ID: 1136480098

View in Genome Browser
Species Human (GRCh38)
Location 16:30535781-30535803
Sequence GGTAAGGCTGAGAAAGTCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 300
Summary {0: 1, 1: 2, 2: 1, 3: 27, 4: 269}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136480098 Original CRISPR GGTAAGGCTGAGAAAGTCAG AGG Intronic
900004450 1:35699-35721 GGTAAGTCTGAGCAAATCTGGGG - Intergenic
900024172 1:206215-206237 GGTAAGTCTGAGCAAATCTGGGG - Intergenic
901447077 1:9315126-9315148 GGCAAGGCTGAGAAGCTCAGCGG + Intronic
901839979 1:11948083-11948105 GGTGAGGCAGAGACAGTGAGGGG + Intronic
902386640 1:16079632-16079654 GGGGAGCCTGAGAAAGTCACAGG + Intergenic
902576487 1:17381171-17381193 GGAAAGGCAGAGACAGTCTGAGG - Intronic
902787873 1:18744981-18745003 GGCAAGGCTGGGAAGCTCAGGGG - Intronic
903051128 1:20602018-20602040 GGTTAGGATGAGAAGATCAGTGG + Intronic
904843924 1:33393920-33393942 TGTGAGGCTGTGAATGTCAGAGG - Intronic
905488087 1:38321110-38321132 GGTAAAACTGAGAAAGTTTGAGG + Intergenic
905828637 1:41046673-41046695 GGTAAGCCTGAGACAAGCAGTGG - Intronic
907447634 1:54519173-54519195 GGTGAGTCTGAGGAAATCAGTGG + Intergenic
908139191 1:61165883-61165905 TGTCAGGCTGAGCAAGTTAGTGG + Intronic
908278730 1:62506142-62506164 GATAAGGCTGAAAAATTGAGTGG + Intronic
908809637 1:67966857-67966879 GGTAAGGCTGAGAAATAAAAAGG - Intergenic
909498790 1:76310388-76310410 GGTAAGGCTGTGGTAGTTAGTGG + Intronic
909506073 1:76391422-76391444 GGTAATGCTGGAGAAGTCAGTGG + Intronic
910018542 1:82556582-82556604 GGTAAAGTTGAAAAAGTCAGAGG + Intergenic
910207759 1:84764913-84764935 GACAAGGCTGAGATGGTCAGGGG - Intergenic
911072217 1:93841197-93841219 GATACAGCTGAGAAAGTCAGTGG - Intronic
912130332 1:106591591-106591613 GGAATGGCTTAGAAAGTGAGTGG - Intergenic
914718785 1:150272413-150272435 GGTAAGTCAGAGACAGTGAGAGG + Exonic
914915953 1:151819391-151819413 GGTCAGGCTGAGAAGACCAGTGG + Intronic
915689703 1:157676451-157676473 GGTAAGTGTGAGAAAGACAGTGG + Intronic
915701823 1:157803795-157803817 GGATAGGCTGAGAAGGGCAGTGG - Intronic
916599867 1:166282422-166282444 AATAAGGCTGGGAAGGTCAGTGG - Intergenic
921696439 1:218215677-218215699 AGTTAGGCAGAGAAAGTGAGTGG - Intergenic
1062760400 10:12797-12819 GGCAAGCCCAAGAAAGTCAGGGG + Intergenic
1063323395 10:5073540-5073562 GGTAAGACTGAGAGAGAAAGGGG - Intronic
1064101586 10:12468830-12468852 GGAAAGGATGACAAAGACAGAGG - Intronic
1064233231 10:13548580-13548602 CTTCAGGTTGAGAAAGTCAGTGG + Intergenic
1064458109 10:15507590-15507612 GCTAAGGCTGAGGCAGTCAAAGG - Intergenic
1066451320 10:35532883-35532905 TGGAAGGATGAGAAAGCCAGAGG + Intronic
1066561007 10:36669774-36669796 GGTCAGGCTGGGTCAGTCAGTGG - Intergenic
1067169725 10:43896843-43896865 GGGAAGGCTGAGGAAGAGAGAGG + Intergenic
1068416473 10:56729683-56729705 GGGAATGAGGAGAAAGTCAGTGG - Intergenic
1069587593 10:69618802-69618824 GGTCAGGCTCAGAAGGGCAGAGG + Intergenic
1069817928 10:71210332-71210354 GGTTAGGCTGAGAAGGGAAGTGG + Intergenic
1070802200 10:79250381-79250403 GGAGAGCCTGAGAAGGTCAGGGG + Intronic
1071137689 10:82470859-82470881 GATAAGGCTGAGTAGGGCAGGGG - Intronic
1072587382 10:96795029-96795051 GGCAAGGCTGAGAGAGACTGTGG - Intergenic
1073275709 10:102308946-102308968 GTTCAGGCAGAGAAAATCAGTGG + Intronic
1074630811 10:115252739-115252761 TGAAAGGCTGATAAAGCCAGAGG - Intronic
1074753310 10:116607418-116607440 GGAGAGGCTCAGAAAGACAGTGG + Intronic
1075084035 10:119402134-119402156 GGGGAGGCTGGGAAAGGCAGAGG + Intronic
1075801215 10:125154724-125154746 GGTGAGGGTTAGAAAGTGAGGGG + Intronic
1076094442 10:127719971-127719993 GGGAAGGCGGAGACAATCAGTGG - Intergenic
1076991552 11:278667-278689 GGAGAGCCTGAGGAAGTCAGCGG - Intronic
1077674256 11:4183085-4183107 GGACTGGCTGGGAAAGTCAGTGG + Intergenic
1082688503 11:56270366-56270388 TGGAAGGGTGAGAGAGTCAGAGG + Intergenic
1082702060 11:56444133-56444155 GTTAAGACTGTGAAAGTTAGAGG - Intergenic
1082704302 11:56474617-56474639 GTTAAGACTGTGAAAGTTAGAGG + Intergenic
1083275234 11:61593318-61593340 GGTATGGATGTGAAAGTCATTGG + Intergenic
1084380319 11:68807751-68807773 GGTACAGCCGGGAAAGTCAGAGG + Intronic
1085056960 11:73410493-73410515 GGTAAGGATGAAGAAGACAGTGG + Intronic
1085681037 11:78575033-78575055 GGTGAGGCTGAGAAACTGAGAGG + Intergenic
1085996154 11:81916660-81916682 GGTAAGAATGAGAAAGTAATGGG + Intergenic
1087461956 11:98456822-98456844 AGTTTGGCTGAGACAGTCAGAGG - Intergenic
1088735209 11:112723074-112723096 GGCAAGGCAGAGAGAGGCAGGGG + Intergenic
1089647421 11:119889401-119889423 GGAAAGGGGCAGAAAGTCAGGGG - Intergenic
1089690307 11:120182986-120183008 GGAAAGGCTGGGAAGGTCAAGGG - Intronic
1090533077 11:127611464-127611486 TGTAAGGATGTGAAAATCAGGGG + Intergenic
1091377869 12:37751-37773 GGTAAGTCTGAGCAAATCTGGGG - Intergenic
1091383838 12:79264-79286 GCTGGGGCTGAGAAAGCCAGTGG - Intronic
1091434916 12:464795-464817 GGTAAGGCAGCGAAAGCCAACGG - Intronic
1091873399 12:3913787-3913809 GGTAAGGAGGAGAAAGGGAGGGG - Intergenic
1091903743 12:4165717-4165739 GGTGAGGCTCAGAAAGGCAAGGG + Intergenic
1092104725 12:5913275-5913297 GGTAAGAGTGAGGAAGACAGCGG + Intronic
1093688506 12:22083628-22083650 GGGAAGGCTGAGATAGAAAGAGG + Intronic
1093907806 12:24713176-24713198 GCTAAGAGTGAGAGAGTCAGTGG - Intergenic
1095826362 12:46533946-46533968 GATAAGGCTTAGAAGGTCAATGG + Intergenic
1100353675 12:93808787-93808809 GGTCAGTCTGAGGAAGGCAGGGG - Intronic
1101122087 12:101592830-101592852 AGTTACTCTGAGAAAGTCAGGGG - Intronic
1101693822 12:107106025-107106047 GGCAAGGCTCAGAGAGGCAGGGG - Intergenic
1102150547 12:110686969-110686991 GGAAAAGCTGAGGAAGGCAGTGG + Intronic
1103518591 12:121523247-121523269 GGAAAGGCTGGGAAATACAGAGG + Intronic
1103583333 12:121932897-121932919 GGGCAGGCTCAGATAGTCAGGGG + Intronic
1106092432 13:26608970-26608992 GGTAAGGCTGGAAAAATAAGTGG + Intronic
1110550326 13:76804836-76804858 GGGAAGGATGAGAGAGACAGAGG + Intergenic
1111075681 13:83231683-83231705 GTTATGGCTGAGAAACTCAGTGG - Intergenic
1112040887 13:95546917-95546939 GATAAGGCAGAGAGAGTAAGGGG - Intronic
1112446491 13:99469299-99469321 GGTGATGCTGAGAAAACCAGCGG - Intergenic
1113413834 13:110112938-110112960 TGTAAGGATGAGGAAGCCAGTGG + Intergenic
1114215652 14:20655919-20655941 GGAAAGGCTGACAAAGCCAGGGG + Intergenic
1114430493 14:22656536-22656558 GGTAGGGCTGATAAAGACATGGG - Intergenic
1114674848 14:24432831-24432853 AGTAAGGATGCCAAAGTCAGAGG + Exonic
1118162129 14:63301338-63301360 GGGAAGGATGAGAAAATAAGGGG - Intergenic
1118501059 14:66363170-66363192 GGTAAGGCAGTGAAATTCAAGGG - Intergenic
1120336399 14:83162501-83162523 AGTGAGGCTGGGAAAGACAGCGG + Intergenic
1120828439 14:88976054-88976076 GGTGAGGCTGAAGAAATCAGGGG + Intergenic
1125419375 15:39488736-39488758 GCCAAGCCTGAGAAAGTCAAAGG + Intergenic
1126461296 15:48917739-48917761 GGAATGGCTGAGAAAGTCAATGG + Intronic
1127896440 15:63303784-63303806 GATAAGAATGAGAAAGCCAGGGG - Intronic
1129618095 15:77115923-77115945 GGTAGGGTTGAGAGAGTCACTGG + Intronic
1131191429 15:90319862-90319884 GGCATGGAAGAGAAAGTCAGAGG + Intergenic
1132729690 16:1355360-1355382 AATCAGGCTGAGAAACTCAGGGG + Intronic
1133711157 16:8402281-8402303 GGGAAGTATGAGAAAATCAGAGG + Intergenic
1133853163 16:9524978-9525000 GGGAAGGCTGAGAAAGAAGGAGG - Intergenic
1134328605 16:13229790-13229812 GGGGTGGCTGAGAAAGTCTGAGG + Intronic
1134820574 16:17243784-17243806 TCAAGGGCTGAGAAAGTCAGAGG + Intronic
1136480098 16:30535781-30535803 GGTAAGGCTGAGAAAGTCAGAGG + Intronic
1136483959 16:30559233-30559255 GGTAAGGTTGAGAAAGTCAGAGG + Intergenic
1136564953 16:31064248-31064270 GCTAAGGCAGAGGAAGCCAGTGG - Exonic
1137869669 16:51937872-51937894 GGTGATGGTGAGAAAGTCAGTGG + Intergenic
1138094639 16:54202283-54202305 GGGGAGGGAGAGAAAGTCAGGGG - Intergenic
1138517074 16:57542034-57542056 GGTAAGGCTGGCAAAGTCACTGG - Intergenic
1139367175 16:66440647-66440669 GGTGAGGCTGAGAAGGTCTGGGG - Intronic
1140379353 16:74472269-74472291 GGTGAGTCTGAGATACTCAGGGG + Intronic
1147238596 17:39075770-39075792 GGTAACGTTTAGAAAGGCAGGGG + Intronic
1149430600 17:56593614-56593636 GGCAACGCCGAGAGAGTCAGTGG + Intergenic
1149505994 17:57194403-57194425 GGAAAGGCTGTGAAAATCATTGG + Intergenic
1149691222 17:58578405-58578427 GGTTATGCAGAAAAAGTCAGTGG + Intronic
1150746132 17:67818304-67818326 GTTAAGGCTCAGAAAGTCAGAGG - Intergenic
1150888239 17:69112649-69112671 CGGAAGGGTGAGAGAGTCAGAGG + Intronic
1151893293 17:76963802-76963824 GGTAAGGCTGACATAGCCAGGGG - Intergenic
1152084833 17:78211643-78211665 GGAATGGCTGAGAAAGACGGGGG - Intergenic
1152275409 17:79353808-79353830 GGGAAGGGTGAGAAAGCCAGTGG - Intronic
1152724715 17:81939541-81939563 GGGAAGGCTGAGGAAGGAAGTGG - Intronic
1152953308 18:13151-13173 GGCAAGCCCAAGAAAGTCAGGGG + Intergenic
1153341297 18:3977781-3977803 GGTGATGCTGTTAAAGTCAGAGG + Intronic
1153540197 18:6145946-6145968 GGTAAGGAAGAGACAGTGAGTGG + Intronic
1159914271 18:74174488-74174510 GGTCAGGCTGCGAAAGTGAATGG + Intergenic
1160360332 18:78269737-78269759 GGAAAGACTAAGAAAGACAGTGG - Intergenic
1160636202 19:77308-77330 GGTAAGTCTGAGCAAATCTGGGG - Intergenic
1163690569 19:18736239-18736261 GGGAAGGCTGATGAAGGCAGAGG - Intronic
1163892587 19:20030015-20030037 GGTAAGGCTGGGACAGGGAGAGG + Intronic
1164490161 19:28703487-28703509 GTGAAGGCTGAGAGAGTCAAGGG - Intergenic
1164915347 19:32047481-32047503 GGCAAGGCTGCGTAAGGCAGTGG + Intergenic
1165493968 19:36141220-36141242 GGTAAGGCGGAGACTATCAGAGG + Exonic
1166194073 19:41194643-41194665 GGTCAGGCTGAGGAGTTCAGCGG + Exonic
928940158 2:36719100-36719122 GGGCAGGCTGAGAAAGGCAGGGG - Intronic
930399105 2:50860613-50860635 GGCAAGGCTGAGTCAGGCAGAGG + Intronic
935043295 2:99455395-99455417 GGTAAGTCTGAGGTAGTTAGGGG - Intronic
935287269 2:101576248-101576270 GAAAAGGCTGAGAAAGTCATCGG + Intergenic
936452028 2:112640986-112641008 TTTTAGGCTGAGAAAGTGAGGGG - Intergenic
936565280 2:113577742-113577764 GGTAAGTCTGAGCAAATCTGGGG + Intergenic
937678032 2:124613460-124613482 GGAAAGGCTGTGGAAGCCAGAGG - Intronic
942803625 2:179903616-179903638 GGTGAGGCTGTGAAGGGCAGTGG + Intergenic
944285269 2:197942374-197942396 GGAAAGAATGAGAAATTCAGTGG - Intronic
945040251 2:205738049-205738071 GCCAAGGCTGAGAAATGCAGGGG + Intronic
945191819 2:207196692-207196714 TTTGAGGCTGAGAAAGTGAGAGG + Intergenic
945566056 2:211401305-211401327 GATGAGGGTGAGAAAGTCAATGG + Intronic
945801380 2:214435786-214435808 ACAAAGGATGAGAAAGTCAGAGG + Intronic
946385802 2:219383829-219383851 GGAAAGGCAGAAAAAGGCAGAGG + Intronic
947039948 2:225906036-225906058 GGTAAAACGGAGAATGTCAGAGG - Intergenic
947654242 2:231812672-231812694 GTTAAGGATGAAAAAGGCAGCGG - Intergenic
947716084 2:232339472-232339494 GGACAGGCTGCGAAAGTCACGGG + Intronic
948265585 2:236633202-236633224 GGACAAGCTGAGAAATTCAGTGG + Intergenic
1168973215 20:1945166-1945188 TGAAAGGCAGAGAAACTCAGTGG - Intergenic
1169008005 20:2225058-2225080 ACTGAGGCTGAGAAAGGCAGGGG - Intergenic
1171812787 20:29758901-29758923 GGTAAGGCTCAGATATTCATTGG - Intergenic
1174207524 20:48851570-48851592 GGTAAGGCTGAGAAAGACAGTGG - Intergenic
1174795059 20:53515258-53515280 GTGAAGGCTCATAAAGTCAGTGG + Intergenic
1175003432 20:55655401-55655423 GCAAATGCTGAGAAACTCAGGGG + Intergenic
1177508536 21:22050879-22050901 GGTAAGTGTCAGTAAGTCAGAGG - Intergenic
1177644923 21:23888750-23888772 TGTAAGACTGAGAAAGATAGAGG - Intergenic
1177770430 21:25508594-25508616 GCTAAGCCTGAGAAAGTCTCCGG - Intergenic
1178403126 21:32304289-32304311 AGGAAGGCTAAGAGAGTCAGAGG + Intronic
1178511484 21:33208497-33208519 GATAAGGCTCAGAGAGTCAGAGG + Intergenic
1180651099 22:17377890-17377912 GCTGAGGCTGAGAAACCCAGAGG - Intronic
1181527726 22:23499633-23499655 GGTAAGGAGGAGGAAGCCAGGGG - Intergenic
1181639693 22:24190075-24190097 GGCAAGGCTGAGCAGGTGAGAGG - Intergenic
1182409479 22:30171020-30171042 TGTCATGTTGAGAAAGTCAGGGG - Intronic
1182764776 22:32750860-32750882 GGAAAGGCTGAGGAAGGCACAGG + Intronic
1183265112 22:36820080-36820102 GGAAAGACTGAGAAAGAGAGAGG - Intergenic
1183850963 22:40587599-40587621 GGTAAGGCAGAGGCAGCCAGGGG + Intronic
1183877679 22:40797920-40797942 GGTCAGGGTGGGAAAGCCAGAGG - Intronic
1184044555 22:41964646-41964668 GGAACTGATGAGAAAGTCAGAGG + Intergenic
949126576 3:452269-452291 AGTAAGGCTGACTAATTCAGTGG - Intergenic
950184383 3:10936334-10936356 GGTGAGGCAGCGAAATTCAGGGG - Intronic
950660065 3:14461715-14461737 GGTGAGGCTGAGAAAGTGAAAGG - Intronic
951043631 3:18014643-18014665 GATGAGGCTGAGTAAATCAGTGG - Intronic
952763206 3:36933836-36933858 GCTACAGCTGAGAAAGTCTGTGG + Intronic
954855171 3:53638134-53638156 GCTAAGGCTAAGAATGTCTGTGG - Intronic
955569830 3:60292412-60292434 GAAAAGCCTGAGAAAATCAGGGG + Intronic
956160983 3:66352331-66352353 GATAAGGCTGAGGCAGACAGAGG - Intronic
956872366 3:73430657-73430679 TGTAAGGATGGGAAAGTCTGTGG - Intronic
958949901 3:100405169-100405191 GGTAAGGATGAAAAAGAGAGAGG - Intronic
959761699 3:109973950-109973972 GGTAATGCTTGGAAAGTCAGAGG - Intergenic
961065872 3:123876994-123877016 GTTGAGGCTGAAAAGGTCAGAGG + Intronic
963244870 3:143048481-143048503 TGTAAGGCTGAGAAAGCAAGGGG - Intronic
963810783 3:149774360-149774382 GGTAAGGCCGAGGAAGGCAGAGG - Intronic
965821934 3:172693018-172693040 TGTAAGTCTGAGGAACTCAGAGG - Intronic
966914101 3:184575509-184575531 GGGAAGACAGAGAAAGACAGAGG - Intronic
967146960 3:186614571-186614593 GGAAACGCTGATCAAGTCAGGGG + Intronic
968579078 4:1381368-1381390 GGTATGGCTGAGGAGGCCAGAGG - Intronic
973071915 4:45871128-45871150 GATGAGGCTGAGAAAGTGATGGG + Intergenic
973180232 4:47257862-47257884 TGTAAGACTGAGAAAATCAAGGG - Intronic
973867929 4:55132914-55132936 GGAGAGGCAGAGGAAGTCAGTGG - Intergenic
973903144 4:55498632-55498654 GGTAAGGATCAAACAGTCAGTGG - Intronic
973927042 4:55749097-55749119 GGGAGGGGTGGGAAAGTCAGAGG + Intergenic
974787069 4:66632319-66632341 GGTAAGGTTGAGGAATCCAGGGG + Intergenic
975495549 4:75032019-75032041 GGTCAAGCAGAGAAAGTCCGAGG - Intronic
977236010 4:94507996-94508018 GGTAATGCTGAGATTGGCAGAGG - Intronic
977294323 4:95193954-95193976 AGTAAGGCAGACAAACTCAGGGG - Intronic
977373616 4:96171551-96171573 AGTAAGGCCGAGGAAGGCAGAGG + Intergenic
978999921 4:115203755-115203777 GGTAAGTCTGAGTAAGTTATAGG + Intergenic
979341392 4:119528599-119528621 GTTCAGGGTGACAAAGTCAGTGG - Intronic
979816656 4:125114565-125114587 AGTAATGCTAAGAAAGGCAGTGG - Intergenic
980828169 4:138096786-138096808 AGGAAGGCTCAGAAAGTCAGTGG + Intergenic
981001500 4:139833242-139833264 GGGAAGACAGAGAAAGACAGGGG + Intronic
981593569 4:146392865-146392887 GATGAGGCTGAGGTAGTCAGTGG - Intronic
981645537 4:146994578-146994600 GGGAAGGCTGAGGAAATCAATGG + Intergenic
982408538 4:155046544-155046566 AGTAATGCTGAGAAGCTCAGTGG + Intergenic
984615289 4:181889973-181889995 AGCAAGGCTGAGTAGGTCAGAGG - Intergenic
985065601 4:186117892-186117914 GGTGAGGCTGAGGAAGCAAGAGG + Intronic
985145913 4:186894405-186894427 GTTAAGGATAAGAAGGTCAGGGG - Intergenic
985925939 5:3019159-3019181 GGTGAGGCGGAGATGGTCAGTGG + Intergenic
986764308 5:10910464-10910486 GCCAAGGCTTAGAAAGTCACTGG - Intergenic
988678671 5:33461281-33461303 GATCAAGCTGAGAAAGTAAGTGG + Exonic
990047036 5:51445229-51445251 GGTTAGGCTCAGGGAGTCAGAGG + Intergenic
991579303 5:68137559-68137581 GGTTAGGAACAGAAAGTCAGTGG - Intergenic
993803106 5:92369677-92369699 GGCATGACTGAGAAAGTCAGAGG - Intergenic
994994522 5:107042966-107042988 GCCAAGGGTGAGGAAGTCAGCGG - Intergenic
996919877 5:128755510-128755532 GGCAATGCAGTGAAAGTCAGAGG + Intronic
997473305 5:134128696-134128718 GGCAAGGCCCAGAAAGGCAGGGG - Intronic
998675824 5:144406866-144406888 TGTAAGGCAGAGAAACTCATTGG + Intronic
1000016813 5:157285311-157285333 GGGAAGGAAGAGAAGGTCAGTGG - Intronic
1000223101 5:159233158-159233180 GGAAAAACTGAGAAAGACAGTGG + Intergenic
1000802151 5:165740917-165740939 TGTAAGGCCAAGAAAGCCAGTGG + Intergenic
1000943894 5:167396839-167396861 GGTAAGGCTTTGAATGTCAAGGG + Intronic
1001667403 5:173444715-173444737 GGTAAGGCAGAGTGAGTGAGGGG + Intergenic
1001753408 5:174148276-174148298 GGGAAGACTGAGAAAGGAAGAGG - Intronic
1003476458 6:6488233-6488255 GTTAAAGCTGAGAAAGTCCTGGG + Intergenic
1005011952 6:21344232-21344254 GGCAAGGCTGGGAAAGGGAGAGG + Intergenic
1006102141 6:31692022-31692044 AGTAAAGCTGTGAAGGTCAGGGG - Intronic
1006163932 6:32053590-32053612 GGACAGGCTGAGGGAGTCAGGGG + Intronic
1006164559 6:32056788-32056810 GGACAGGCTGAGGGAGTCAGGGG + Intronic
1006164879 6:32058260-32058282 GGAAAGGCTCAGCGAGTCAGGGG + Intronic
1006165558 6:32062359-32062381 GGACAGGCTGAGGGAGTCAGGGG + Intronic
1006166509 6:32068592-32068614 GGACAGGCTGAGGGAGTCAGGGG + Intronic
1007478569 6:42135308-42135330 CGTAAGGCAGTGCAAGTCAGGGG - Intronic
1008053227 6:46921290-46921312 GGTCAGGCTGAGGAAGGAAGAGG - Intronic
1009295745 6:61944494-61944516 GGGAAGGGTGTGAAGGTCAGAGG + Intronic
1010384318 6:75261813-75261835 GATAAGGCTAAGGAAGTCTGTGG + Intronic
1011667595 6:89650002-89650024 GGTAAGGAAGAGAAATGCAGTGG - Exonic
1013717808 6:112984591-112984613 GGTAAGGTTGAGAAAGAGATGGG + Intergenic
1016861272 6:148721107-148721129 GGTGAGGCTGAGTCAGCCAGGGG - Intergenic
1017070762 6:150573727-150573749 GGTAAGGCTGGGGAAGAAAGGGG - Intergenic
1017213293 6:151880545-151880567 AGTAAGGCTGAGGAAGTGATAGG + Intronic
1017621578 6:156304652-156304674 GATAAGGCTGGAAAAGTCAGTGG + Intergenic
1017640963 6:156493777-156493799 GAGAAGGCTGAGAAAGACACTGG + Intergenic
1019033228 6:169031558-169031580 GGTGATGCTGAGGAAGTCAGAGG - Intergenic
1019603669 7:1897936-1897958 ACAGAGGCTGAGAAAGTCAGGGG + Intronic
1021526692 7:21595912-21595934 GGAAAGGCTGAGACAGTAGGAGG + Intronic
1021985478 7:26094258-26094280 GGAAAGGCAGAGAAGGACAGGGG - Intergenic
1022383100 7:29878897-29878919 GGGAAGGCTGACAAGGGCAGTGG + Intronic
1022792728 7:33704940-33704962 GGTCAGGCTGAGCAAGACTGTGG - Intergenic
1022841039 7:34164047-34164069 GGAAAGGCTAAGAAACTCTGGGG + Intergenic
1024992051 7:55242643-55242665 GGCAAGGGTGAGATAGTCAAAGG - Intronic
1025971305 7:66328502-66328524 GCTAAAACTGAGAAACTCAGAGG - Intronic
1028338471 7:89687825-89687847 AGTCAGGCTGAGAACCTCAGTGG + Intergenic
1030240762 7:107321108-107321130 AGTAAGACTGGCAAAGTCAGAGG + Intronic
1030285497 7:107822499-107822521 GGAAAGGCAGGCAAAGTCAGAGG + Intergenic
1030875836 7:114812292-114812314 GGTAAGGTTGATAATGTAAGAGG - Intergenic
1031541459 7:122999848-122999870 TGAAAAGCTGAGAAAGTGAGGGG + Intergenic
1034952052 7:155305223-155305245 GGTTAGGCTTAGAACCTCAGAGG - Intronic
1035768352 8:2126803-2126825 GGGGAGGCTGATAAAGTCTGGGG + Intronic
1036066062 8:5382855-5382877 AGTAAGACTGAGAAAATAAGTGG + Intergenic
1036509730 8:9389131-9389153 GGTTAGGCTGACAAAGTGTGAGG - Intergenic
1037023025 8:13997720-13997742 AGAAAGGATGAGAAAGACAGGGG - Intergenic
1038204800 8:25456233-25456255 GGTAAGGGAGATAAAGTAAGTGG + Intronic
1038431555 8:27504398-27504420 GGTTAGGCAGATAAAGCCAGGGG + Intronic
1040315809 8:46260307-46260329 GGGAATGGTGAGACAGTCAGAGG + Intergenic
1040454676 8:47584846-47584868 GGAAAGGCAGAGAAAGCCACAGG - Intronic
1040603300 8:48905528-48905550 GGTAGGCCTGAGAAAATCAGGGG + Intergenic
1041015315 8:53587276-53587298 GGTGAGGCTGGGAAGGGCAGTGG + Intergenic
1041471180 8:58211141-58211163 GGAAAGTCTGAAAAAATCAGAGG - Intergenic
1043941059 8:86196518-86196540 GGTAAGTCTGAGTTAGTAAGTGG - Intergenic
1044740672 8:95323151-95323173 GGGAAGGCTGAGACAGCCTGTGG + Intergenic
1044825920 8:96196970-96196992 GGAAAGGCAGACAAAGTCACAGG - Intergenic
1046809397 8:118516181-118516203 GGAAAGGTTGAAGAAGTCAGTGG - Intronic
1049294258 8:141822401-141822423 GGGAAGGCTGAGAAAGAGAGTGG - Intergenic
1049433141 8:142574478-142574500 CGAAAGGCAGAGAAAGGCAGCGG - Intergenic
1049887145 9:35482-35504 GGTAAGTCTGAGCAAATCTGGGG - Intergenic
1051603488 9:18897264-18897286 GGGAAGGCTGAGTAACTCAAGGG - Intronic
1051824105 9:21199230-21199252 GCTAAGGCTAAGAATGTCTGTGG + Intergenic
1052728955 9:32262849-32262871 GGTAAGGGATATAAAGTCAGTGG - Intergenic
1053455559 9:38230870-38230892 GGCAGGGTGGAGAAAGTCAGAGG - Intergenic
1054852836 9:69866314-69866336 TGGAGGGCTGAGAAAGCCAGTGG + Intronic
1055110173 9:72551540-72551562 GGTCTGGCTGAGAAAAGCAGTGG - Intronic
1055374841 9:75637486-75637508 GGCAAGGCTGATAAATTCAAGGG - Intergenic
1055785571 9:79865878-79865900 GGGAAGGCTCAGAAAAACAGGGG - Intergenic
1058069371 9:100586070-100586092 AGAGAGGCTGAGACAGTCAGGGG + Exonic
1058069375 9:100586091-100586113 GGAGAGGCTGAGACAGTCAGGGG + Exonic
1058733842 9:107876263-107876285 GGTAAGGCTGAGACTCTCACTGG - Intergenic
1059031943 9:110707361-110707383 GTTAAGGCAGAGAATGTGAGGGG - Intronic
1059910251 9:119035508-119035530 AGTGAGGCAGAGAGAGTCAGTGG - Intergenic
1060726889 9:126012058-126012080 GTTAAGGCTCAGAAAGTTATCGG - Intergenic
1061917883 9:133765545-133765567 TGTAAGGCAGAGAAAGACTGAGG + Intronic
1185567761 X:1108889-1108911 GGTTAAGCTGTGAAAGGCAGTGG + Intergenic
1185844164 X:3421613-3421635 GGGAAGGATGAGAGGGTCAGGGG + Intergenic
1187490644 X:19748236-19748258 AGTAACTCAGAGAAAGTCAGTGG + Intronic
1190073952 X:47301824-47301846 GGAAAGGCAGAGAAAGGGAGGGG + Intergenic
1190588541 X:51973337-51973359 GGCAAGGCTGAGATATCCAGAGG - Intergenic
1193083755 X:77429794-77429816 GGAAAGGTTGAGGAAGGCAGAGG + Intergenic
1194915981 X:99709198-99709220 AGTCAGACTGAGGAAGTCAGAGG - Intergenic
1197186703 X:123595463-123595485 AGGAAGGCTGGAAAAGTCAGGGG + Intergenic
1198025341 X:132700280-132700302 GGCAAGGTTGAGAAAATCAATGG + Intronic
1199565126 X:149207764-149207786 AGAGAGGCTGAGAAAGTCATTGG + Intergenic