690873 CAGGAGGATGTGAAGGAGGAAGG + Intergenic
1073300625 10:102469109-102469131 CAGGAAGACATTGTGCAGGATGG - Exonic
1073793587 10:106963924-106963946 AAAAAAGATGTGAAGCAGGAGGG + Intronic
1073918167 10:108429873-108429895 CAGAAAAACGTGAAGCAAGGAGG - Intergenic
1073994159 10:109296144-109296166 CAGGAAGATGTGAGGGAGCAGGG - Intergenic
1074481093 10:113821427-113821449 CAGGAAGACTCAAAGCAGGGAGG + Intergenic
1074649751 10:115507094-115507116 TGGGAAGACTTGAAGCAGGGAGG + Intronic
1074821038 10:117178643-117178665 CAGGAAGACCTGAAGCAGGAAGG - Intergenic
1075032023 10:119030030-119030052 CAGGACGACGAGGAGGAGGAGGG - Exonic
1075677610 10:124306943-124306965 AAGGAAGAAGTGAAGCAAAAAGG + Intergenic
1076076387 10:127537190-127537212 CAGGAAGGAGGGAAGCAGGAAGG + Intergenic
1076551385 10:131280149-131280171 TGGGAAGACTGGAAGCAGGAGGG + Intronic
1076551426 10:131280420-131280442 TGGGAAGACTGGAAGCAGGAGGG + Intronic
1076581813 10:131517063-131517085 CAGGGAGACGGAAGGCAGGAAGG - Intergenic
1076858287 10:133127971-133127993 CAGGAAGAGGTGAAGTGGGGTGG - Intronic
1077247069 11:1544827-1544849 CAGGAAGCAGTGAAGGAGCAGGG + Intergenic
1078603494 11:12754763-12754785 AAGGAAAACCTGAATCAGGATGG - Intronic
1079632268 11:22692514-22692536 CAGGAAGACACGAAGTAGGGAGG + Intronic
1081377057 11:42372502-42372524 CAGGAAGAATGGAAGCAGGAGGG - Intergenic
1081408157 11:42722274-42722296 GAGGCAGATGTGAAGAAGGAAGG - Intergenic
1081630971 11:44689492-44689514 CAGCAAGACCTAAAGCAGGAAGG + Intergenic
1082632527 11:55558935-55558957 CAGGAAGACTCAAAGCAGGGAGG + Intergenic
1083314194 11:61804215-61804237 CAGGCAGAGGTGGAGCAGGGGGG - Intronic
1085360542 11:75881373-75881395 CAGGAAGACTCGAAGCAGGGAGG + Intronic
1085514608 11:77105070-77105092 CAGGAAGAGCTCAAGCAGAAGGG - Intronic
1085759978 11:79233445-79233467 CAGGGGGACGGGAAGGAGGAGGG + Intronic
1086040896 11:82477547-82477569 CGGGAAAACTTGAAGCAGGGAGG - Intergenic
1086583819 11:88429452-88429474 AAGGAAGAAGTGAAGCAGCTGGG + Intergenic
1086916091 11:92531605-92531627 TAGCAAGACATGAAGCAGCATGG - Intronic
1087203721 11:95372322-95372344 CAGGAGGATGTGAAGGAGGAGGG + Intergenic
1087740232 11:101879198-101879220 CAGGAAGACTTGAAGTGGGGAGG - Intergenic
1088016001 11:105060945-105060967 GAGGAAGGAGTGAAGGAGGAGGG - Intronic
1088353220 11:108912948-108912970 CAGGACAACTTGAAGCAGGGAGG - Intronic
1088499363 11:110467749-110467771 CGGAAACACGTGATGCAGGAAGG - Intergenic
1089573501 11:119424957-119424979 CAGAAAGCTGTTAAGCAGGAAGG - Intronic
1090017317 11:123097749-123097771 CAGGAGGACAAGAAGGAGGAGGG + Intronic
1090131832 11:124150779-124150801 CAGGAAGACGAGAAAGAGGAAGG + Intergenic
1091074917 11:132606525-132606547 CAGGAAGAGCTGACCCAGGAGGG + Intronic
1091148056 11:133298044-133298066 GAGTAAGAAGAGAAGCAGGAAGG - Intronic
1093321046 12:17715915-17715937 CAGGAAGAAGGAAGGCAGGAAGG - Intergenic
1093321048 12:17715923-17715945 CAGGAAGGCAGGAAGAAGGAAGG - Intergenic
1094009574 12:25792972-25792994 CAGGAAGGAGTGGAGCAGGAGGG + Intergenic
1094012455 12:25823792-25823814 CAGGAAGCTCTGAAGCTGGAGGG - Intergenic
1095788027 12:46132024-46132046 CAGGAAAGCATGAAGGAGGAGGG + Intergenic
1096229815 12:49890615-49890637 GAGGAAGAAGGGAAGCAGGGTGG - Intronic
1096509434 12:52119614-52119636 CAGGAGGAGGGGCAGCAGGAGGG - Intergenic
1096791883 12:54050461-54050483 CAGCAAGGCGGGAGGCAGGAGGG + Intronic
1098357276 12:69623596-69623618 CAGGAAGACCTAAAGCTGGCTGG + Intergenic
1098670988 12:73231378-73231400 CAGAAGGAAGTGAAGCAGGCAGG + Intergenic
1099728797 12:86470384-86470406 CAAGAAGAACTGAAGTAGGAAGG + Intronic
1100687580 12:97003732-97003754 AAGGAAGACTTGAAGCAAGGTGG + Intergenic
1101427631 12:104600898-104600920 AAGGAAGCCGAGAAGGAGGAAGG - Intronic
1101678877 12:106945153-106945175 AAGAAAGACCTGAAGCAGCAGGG + Intergenic
1101800048 12:108013826-108013848 CTGGAAGACCTGAAGGAGGAAGG - Intergenic
1101907128 12:108835506-108835528 CAAGGAGCCGGGAAGCAGGAAGG + Intronic
1102230406 12:111257776-111257798 CAGGAAGAGGAGGAGGAGGATGG - Intronic
1102735882 12:115159051-115159073 CAGGAAGATGTCAAGGGGGAAGG - Intergenic
1103181950 12:118920481-118920503 CAGGAAGACTTGTATCAGGAAGG + Intergenic
1103213184 12:119181346-119181368 CAGGACAACTTGAAGCAGGGAGG + Intronic
1103581624 12:121919706-121919728 CAGGAATACGAGAAGAAGCAGGG - Intronic
1103613249 12:122136695-122136717 CAGGAAGACGCGAATGAGGGAGG + Intronic
1103846026 12:123902589-123902611 CAGGGAGCCGGTAAGCAGGAGGG + Intronic
1104147010 12:126044322-126044344 CAGGATGAAGTCAAGAAGGAAGG + Intergenic
1104453688 12:128892024-128892046 CAGGAAGACTCAAAGCAGGGAGG + Intronic
1104680743 12:130749768-130749790 CAGGAAGACTCGAAGCTGGGAGG - Intergenic
1104788447 12:131466782-131466804 GAGGAAGAGGTGAGGCCGGAGGG - Intergenic
1104913389 12:132251371-132251393 CAGGAAGCTGTGAAACAGGCCGG + Intronic
1105388414 13:19954216-19954238 GAGGATGACGTGAACCCGGAAGG - Intergenic
1105743069 13:23349101-23349123 CTGGAAAACCTGCAGCAGGAGGG + Intronic
1105929283 13:25037116-25037138 CAGGAAGGCTGGAAGCAGGGAGG - Intergenic
1106194293 13:27480202-27480224 CAGCAGGCCGAGAAGCAGGAAGG + Intergenic
1106855536 13:33847441-33847463 GAGGAGGAGGTGAAGCAAGATGG - Intronic
1106855667 13:33849210-33849232 ATGCAAGACCTGAAGCAGGAAGG + Intronic
1108509265 13:51140203-51140225 CAGGAAGACTGGAAGCAGGGAGG - Intergenic
1108509723 13:51145765-51145787 CAGGAAGACTGGAAGCAGAGAGG - Intergenic
1108918983 13:55654238-55654260 CAGAAAAACTTGAAGCAGGTTGG + Intergenic
1108958265 13:56187817-56187839 CAGTGAGATGTGAAGCAGGCTGG + Intergenic
1109149200 13:58823628-58823650 CAGTTAGAGGTGAAGCAGGCTGG - Intergenic
1109828465 13:67754823-67754845 CAGGAAGACTCCAAGCAGGGAGG + Intergenic
1110425652 13:75363535-75363557 CAGGAAGACTCAAAGCAGGGAGG - Intronic
1111622851 13:90746719-90746741 GAGGAAGAGGAGAAGGAGGAGGG - Intergenic
1112009316 13:95280667-95280689 AAGGATGAGGTGCAGCAGGAAGG - Intronic
1112121762 13:96420095-96420117 AAGGAAAACCTGCAGCAGGAAGG - Intronic
1112228785 13:97567281-97567303 CAGGAAGACTGGTAGCAGTATGG + Intergenic
1112355380 13:98670559-98670581 CAGGAAGACTCGAAGCAGGGAGG - Intergenic
1113266274 13:108621507-108621529 CAGAAAGAAATGAAGCTGGATGG - Intronic
1113362706 13:109645674-109645696 CAGAAAGACCTGAGTCAGGAGGG - Intergenic
1113887494 13:113668487-113668509 CAGGAGGAACTGAGGCAGGACGG + Intronic
1114052748 14:18935369-18935391 CAGGAAGACTGGAAGCAGGGAGG - Intergenic
1114109810 14:19466557-19466579 CAGGAAGACTGGAAGCAGGGAGG + Intergenic
1114477771 14:23009897-23009919 CAAGAAGTTGAGAAGCAGGATGG - Intronic
1114504553 14:23199282-23199304 CAGGAAGACTTGAAGTGGGGAGG + Intronic
1114871791 14:26667155-26667177 TAGGAAGACCAGAAGGAGGAAGG - Intergenic
1114969802 14:28012384-28012406 CAGGAAGACTCGAAGCTGGGAGG - Intergenic
1114994317 14:28328737-28328759 AAGGAGGAGGTGAAGCAAGATGG - Intergenic
1115318046 14:32046941-32046963 CAGAAAAATGTGAAGGAGGAAGG + Intergenic
1115469945 14:33758161-33758183 CTGGAGGAGGTGAAGCAGGCTGG - Intronic
1116114832 14:40634929-40634951 CAGGAGGTGGTGAAGCAAGATGG + Intergenic
1116394473 14:44430941-44430963 CAGGAAGACTGGAAACAGGGAGG + Intergenic
1117419323 14:55528588-55528610 CAGGAAGACTCGAAGCTGGGAGG - Intergenic
1118117483 14:62796852-62796874 CAGGAAGACTGGAAGCAGAGAGG + Intronic
1118510877 14:66471800-66471822 CAGGATAACTTGAAGCAGGGAGG - Intergenic
1118979085 14:70701641-70701663 GAGGAAGAAGTGGAGGAGGAGGG + Intergenic
1119090355 14:71775103-71775125 CAGGACAACTCGAAGCAGGAAGG - Intergenic
1119119802 14:72064172-72064194 CTGGAAGAGGTGAAGGAGGAGGG + Intronic
1119586682 14:75842394-75842416 GAGGAGGCCGAGAAGCAGGAGGG + Intronic
1121122421 14:91384410-91384432 CAAGCAGCAGTGAAGCAGGATGG - Intronic
1121424957 14:93843799-93843821 CAGGACAACTTGAAGCAGGGTGG + Intergenic
1121701541 14:95958365-95958387 CAGGAAGACTAGAAGAAGGGAGG - Intergenic
1121901389 14:97696487-97696509 GAGGAAGACATGGAGCAGAAGGG - Intergenic
1123007889 14:105333200-105333222 CAGGAGCACATGCAGCAGGAGGG - Intronic
1123009156 14:105338871-105338893 TAGGAAGACAGGAGGCAGGAGGG - Intronic
1123476209 15:20593907-20593929 CAGGAAGACGTCCTGCAGAAAGG - Intergenic
1123477318 15:20598996-20599018 GAGGAAGAGGAGCAGCAGGAAGG - Intergenic
1123640698 15:22401386-22401408 GAGGAAGAGGAGCAGCAGGAAGG + Intergenic
1123641803 15:22406457-22406479 CAGGAAGACGTCCTGCAGAAAGG + Intergenic
1123740031 15:23226757-23226779 CAGGAAGGCGTGAAGCATTCAGG - Intergenic
1124504566 15:30261861-30261883 TTGGAAGAGGTGAAGAAGGAAGG - Intergenic
1124738986 15:32276774-32276796 TTGGAAGAGGTGAAGAAGGAAGG + Intergenic
1125131849 15:36291044-36291066 CAGGAAGAAATGAAGCATTAAGG - Intergenic
1127834874 15:62782884-62782906 CAAGAGGAGGTGGAGCAGGAGGG + Intronic
1127903048 15:63355217-63355239 CAGGGAGATGTGAAGCAGCTTGG - Intronic
1128120028 15:65138894-65138916 CAGGAAGACTTGAAGCGGGGAGG + Intergenic
1128289986 15:66470958-66470980 CAGGACAACTTGAAGCAGGGAGG + Intronic
1128788850 15:70417968-70417990 GATGAAGAGGTGAAGGAGGAGGG - Intergenic
1130953229 15:88608825-88608847 CAGGAAGACTTGTTGCAGGTAGG + Intergenic
1131167273 15:90151542-90151564 CAGGAACAGGTGTAGCTGGAGGG - Intergenic
1132198759 15:99933269-99933291 CAGGAAGACAGGATCCAGGAGGG - Intergenic
1132529624 16:439785-439807 CAGGAAGACATGAAGCAGGGAGG + Intronic
1132816258 16:1828356-1828378 CAAGAAAACGTGAAGTAGAACGG + Intronic
1133504351 16:6396337-6396359 AAGGAAGACGAGACTCAGGAAGG + Intronic
1134419987 16:14077979-14078001 CAGCAAGGCTAGAAGCAGGAGGG - Intronic
1135637921 16:24094898-24094920 AAGAAAGACGGAAAGCAGGAAGG + Intronic
1135938744 16:26803019-26803041 AAGGAAGAAGAGAAGGAGGAAGG + Intergenic
1136480046 16:30535438-30535460 CAGGAAGACGTGAAGCAGGAAGG + Intronic
1136707517 16:32201939-32201961 CAGGAAGGCGTGAAGCATTCAGG + Intergenic
1136760392 16:32727471-32727493 CAGGAAGGCGTGAAGCATTCAGG - Intergenic
1136807711 16:33142915-33142937 CAGGAAGGCGTGAAGCATTCAGG + Intergenic
1137570263 16:49560846-49560868 AAAGAAGAGGTGAAGAAGGAGGG - Intronic
1139278526 16:65750024-65750046 GAGGAAGAAGTGAAGGAGGGAGG + Intergenic
1139410302 16:66753260-66753282 GTGGATGACCTGAAGCAGGAAGG + Intergenic
1139596220 16:67959874-67959896 AAGGAAGGCTTGAAGCAGGAAGG - Intronic
1140266416 16:73425156-73425178 CAGGAAGCACTGTAGCAGGAGGG + Intergenic
1140726380 16:77816798-77816820 CAGGAAGGAGTGAAGAAGGGAGG + Intronic
1141359384 16:83381318-83381340 CAGGAAGACATGAAGGGGCAGGG - Intronic
1141622196 16:85242271-85242293 CTGGCAGAGGGGAAGCAGGAGGG - Intergenic
1142115469 16:88353980-88354002 CAGGTAGATATGAAGCAGGCAGG - Intergenic
1142295726 16:89220704-89220726 TAGGAAGTGGTGAACCAGGACGG - Intronic
1203062547 16_KI270728v1_random:987793-987815 CAGGAAGGCGTGAAGCATTCAGG - Intergenic
1142765262 17:2060846-2060868 CAGGAAGAGGAGCAGCAGGAAGG + Exonic
1143391418 17:6561243-6561265 AAGGAAGAGGAGAAGGAGGAAGG - Intergenic
1144826900 17:18110214-18110236 CAGGATGAGGTGAAACAGGCTGG - Intronic
1144945451 17:18967349-18967371 CAGGAAGGAGGGAGGCAGGAGGG + Intronic
1145191293 17:20843370-20843392 CAGGAAGGCGTGAAGCATTCAGG + Intronic
1145208456 17:20996726-20996748 GAGGAAGAGGTGCAGGAGGAAGG - Intergenic
1146000333 17:29126833-29126855 CAGGAGGCTGAGAAGCAGGAGGG - Intronic
1146055331 17:29578000-29578022 CAGGAAGGAGTGATGCAGGGGGG + Intronic
1146914053 17:36666800-36666822 CTGGGAGACGTGCAGCAGGGTGG + Intergenic
1147169838 17:38611520-38611542 GAAGAAGAGGGGAAGCAGGAGGG + Intergenic
1147563365 17:41522183-41522205 CAGGAAGCCTTGGAGCTGGAGGG - Exonic
1148782824 17:50130996-50131018 CAGGAAGCCCTGGAGCAGGTGGG + Intergenic
1148949983 17:51302290-51302312 CAGGACAACTTGAAGCAGGGAGG - Intergenic
1148951595 17:51318137-51318159 CAGGATAACTTGAAGCAGGGAGG - Intergenic
1150502077 17:65660510-65660532 AAGGAAGAAGGGAAGAAGGAAGG - Intronic
1150991401 17:70264056-70264078 CAGGAAGGCGGCAGGCAGGAAGG - Intergenic
1151802726 17:76387321-76387343 CAGGAAGAGGCGCAGCAGCATGG - Exonic
1152072703 17:78141895-78141917 CAGGGAGCCATGAAGCAGGCTGG - Exonic
1152296251 17:79468805-79468827 CAGGAAGACAGGCAGGAGGATGG + Intronic
1153465188 18:5380708-5380730 CAGGCAGGCATGAGGCAGGAGGG - Intergenic
1153680639 18:7497346-7497368 AAGGAAGAGGAGAAGGAGGAAGG + Intergenic
1155161647 18:23201041-23201063 CAGGGAGAGCAGAAGCAGGAAGG + Intronic
1155181736 18:23354159-23354181 GAGGAAGACGTGAAGCTTCATGG + Intronic
1156291015 18:35748514-35748536 CAGGAAGACCTGCAGGATGATGG + Intergenic
1156323150 18:36046920-36046942 CAGGAAGATCTGAAACAGAATGG + Intronic
1156721663 18:40077711-40077733 CAAGCAGCTGTGAAGCAGGAAGG + Intergenic
1157519544 18:48336106-48336128 CAGAAAGACTGGAGGCAGGAGGG - Intronic
1158458518 18:57628042-57628064 CAGGAAGACTTGAAGCAGGGAGG + Intergenic
1159029258 18:63214168-63214190 AAGGAAGATGGGAAGCAAGAAGG + Intronic
1159924116 18:74251380-74251402 CAGGAAGACTCAAAGCAGGAGGG + Exonic
1160339383 18:78074669-78074691 CAGGCCGGCCTGAAGCAGGAAGG - Intergenic
1160598157 18:79992006-79992028 CAGGAAGACTCAAAGCGGGAAGG + Intronic
1161291562 19:3496486-3496508 CATGAAGAAGTGAGGCAGGAGGG + Intronic
1163198682 19:15746053-15746075 GAGGAGGACGTGGAGGAGGAAGG - Intergenic
1163279585 19:16307314-16307336 CAGGAAGACTTGAAGCCAGGAGG - Intergenic
1163369894 19:16896233-16896255 CAGCAGGACGTGAAGCTGAATGG - Exonic
1164042357 19:21504980-21505002 CAGGAAGACACGAAGCTGGAGGG + Intronic
1164745711 19:30611205-30611227 CAAGATGATGGGAAGCAGGAAGG + Intronic
1167538980 19:50073471-50073493 CTGGAGGAAGAGAAGCAGGACGG + Intergenic
1167891410 19:52542737-52542759 CAGGAAGACTTGAAGCAGGGAGG + Intronic
1168140263 19:54381208-54381230 CAAGAAGACCTGAAGGAGAAGGG - Intergenic
1168307379 19:55442834-55442856 CAGGAGTACGAGGAGCAGGAGGG + Exonic
1168367551 19:55801803-55801825 CAGGATGAAGTGAGGCAGGCAGG - Intronic
925151276 2:1617183-1617205 CAGGAAGACTCGAAGCAGACGGG - Intergenic
925266863 2:2571731-2571753 GAGGAAGAGGGGCAGCAGGAAGG - Intergenic
926083331 2:10006247-10006269 CAGTAAGAGGTGAAGCGGGCTGG - Intergenic
926508298 2:13742418-13742440 CAGGAAGACTTGAAGCGGAAGGG - Intergenic
926509274 2:13753219-13753241 CAGGAAAACTGGAAACAGGAGGG - Intergenic
926558302 2:14386558-14386580 CAGAAGGAGGAGAAGCAGGAGGG + Intergenic
926721788 2:15966439-15966461 AAGGAAGCCATGGAGCAGGAAGG - Intergenic
926744192 2:16137212-16137234 CAGGCTGAGGTGAGGCAGGAGGG + Intergenic
926842738 2:17100701-17100723 AGGGAAGAGGTGAAGCCGGAGGG + Intergenic
927292923 2:21422282-21422304 CAGGGAGAGGAGAAGAAGGAGGG + Intergenic
927481830 2:23459977-23459999 CAGGTAGAGGAGAAGCTGGAAGG + Intronic
928228660 2:29477084-29477106 AAGGAAGAAGTGAACCACGAGGG + Intronic
928858087 2:35824216-35824238 CAGGAAGACTTGAAGCAGGGAGG + Intergenic
929217958 2:39436489-39436511 CAGGTTGGCGTGAAGCAGGCAGG + Intronic
929670762 2:43875237-43875259 CAGCAGGAAGTGCAGCAGGAAGG - Exonic
929810799 2:45187993-45188015 CAGGAAGGGGTGGAGCAGGTGGG - Intergenic
930170980 2:48251618-48251640 CAGGAAGAAGGGAAGGATGAAGG - Intergenic
930495121 2:52131607-52131629 CAGGACAACTTGAAGCAGGGAGG - Intergenic
931058051 2:58494960-58494982 CAGGAAGATGGGATGCAGTATGG - Intergenic
931141088 2:59459032-59459054 CAAGAAGGTGTGAAGCAGCAGGG - Intergenic
933242844 2:79942263-79942285 CAGGAAGCCGAGAACCAGGAAGG + Intronic
934108390 2:88717443-88717465 CGGGAAGACTTGAAGCAGGGAGG + Intronic
934108930 2:88723899-88723921 CGGGAAGACTTGAAGCTGGAAGG + Intronic
934527011 2:95058295-95058317 CAGTGAGACATGAAGCATGACGG - Intergenic
935152765 2:100452913-100452935 CAGGGAGACTTGAAGCGGGGTGG - Intergenic
935265481 2:101389991-101390013 CAGGAAGACTTGAAGCGGGGAGG + Intergenic
935505189 2:103891603-103891625 CTGGAAGAAGTCAAGCAGGTGGG + Intergenic
935708394 2:105876372-105876394 CAGGGAGACGTGAGGTAGGTGGG - Intronic
936478482 2:112863305-112863327 CAGGACAACTTGAAGCAGGGAGG - Intergenic
937400879 2:121582577-121582599 CAGGAAGACAGAAAGCAGGGAGG + Intronic
937654884 2:124363383-124363405 CAGGGAGATGTTAAGAAGGAGGG - Intronic
938261769 2:129901945-129901967 TAGGAAGAGGTGTAGGAGGAGGG - Intergenic
938471205 2:131564015-131564037 CAGGAAGACTGGAAGCAGGGAGG - Intergenic
939581178 2:143947851-143947873 CAGGAGGAGGTGAAGAAGGAAGG + Intronic
940645750 2:156391326-156391348 AAGGAAGAGATGAAGCTGGAAGG - Intergenic
940804263 2:158168324-158168346 AAGCAAGAGGTGAAGCAGGCTGG + Intergenic
942370259 2:175276285-175276307 CAGGGAGAGGTGTAGCAGGTAGG - Intergenic
942766626 2:179465017-179465039 TAGGAAGACAGGAAGCAGAAAGG - Intronic
943424210 2:187709198-187709220 TAGGAAGACTTGCAACAGGAAGG + Intergenic
943676192 2:190718387-190718409 CAGGAAGACTCGAAGCGGGGAGG - Intergenic
944303753 2:198156168-198156190 CAGGAAGGCTGGAAGCAGGGAGG - Intronic
944592318 2:201229236-201229258 CAGGTACACGTGAAACAGTAAGG - Intronic
945036324 2:205706996-205707018 CAGGAAGTCTCTAAGCAGGATGG - Intronic
945147135 2:206750204-206750226 GAGGCAGAGGAGAAGCAGGAAGG - Intronic
945534509 2:210997712-210997734 CAGGAATAGGGGAAGTAGGAGGG + Intergenic
946237354 2:218332365-218332387 CAGAAAGAGAAGAAGCAGGATGG + Intronic
946679590 2:222199366-222199388 CAGGAAGAAGGGAAGGAGGGAGG + Intergenic
947598163 2:231427024-231427046 GAGGAAGCAGTGAAGCTGGAAGG - Intergenic
948538971 2:238672223-238672245 GAGGAAGAGGAGAAGGAGGAGGG - Intergenic
949060779 2:241955904-241955926 CGGGAAGACTGGAAGCAGGGAGG + Intergenic
1168836838 20:883230-883252 AAGGAAGATGTGTAGGAGGAAGG - Intronic
1168900061 20:1355746-1355768 CAGGAGGAGGTGGAGCAAGATGG - Intronic
1169729429 20:8770661-8770683 CAGGAAGATGGGAAGCCGGGAGG + Intronic
1170690974 20:18614814-18614836 CAGGAGGAAGGGAAGGAGGAAGG - Intronic
1172785969 20:37469240-37469262 CAGGAAGGAGAGAGGCAGGAAGG - Intergenic
1173545378 20:43893794-43893816 CTGGAAGATGTGAAGTAGGGGGG + Intergenic
1173560863 20:44004411-44004433 AAGGAGAAGGTGAAGCAGGAAGG + Intronic
1173648156 20:44646444-44646466 CAGGAAGACAAAAAGGAGGAGGG + Intronic
1173648754 20:44650167-44650189 CAGTAAGACGTGAAGGAGGCAGG + Intronic
1174385122 20:50183495-50183517 CAGAATGGCGTGAACCAGGAAGG + Intergenic
1174738003 20:52984051-52984073 CAGGAAGAAGGGAAGCTGGCTGG + Intronic
1175120157 20:56710814-56710836 GAGGAAGAGGGGAAGGAGGAGGG - Intergenic
1175120182 20:56710889-56710911 GAGGAAGAGGGGAAGGAGGAGGG - Intergenic
1175183920 20:57167105-57167127 CAGGCAGTCTGGAAGCAGGAGGG + Intergenic
1175293671 20:57894652-57894674 AAGGAAGAAGGGAAGGAGGAAGG + Intergenic
1175894598 20:62330546-62330568 CTGGTAGCCGTGCAGCAGGAAGG + Exonic
1176139955 20:63540649-63540671 CAGGCAGACGTGCAGACGGAGGG - Intergenic
1176145385 20:63563134-63563156 CAGGAAGCCGTGCTGCAGGCTGG + Exonic
1176286359 21:5021265-5021287 CAGGAAGCCCTGAAGCCGGGCGG - Intergenic
1177534417 21:22405615-22405637 CAGGAAGACTCAAAGCGGGAAGG - Intergenic
1178664362 21:34533809-34533831 CATGAGGACCTGAAGCAGGTAGG + Intronic
1178691672 21:34755064-34755086 CAGGAAAAGGAGAAGAAGGAAGG + Intergenic
1179003286 21:37483890-37483912 CAGGAAGACCTTAATCAAGAGGG - Intronic
1179317024 21:40253067-40253089 CAGGAAGACATAAACCAGGAGGG + Intronic
1179648898 21:42793879-42793901 CAGGAAGACTCGAAGCTGGGAGG + Intergenic
1179669673 21:42937823-42937845 CAGGAAGACAGGAAGCGGGGAGG - Intergenic
1179674567 21:42973319-42973341 CAGAAAGATGGGAAGCAGCAGGG - Intergenic
1179826751 21:43970393-43970415 CAGAAAGAAGTGAAACATGAAGG - Intronic
1179870822 21:44242210-44242232 CAGGAAGCCCTGAAGCCGGGCGG + Intergenic
1179883080 21:44301505-44301527 CTAGAAGACTTGAAGCAGGCCGG + Intronic
1179906459 21:44425636-44425658 CAGGAAGACGTGACGCAAGGCGG - Intronic
1180471222 22:15657743-15657765 CAGGAAGACTGGAAGCAGGGAGG - Intergenic
1180981365 22:19879595-19879617 CAGGAAGACGAGGTGCAGGGTGG + Intronic
1181720228 22:24768582-24768604 AAGGAAAACAAGAAGCAGGAAGG + Intronic
1182026265 22:27121650-27121672 GAGGAAGACGGGAAGCTGGGTGG - Intergenic
1182444212 22:30380775-30380797 CAGGAGGAAGTGCAGGAGGATGG - Intronic
1183334215 22:37237382-37237404 CAGGGAGAGGTGGAGCAGGAGGG + Intronic
1183419772 22:37704727-37704749 CAGGAAGAGGAGAGGAAGGAAGG + Intronic
1183583294 22:38738237-38738259 GACGAAGACCTGCAGCAGGAGGG - Exonic
1184126659 22:42492103-42492125 CAGGAGGACAAGAGGCAGGACGG - Intergenic
1184449712 22:44575756-44575778 GAGGAAGAAGGGAAGGAGGAAGG + Intergenic
1185384870 22:50527007-50527029 TAGGAAGCCGTGAAGGAGGGAGG + Intronic
949097133 3:99166-99188 CAGAAAGAAATGGAGCAGGAGGG - Intergenic
950454119 3:13082634-13082656 CAGTAAGAAGGGAGGCAGGAAGG - Intergenic
950600737 3:14033178-14033200 CAGGACAACTTGAGGCAGGAAGG + Intronic
950841660 3:15973949-15973971 GAGGAAGAGGAGAAGGAGGAAGG - Intergenic
950919874 3:16683661-16683683 CGGGAAAACCTGAAGTAGGAAGG - Intergenic
951520875 3:23609831-23609853 AAGGAAGAAGGGAAGGAGGAAGG + Intergenic
952005501 3:28837934-28837956 CAAGAAGACTTGAAGAAAGATGG + Intergenic
952752527 3:36836854-36836876 CAGCAAGAGCTGAAGCAGAAAGG - Intronic
952820363 3:37481141-37481163 CGGGAAGGCCTGAAGCATGAGGG - Intronic
953672409 3:44974624-44974646 CTGAAAGAGGTGAAGCCGGAAGG - Intronic
955036348 3:55271821-55271843 AAGGAGGAAGGGAAGCAGGAAGG + Intergenic
956277624 3:67520243-67520265 CAGGAAGAAGTAAAGAAGGAAGG + Intronic
956744977 3:72304145-72304167 CAGGGAGACAGGAAGCAGCAAGG + Intergenic
956874107 3:73445032-73445054 TAGGCTGAAGTGAAGCAGGAAGG + Intronic
957271024 3:78030124-78030146 CAGTGAGAGGTGAAGCAGGCTGG + Intergenic
957845142 3:85722068-85722090 CAGGAAGACGAGCTGCAGAAAGG - Intronic
958154801 3:89743023-89743045 CAGAAAGACATGATGCATGATGG + Intergenic
958638172 3:96772278-96772300 CAGGAAGACTCGAAGTGGGAGGG + Intergenic
958842202 3:99220228-99220250 CAGGAAGGCAAGAGGCAGGAAGG + Intergenic
959098956 3:101988872-101988894 CAGGAAAATGTGAGCCAGGAAGG + Intergenic
960096535 3:113695984-113696006 CAGGAAAAGGTGAAGGAGGCGGG + Intronic
960097127 3:113699291-113699313 CAGGAAAAGGTGAAGGAGGCGGG - Intergenic
960404736 3:117245850-117245872 CAGGAAAACGTGCAGAATGAAGG - Intergenic
960409665 3:117307335-117307357 CAGGAAGATGTGTGGGAGGAAGG - Intergenic
960636482 3:119789710-119789732 AGGGAAGCTGTGAAGCAGGAAGG - Intronic
962424968 3:135261615-135261637 CAGGAACACATGAAGCATGAAGG + Intergenic
962462590 3:135628371-135628393 CAGGAAGTGGGGAAGGAGGAAGG - Intergenic
963335755 3:143972163-143972185 GAGGAAGACGGGGAGCGGGAAGG - Exonic
963844846 3:150144805-150144827 AAGGAAAACTTGAAGCAGGAAGG + Intergenic
964377280 3:156060634-156060656 CAGAAAGAGAGGAAGCAGGAAGG - Intronic
964664670 3:159159104-159159126 AAGAAAGAGGTGAAGCAGCATGG + Intronic
964860867 3:161199475-161199497 TAGGAAGACTTGAAGCAGAGAGG - Intronic
965031600 3:163376106-163376128 CTGGAAGACATGAAGCAGATGGG - Intergenic
965171091 3:165265590-165265612 CAGGAAGAAGGGAGGAAGGAAGG - Intergenic
965557386 3:170032473-170032495 CAGGACAACTTGAAGCAGGGAGG + Intergenic
965937051 3:174127508-174127530 CAGGAATATGGGAAGAAGGAGGG - Intronic
967031285 3:185609747-185609769 CAGGAGGAGGTGAAGGAGAAAGG - Intronic
967106970 3:186261864-186261886 GAGGCAGATGAGAAGCAGGAGGG + Intronic
967133223 3:186491719-186491741 CATGCAGAAGGGAAGCAGGAAGG + Intergenic
968837537 4:2976210-2976232 AAGGAAGAAGGGAAGGAGGAGGG - Intronic
968938677 4:3626668-3626690 GAGGGAGACATGAAGCACGAAGG - Intergenic
969147821 4:5139491-5139513 CAGAAGGAAGTGAAGCATGAAGG + Intronic
969196904 4:5570267-5570289 CAGGAAGAGGTGAATCTGCAGGG - Intronic
969689714 4:8697855-8697877 CAGGAGCAGGAGAAGCAGGAAGG - Intergenic
970099141 4:12501318-12501340 AAGGAAGAGGAGAAGAAGGAAGG + Intergenic
970158487 4:13165547-13165569 CGGGAAGAAGTGAAGGAGGGAGG + Intergenic
970506730 4:16738384-16738406 CAGGAAGAGGAGGAGGAGGAAGG + Intronic
970607243 4:17692189-17692211 GAGGGAGAAGTGAAGGAGGAGGG + Intronic
971641698 4:29142285-29142307 CAGGAAGACTGGAAGCAATATGG - Intergenic
971895578 4:32589409-32589431 AAGGAAGATGTGAATTAGGAGGG + Intergenic
972990497 4:44817683-44817705 GAGGAAGAGGAGAAGGAGGAAGG + Intergenic
973245129 4:48003207-48003229 CAGGAAGATTGGAAGCAGGGAGG + Intronic
973319071 4:48791436-48791458 CAGGAAGACATGAAGAAGTTGGG + Intergenic
973916195 4:55636654-55636676 CTGGAAGAGGTGAAGGAGAAAGG - Intronic
975205253 4:71638202-71638224 CAGGAAGACCTGAAGTGGGAAGG - Intergenic
975646175 4:76548244-76548266 CACTAAGAAGTGAAGCAGCAGGG + Intronic
976153863 4:82121299-82121321 CAGGCAGGCGAGAAGGAGGAAGG + Intergenic
976961449 4:90981016-90981038 CAGGTAGACCTGAAGTAGAAGGG + Intronic
977643052 4:99378867-99378889 CAGGACAACTTGAAGCAGGGAGG + Intergenic
978034991 4:103981799-103981821 CATGAAAATGTGAAGCAGAAAGG - Intergenic
978197925 4:105991972-105991994 CAGGAGGACATGAAGAAGGATGG - Intronic
979529210 4:121751015-121751037 AATGAAGAAGTGAAGCAGGTAGG + Intergenic
979543852 4:121917382-121917404 GAGGGAGAGGTGAAGCAGGAAGG - Intronic
979795603 4:124842462-124842484 CTAGAAGAGGTGAAGCAAGATGG - Intergenic
979856433 4:125638980-125639002 CATGAAGAAGTGAAGCAGTTTGG + Intergenic
980071417 4:128246403-128246425 CAGGACAACTTGAAGCAGGGAGG + Intergenic
980190677 4:129520487-129520509 GAGGAAGAAGAGAAGGAGGAGGG + Intergenic
980201879 4:129665978-129666000 CAGAAATACATGAAGCAGGCTGG + Intergenic
980875640 4:138659410-138659432 GAGGGAGAAGAGAAGCAGGAGGG + Intergenic
981846434 4:149175704-149175726 GAGGGAGAGGTGAAGCAGGGTGG + Intergenic
982505608 4:156213602-156213624 CAGGAAGACTTGAAGCAGGAGGG + Intergenic
982717525 4:158824605-158824627 GATGAAGACTGGAAGCAGGAAGG - Intronic
982920330 4:161266589-161266611 CAGGACGACTTGAAGCAGGGAGG + Intergenic
982951631 4:161704223-161704245 CAGGAAGACTGGAAGCAGGGAGG - Intronic
983044971 4:162975602-162975624 CAGGAAGACTTGAAGCCAGAAGG + Intergenic
983739691 4:171113869-171113891 AAGGAAGGCATGAAGGAGGAAGG + Intergenic
985226851 4:187770590-187770612 CAGGAAGACTCCAAGCAGGGAGG + Intergenic
985797395 5:1973118-1973140 AAGGAAGAAGAGAAGAAGGAAGG - Intergenic
986361034 5:6978371-6978393 CAGGAAGACATGATGCCGGGGGG - Intergenic
986415159 5:7520838-7520860 CAGGCAGACGCTAAGCACGATGG - Exonic
986589794 5:9356617-9356639 GAGGAAGTTGTGCAGCAGGATGG + Intronic
986796528 5:11218044-11218066 GAGGAAGAAGGGAAGGAGGAAGG - Intronic
986947614 5:13043844-13043866 AAGGGAGACTTGAAGTAGGAAGG - Intergenic
987016429 5:13824811-13824833 CAGGATTACCTGAAGGAGGAAGG + Intronic
987121355 5:14770599-14770621 GAGGAAGAGATGAAGCAAGATGG + Intronic
987858423 5:23451805-23451827 CTGGAAGACTTGAAGTAGGGAGG + Intergenic
988087993 5:26496612-26496634 CAGGAAGAAGTGAAATAGGAGGG + Intergenic
989730426 5:44641610-44641632 CAGGAAGACCTGCTGCAGAAAGG - Intergenic
990905462 5:60798000-60798022 CAGGAAGACTCGAAGCAGGGAGG - Intronic
992556334 5:77907041-77907063 TGGGAAGACGTGAAGGTGGAAGG - Intergenic
993185911 5:84619408-84619430 CAGAAAGAAAGGAAGCAGGATGG + Intergenic
993656883 5:90588663-90588685 CAGGAAAACGTGACTCAAGAAGG + Intronic
994776268 5:104038715-104038737 CAGGACAACTTGAAGCAGGAAGG - Intergenic
995129054 5:108610460-108610482 AAGGAAGAGGTGAAGGAGGAGGG + Intergenic
995354723 5:111224502-111224524 CAGGACGAGGCGGAGCAGGAGGG - Exonic
995653239 5:114395786-114395808 CAGCAGGCAGTGAAGCAGGAAGG - Intronic
995943053 5:117608163-117608185 CAGGATCACGTGAAGCAGCAGGG - Intergenic
997732628 5:136192342-136192364 CAGGAAGAAGAGCAGCAGGTAGG + Intergenic
997883621 5:137612121-137612143 AAGGAGGATGTGAAGCAGCATGG - Intergenic
998054528 5:139063068-139063090 CAGGCAGACAAGAAGCAGGGAGG + Intronic
999070569 5:148739474-148739496 CAGGAAGTCAGGAAGCAGGACGG + Intergenic
999226375 5:150028158-150028180 CAGGAAGACTCAAAGCAGGGAGG + Intronic
999256388 5:150212020-150212042 CAGGAGGAAGTGAAGCTGGTGGG - Intronic
999340894 5:150770764-150770786 CAGGAAGACTCAAAGCAGGATGG - Intergenic
999410723 5:151347506-151347528 CTGGAAGGAGGGAAGCAGGAAGG + Exonic
999481349 5:151950908-151950930 CAGGAACGCGTGCAGCAGGCTGG - Intergenic
999540303 5:152564191-152564213 CTGGAAGAGATCAAGCAGGAAGG + Intergenic
1000503311 5:162080097-162080119 CAGGAAGACAGGAAGTAGGCGGG - Intronic
1000599996 5:163261173-163261195 CAGGAAGAGGTGAAGGAGAAAGG + Intergenic
1001085021 5:168694203-168694225 CAGGCAGATGGGCAGCAGGAGGG - Intronic
1001185413 5:169567001-169567023 CAGGAATAGGTGAAGGTGGAAGG - Intergenic
1001233575 5:170010457-170010479 CAGGAAGATGAGAAGGAGTAAGG + Intronic
1003831754 6:10019452-10019474 CAGGAAGACTTGAAGCAGATGGG - Intronic
1005370675 6:25129152-25129174 CAGGACAACTTGAAGCAGGGAGG - Intergenic
1005595759 6:27377566-27377588 CAGGAAGACATGAAGCTGGGAGG - Intronic
1005732273 6:28709678-28709700 GAGGAGGACGAGAAGAAGGAAGG - Intergenic
1005972197 6:30770064-30770086 CATGAAGGCCTGAAGCTGGACGG - Intergenic
1006463134 6:34175594-34175616 AAGGAAGAGGTGAAGCAAGATGG - Intergenic
1006621404 6:35367166-35367188 CAGGAAGAAGAGAGGCCGGAGGG + Intronic
1007170608 6:39860642-39860664 CAGGGTGACCTGAAGCAGGAGGG + Intronic
1007652486 6:43432198-43432220 CGGGAAGACGGAAAGCAGGAAGG - Exonic
1008479103 6:51966279-51966301 CAGGACAACTTGAAGCAGGGAGG + Intronic
1008756800 6:54805642-54805664 CAGTAATTTGTGAAGCAGGAAGG + Intergenic
1009482193 6:64172901-64172923 CAGGAAGAAGGGGAGGAGGATGG - Intronic
1009904086 6:69847326-69847348 TAGCAAGCCCTGAAGCAGGATGG - Intergenic
1010355681 6:74930024-74930046 GAGGAAGAGGAGAAGTAGGAAGG + Intergenic
1010982075 6:82379566-82379588 CGGGTAGAGGAGAAGCAGGAGGG - Intergenic
1011923307 6:92610251-92610273 AAGAAAGACGGGAAGAAGGAGGG - Intergenic
1011923317 6:92610300-92610322 AAGAAAGACGGGAAGAAGGAGGG - Intergenic
1012393438 6:98769300-98769322 CAGGATGAGGTGAAGCTGAAAGG - Intergenic
1012648710 6:101723889-101723911 CAAGAAGAGGTAAAGCAGAAAGG - Intronic
1012724420 6:102791102-102791124 AAGGAAAACATGAAGAAGGATGG + Intergenic
1012981971 6:105840669-105840691 CAGGAAGAGCTGTAGAAGGAGGG - Intergenic
1014274170 6:119368101-119368123 CAGGACTACTAGAAGCAGGAGGG + Intergenic
1015047952 6:128800817-128800839 GAGGAAGAAGAGAAGCAGGGGGG - Intergenic
1015142077 6:129946626-129946648 CAGGAAGAAGTCAGGCAGGCTGG + Intergenic
1016775481 6:147899973-147899995 AAGGAAGAAGGGAAGCAAGAAGG + Intergenic
1016934039 6:149435911-149435933 GACGAGGACGTGAAGGAGGACGG + Intergenic
1017386061 6:153885146-153885168 CAGGACAACTTGAAGCGGGAAGG + Intergenic
1018362247 6:163083357-163083379 CAGGAAGACTGGAAGCGGGGAGG - Intronic
1018566885 6:165163666-165163688 CAGCAAGAGGTGAAGCAGCTTGG + Intergenic
1018567691 6:165172910-165172932 CAGGGAGACGTGAAGGCAGAAGG + Intergenic
1018690496 6:166340434-166340456 GAAGAAAAGGTGAAGCAGGAAGG - Intronic
1018813527 6:167314758-167314780 TAGGAAGACTGGAAGCAGGGAGG - Intronic
1018858232 6:167690738-167690760 CGGGAAGACTGGAAGCAGGCAGG - Intergenic
1019316193 7:388058-388080 CAGCAAGATGTGAAGCAAGATGG + Intergenic
1019473031 7:1231348-1231370 CAGGCAGTCGTGTGGCAGGACGG + Intergenic
1019519698 7:1455081-1455103 CAGGAAGCCGTCCAGCAGGTGGG - Intronic
1019912919 7:4112217-4112239 CAGGAAGACTCCAAGCAGGGAGG + Intronic
1020340564 7:7105124-7105146 TAGGAAGACTTGAAGCAGGGAGG - Intergenic
1021802107 7:24317288-24317310 CAGGAAGACTGGAAGCGGGGAGG - Intergenic
1021930504 7:25576819-25576841 GAGGAAGAAGAGAGGCAGGAAGG + Intergenic
1021993804 7:26160845-26160867 CAGGAAGAGGTGGAGCTGGATGG - Intronic
1022267861 7:28775222-28775244 CAGGCAGAGAGGAAGCAGGAGGG - Intronic
1022499100 7:30871444-30871466 CAGCAAGCCGGGAAGGAGGATGG + Intronic
1023049236 7:36236575-36236597 CAGTAAGAGGTGAAGCTGGCTGG + Intronic
1023410040 7:39881178-39881200 TGAGAAGACCTGAAGCAGGAGGG - Intergenic
1024530268 7:50385508-50385530 AAGGAAGCCATGAGGCAGGAAGG - Intronic
1024531121 7:50393422-50393444 CAGGATGACATGAAGGGGGAAGG + Intronic
1024897582 7:54278675-54278697 CAGGAAGACTGGAAGCCGGGAGG + Intergenic
1024938818 7:54740850-54740872 CAGGAAGACTGGAAGCAGGGAGG - Intergenic
1024946886 7:54817357-54817379 CAGGAAGACGAGAAGCAGGGAGG - Intergenic
1025003264 7:55335993-55336015 CAGGAAGACTGGAAGCAGGGAGG + Intergenic
1026294172 7:69036604-69036626 CAGGAGGAGGAGAAGCAGGTTGG + Intergenic
1026329017 7:69336063-69336085 CAAGAACAGGTGAAGTAGGATGG - Intergenic
1026562578 7:71462665-71462687 CGGGAAGACTTGAAGTGGGAGGG + Intronic
1028078779 7:86548247-86548269 GAGGATGAGCTGAAGCAGGATGG - Intergenic
1028959660 7:96734538-96734560 GAGGAAGACGTGATGCATGGTGG + Intergenic
1029646188 7:101857599-101857621 CAGAAATGAGTGAAGCAGGAAGG + Intronic
1031068301 7:117132886-117132908 CATGAAGACATGAACCTGGAGGG - Intronic
1031123059 7:117742965-117742987 CAGGAAGAGGTGAAGCAGGCTGG - Intronic
1031227670 7:119061159-119061181 CAGGAAGACTCAAAGCAGGGAGG + Intergenic
1032616816 7:133481830-133481852 CAGAAAGGAGTGAAGGAGGAGGG + Intronic
1034008339 7:147499697-147499719 AAGGAAGGCTTTAAGCAGGAGGG + Intronic
1035303381 7:157913400-157913422 CAGCAGGCAGTGAAGCAGGAAGG - Intronic
1036037045 8:5031060-5031082 CAGGAAGACCTGAAGGAGAGGGG - Intergenic
1036213543 8:6861780-6861802 CAGGAAGACTTGAAGCAGGGAGG - Intergenic
1036615794 8:10386387-10386409 CAGATATACCTGAAGCAGGAGGG + Intronic
1037499876 8:19475271-19475293 CAGTAAGACCTGAAGCTGAAGGG + Intronic
1038507650 8:28099383-28099405 CAGGAAGACAAGAAGAAGGCTGG + Intronic
1038596431 8:28890497-28890519 CAGGAAGAGGAGAAGGGGGAGGG - Exonic
1038627347 8:29206969-29206991 CAGGAGGGCATGAAGCAGGGTGG - Intronic
1038693114 8:29781209-29781231 GAGGAAGCCCTGAACCAGGATGG + Intergenic
1039978597 8:42387791-42387813 CAGAAAGACCTGAAGCAAGAAGG - Intergenic
1040471940 8:47741134-47741156 CAGAATGACGTGAACCAGGGAGG + Intergenic
1040744329 8:50621388-50621410 CAGGAAGAGGTGTAGAAGCAGGG + Intronic
1040915274 8:52562557-52562579 CAGGAAACCCTGAGGCAGGAGGG - Intronic
1042322559 8:67492902-67492924 CTGGAAGATGTGAAGAATGAAGG + Intronic
1042958811 8:74280543-74280565 AAGGAAGAAGGGAGGCAGGAAGG + Intronic
1043670439 8:82878576-82878598 TAGGCAGATGTGAAGCATGAAGG - Intergenic
1044222423 8:89684968-89684990 CAGGACAACTTGAAGCAGGGAGG - Intergenic
1044711517 8:95063043-95063065 GAGGAAGAAGTGAGGCTGGAAGG + Intronic
1044802069 8:95967247-95967269 GAGCAAGTCGTGAAGGAGGAAGG + Intergenic
1045331034 8:101155763-101155785 TAGGGAGACGAGTAGCAGGAGGG - Intergenic
1045354786 8:101375754-101375776 CTGCAGCACGTGAAGCAGGAAGG + Intergenic
1046440588 8:114247883-114247905 CAGGAAGACTGGAAGCAGAAGGG - Intergenic
1046956099 8:120064369-120064391 CAGGAAGACTCCAAGCGGGAGGG - Intronic
1047219378 8:122907347-122907369 CAGGAAGACTCCAAGCGGGAGGG + Intronic
1049356681 8:142192655-142192677 CAGGAAGGAGGGAAGGAGGAGGG + Intergenic
1049706907 8:144047285-144047307 CAGGAAGGGGTGGAGCAGGGAGG + Intergenic
1049741973 8:144245220-144245242 CAGGAAGTAGCGCAGCAGGAGGG - Exonic
1050684000 9:8146920-8146942 CAGGAAGAAGAGAAGTAGGAAGG - Intergenic
1050922882 9:11228471-11228493 CAGGAAAACTTGAAGCAGGGAGG + Intergenic
1051173475 9:14342441-14342463 AAGGAAGACGGGAGGCAGGGAGG + Intronic
1051375021 9:16393758-16393780 CAGGAAGACGTGAGAGAGAAAGG + Intergenic
1052785058 9:32820652-32820674 TGGGAAGAAGTGAAGGAGGAGGG - Intergenic
1052882564 9:33612694-33612716 CAGGAAGAAAAGCAGCAGGAAGG - Intergenic
1053151085 9:35743527-35743549 CTGGTAAACGTGAACCAGGAAGG + Intronic
1053504816 9:38633002-38633024 AAGGATGACGTGAACCAGGGAGG - Intergenic
1054452062 9:65408667-65408689 GAGGGAGACATGAAGCACGAAGG + Intergenic
1055002506 9:71468303-71468325 CTGGGAGAGGGGAAGCAGGATGG - Intergenic
1055523449 9:77106033-77106055 CTGGAAGAAGTGAAGGAAGAGGG + Intergenic
1056505694 9:87256300-87256322 CAGGTAGACATCAAGCAGGAGGG - Intergenic
1056802995 9:89707057-89707079 CCGAAAGAGGAGAAGCAGGAGGG - Intergenic
1057348931 9:94278319-94278341 GAGGGAGACATGAAGCAGGGTGG - Intronic
1058123996 9:101170848-101170870 GAGGATGACTTGAACCAGGAAGG + Intronic
1058369999 9:104255414-104255436 CAGGAAGACTGGAAGTAGGGAGG - Intergenic
1059136184 9:111808635-111808657 CAGGAAGACTTGAAGCAGGGAGG - Intergenic
1059553708 9:115256547-115256569 CAGGAGGAAGAGAAGCAGGGAGG + Intronic
1060458389 9:123823370-123823392 TAGGCAGACTTGAGGCAGGAAGG + Intronic
1060967467 9:127719989-127720011 CAGAAAGCCCTGAGGCAGGAGGG - Intronic
1060997462 9:127883211-127883233 CAGTAAGAGGTGCATCAGGAGGG - Intergenic
1061893535 9:133635229-133635251 CAGAGAGACGAGAAACAGGAGGG + Intergenic
1062097913 9:134712262-134712284 CAGGAAGAAGAGAGTCAGGAAGG - Intronic
1062097936 9:134712333-134712355 CAGGAAGAAGAGGGGCAGGAGGG - Intronic
1062097946 9:134712362-134712384 CAGGAAGGAGGGAAGAAGGAAGG - Intronic
1062098008 9:134712578-134712600 CAGGAAGAAGTGAGGCAGAAAGG - Intronic
1203364731 Un_KI270442v1:247700-247722 CATGAAGGCGTGAAGCTGGTGGG + Intergenic
1185681354 X:1891076-1891098 CAGGAAGACTCTAAGCGGGAAGG + Intergenic
1185699321 X:2218542-2218564 CAGGGAGACGTGAAGCCCAACGG - Intergenic
1185766919 X:2732974-2732996 GAGGAAGAAGTGAAGCAGGGAGG - Intronic
1185795765 X:2962932-2962954 CAGGAAGACTGTAAGCAGGGAGG - Intronic
1185811466 X:3114320-3114342 CTGGAAGACTTGAAGTGGGAGGG + Intergenic
1185812243 X:3121414-3121436 CAGGAAGACTGGAAGCAGGGAGG + Intergenic
1186779635 X:12899801-12899823 GAGAAAGACGTGAAGAGGGAAGG + Intergenic
1187089080 X:16075271-16075293 CAGGAACACATGGAGCAGAAAGG - Intergenic
1187149451 X:16668627-16668649 AAGGAAGAAGGGAAGAAGGAAGG + Intronic
1187551631 X:20311934-20311956 AAGGAAGAGGTGAAGAAGTAAGG - Intergenic
1187616545 X:21000769-21000791 CAGGAAGACTCTAAGCAGGGAGG - Intergenic
1187733184 X:22277572-22277594 CTGTAAAACGTGAGGCAGGAAGG - Intergenic
1187929291 X:24279388-24279410 CAGGAAGAGGCTAAGCATGATGG + Intergenic
1188716588 X:33465736-33465758 CTGGAAGAGGTGGAGCAAGATGG - Intergenic
1189504041 X:41593306-41593328 AAGTAAGAACTGAAGCAGGAGGG + Intronic
1190085277 X:47390027-47390049 CATGAAGACATCAAACAGGAAGG - Intronic
1190328774 X:49223052-49223074 GAGGAAGAGGAGAAGCAGCAAGG + Exonic
1190438206 X:50448863-50448885 CAGGAACCTGTGAAGCAGGGAGG + Intronic
1192337204 X:70231942-70231964 CAGGAAGACCTGGAGTGGGAGGG + Intergenic
1193192900 X:78593550-78593572 AAGGAAGAGGTGGAGCAAGATGG - Intergenic
1193871121 X:86799533-86799555 GAGGGAGAGCTGAAGCAGGATGG + Intronic
1194135483 X:90135432-90135454 CAGGAAGACTCAAAGCAGGGAGG - Intergenic
1194981812 X:100449380-100449402 CAGGAAAATATGAAGAAGGAAGG - Intergenic
1195401215 X:104463518-104463540 CAGGACAACTTGAAGCAGGGAGG - Intergenic
1196180900 X:112688376-112688398 CAGGAAGAAGTGGCTCAGGAAGG + Intergenic
1196811952 X:119635949-119635971 CAGGATGGAGTGAAGGAGGAGGG + Intronic
1196974180 X:121140657-121140679 CAGGACAACTTGAAGCAGGGAGG + Intergenic
1196998042 X:121405962-121405984 CAGGAAGACTCAAAGCGGGAAGG + Intergenic
1197491872 X:127128104-127128126 CAGGAATAGGTGGAGCAAGATGG + Intergenic
1197600229 X:128519297-128519319 GAGGAAGAGGTGGAGCAAGATGG + Intergenic
1199596499 X:149510128-149510150 CAGGAAGAAGTGAAGCCGCATGG + Intronic
1200753200 Y:6965837-6965859 CAGGAAAACTCGAAGCGGGAGGG + Intronic
1201269110 Y:12237190-12237212 CAGGAAGCCTGGAAGCAGGGAGG - Intergenic
1201297595 Y:12477589-12477611 CAGGAAGACTCCAAGCAGGGAGG - Intergenic
1201741108 Y:17325485-17325507 TAGGAAGAAGGGAAGAAGGAGGG + Intergenic
1201916102 Y:19182836-19182858 CAGGAAGACTTCAAGCATGGAGG + Intergenic
1201945352 Y:19504595-19504617 CAAGAAGCCCTGATGCAGGAGGG + Intergenic