ID: 1136483153

View in Genome Browser
Species Human (GRCh38)
Location 16:30555318-30555340
Sequence CACCAGTGGGTTCATCGGCC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 88
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 79}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136483153_1136483159 -1 Left 1136483153 16:30555318-30555340 CCGGGCCGATGAACCCACTGGTG 0: 1
1: 0
2: 1
3: 7
4: 79
Right 1136483159 16:30555340-30555362 GTTTGGCCACGGCTGACTTCTGG 0: 1
1: 0
2: 0
3: 6
4: 66
1136483153_1136483161 8 Left 1136483153 16:30555318-30555340 CCGGGCCGATGAACCCACTGGTG 0: 1
1: 0
2: 1
3: 7
4: 79
Right 1136483161 16:30555349-30555371 CGGCTGACTTCTGGCCAAAGCGG 0: 1
1: 0
2: 1
3: 6
4: 93
1136483153_1136483167 28 Left 1136483153 16:30555318-30555340 CCGGGCCGATGAACCCACTGGTG 0: 1
1: 0
2: 1
3: 7
4: 79
Right 1136483167 16:30555369-30555391 CGGCGGCCGCACTGCGGGCAGGG 0: 1
1: 0
2: 2
3: 13
4: 106
1136483153_1136483164 22 Left 1136483153 16:30555318-30555340 CCGGGCCGATGAACCCACTGGTG 0: 1
1: 0
2: 1
3: 7
4: 79
Right 1136483164 16:30555363-30555385 CCAAAGCGGCGGCCGCACTGCGG 0: 1
1: 0
2: 0
3: 11
4: 75
1136483153_1136483168 29 Left 1136483153 16:30555318-30555340 CCGGGCCGATGAACCCACTGGTG 0: 1
1: 0
2: 1
3: 7
4: 79
Right 1136483168 16:30555370-30555392 GGCGGCCGCACTGCGGGCAGGGG 0: 1
1: 0
2: 2
3: 24
4: 242
1136483153_1136483166 27 Left 1136483153 16:30555318-30555340 CCGGGCCGATGAACCCACTGGTG 0: 1
1: 0
2: 1
3: 7
4: 79
Right 1136483166 16:30555368-30555390 GCGGCGGCCGCACTGCGGGCAGG 0: 1
1: 0
2: 1
3: 27
4: 229
1136483153_1136483162 11 Left 1136483153 16:30555318-30555340 CCGGGCCGATGAACCCACTGGTG 0: 1
1: 0
2: 1
3: 7
4: 79
Right 1136483162 16:30555352-30555374 CTGACTTCTGGCCAAAGCGGCGG 0: 1
1: 0
2: 0
3: 9
4: 103
1136483153_1136483165 23 Left 1136483153 16:30555318-30555340 CCGGGCCGATGAACCCACTGGTG 0: 1
1: 0
2: 1
3: 7
4: 79
Right 1136483165 16:30555364-30555386 CAAAGCGGCGGCCGCACTGCGGG 0: 1
1: 0
2: 0
3: 4
4: 79

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136483153 Original CRISPR CACCAGTGGGTTCATCGGCC CGG (reversed) Exonic
901639293 1:10685336-10685358 CACCAGCGGGTTCATGGGGCAGG - Intronic
901721818 1:11204698-11204720 CACCTGTGGGATCACAGGCCTGG - Exonic
903304443 1:22402752-22402774 CATTAGTGGTTTCATCGCCCAGG - Intergenic
905378300 1:37540454-37540476 CAGGAGTTGGTTCCTCGGCCTGG - Exonic
906227035 1:44130667-44130689 CACCAGAAGACTCATCGGCCGGG + Exonic
916913472 1:169379040-169379062 CACCAGTGTGTTGAGAGGCCTGG - Intronic
920404245 1:205697185-205697207 CACCACTGGCTTCAAAGGCCAGG + Intergenic
923619222 1:235564340-235564362 CACCAGTGATTTCATCCCCCAGG - Intronic
1068548956 10:58385184-58385206 GAGCAGTGGGTTCCTCTGCCGGG - Exonic
1072562438 10:96588108-96588130 CACGAGGGCGTTCATCTGCCAGG + Intergenic
1077034900 11:489851-489873 CAGCAGGGGGTTCAGCGTCCCGG - Intronic
1078387881 11:10908911-10908933 CACCAGCAGGCTCATGGGCCCGG - Intergenic
1079124970 11:17712590-17712612 CATCAGTGGGTTCTTAAGCCTGG + Intergenic
1079435621 11:20445610-20445632 CACCTGTGTGATCATCAGCCAGG + Intronic
1098416621 12:70242794-70242816 CACCAGTGGTTTCATCAGAGGGG + Intergenic
1101547589 12:105731006-105731028 TACCATTGGGTTCATGTGCCTGG - Intergenic
1101734095 12:107449935-107449957 CAGAAGTGGGTACATCAGCCAGG - Intronic
1105245201 13:18643939-18643961 AGCCAGTGGGATCGTCGGCCAGG + Intergenic
1109488921 13:63068928-63068950 CACCAGTGGCCTCATCAACCTGG - Intergenic
1110575211 13:77047787-77047809 CTCCAGTGGGTTCCTGGGCCAGG + Intronic
1111164211 13:84436907-84436929 CACCAGTGGGCTCATCCCACTGG + Intergenic
1111167794 13:84484853-84484875 TACCATTGTGTTCATCTGCCTGG - Intergenic
1118300431 14:64610572-64610594 CAGCAGGGGGTTCATTGGACTGG + Intergenic
1120825708 14:88953075-88953097 CAACAAAGGCTTCATCGGCCAGG - Intergenic
1121448222 14:93991814-93991836 CACCTGTGGTTCCCTCGGCCTGG - Intergenic
1124159102 15:27253128-27253150 CAGCAGTGGGTCCAGCAGCCCGG - Intronic
1124218772 15:27831796-27831818 GACCAGAGGGTTCAGCAGCCTGG - Intronic
1125700700 15:41680757-41680779 CATCAGTGTGTTCACCAGCCAGG + Intronic
1126794179 15:52246344-52246366 CATCAGTGGGTGCTTGGGCCAGG - Intronic
1129794830 15:78368293-78368315 CTCCAGTGGGTTCCTTGGTCTGG + Intergenic
1130548939 15:84877110-84877132 CACCAGTTGTTTCCTCAGCCTGG - Intergenic
1136479442 16:30532623-30532645 CACCAATGGGTCCATCGGCCCGG - Exonic
1136483153 16:30555318-30555340 CACCAGTGGGTTCATCGGCCCGG - Exonic
1140565101 16:76032353-76032375 CACCAGTAGGTTCAGCTGTCTGG - Intergenic
1141677470 16:85525168-85525190 GCCCAGTGGTTTCATCAGCCGGG + Intergenic
1142033588 16:87850497-87850519 CACCAGAGCGTGCATCCGCCGGG + Intronic
1144348337 17:14369831-14369853 CACCTTTGGGTTCACCTGCCGGG - Intergenic
1147968911 17:44209265-44209287 CACAAGTGGGTGGATGGGCCAGG + Intronic
1148218284 17:45845746-45845768 CACCATTGGGATCTTTGGCCTGG + Exonic
1148681166 17:49474252-49474274 CACCAGTGGTTTCTTCTGCCAGG + Intronic
1150410897 17:64939824-64939846 CACCTGGGGCTTCATCGGGCTGG + Intergenic
1153926854 18:9842151-9842173 CACCAGTGTGCTCAGCAGCCCGG + Intronic
1154443746 18:14415992-14416014 AGCCAGTGGGATCGTCGGCCAGG - Intergenic
1160011807 18:75111705-75111727 CACCTGTGATTTCATCGCCCTGG - Intergenic
1160932448 19:1577126-1577148 TACGGGTGGGTTCATTGGCCTGG - Exonic
1162883800 19:13681138-13681160 CATCAGTAGTTTCACCGGCCGGG + Intergenic
930728839 2:54709012-54709034 TGCCAGTGGGTGAATCGGCCTGG - Intergenic
939100392 2:137889045-137889067 AGCCAGTGGGATCGTCGGCCAGG + Intergenic
947931780 2:233970709-233970731 CAGCAGTGGGTTTATCATCCAGG - Intronic
948460147 2:238125250-238125272 CACCTGTGGGTGAATGGGCCTGG - Exonic
1169082563 20:2806082-2806104 CCCCAGTGGGTTCACCTGCAAGG + Intergenic
1174324514 20:49768562-49768584 CCCCAGTGGCTTCAGGGGCCAGG + Intergenic
1175240036 20:57540440-57540462 CGCCAGTGGCTCCTTCGGCCTGG + Intergenic
1175286444 20:57839993-57840015 CAGCAGTGGCTTCCTCTGCCTGG - Intergenic
1176452342 21:6875232-6875254 AGCCAGTGGGATCGTCGGCCAGG + Intergenic
1176830514 21:13740281-13740303 AGCCAGTGGGATCGTCGGCCAGG + Intergenic
1178767604 21:35469002-35469024 CACCAGTGTGTGCATCGGCAGGG + Intronic
1180414083 22:12693303-12693325 CACCACTGGGCTGACCGGCCTGG - Intergenic
1180636787 22:17268190-17268212 CACCAGGTGGATCATCGCCCTGG + Intergenic
1183953276 22:41364411-41364433 CACCAGTGGGTTGCTGGGCCAGG - Intergenic
1185074369 22:48675448-48675470 CACAAGTGGGTGTATGGGCCGGG - Intronic
954520342 3:51219774-51219796 CACAAGTGGGTTCATAGCGCTGG + Intronic
961839573 3:129697404-129697426 CAGCAGGGGGGTCCTCGGCCTGG + Intronic
963042074 3:141077393-141077415 CACCAGTGAGATCATGGGCGTGG - Intronic
968931458 4:3581683-3581705 CACCAGAGGGACCATGGGCCTGG - Intronic
979173055 4:117626019-117626041 AAACAGTGGTTTCATGGGCCAGG + Intergenic
980383516 4:132058135-132058157 CACCAGTGGGGCCCTGGGCCTGG - Intergenic
991409350 5:66331349-66331371 CAGCAGTGGGTGCCTGGGCCTGG - Intergenic
1004416975 6:15433673-15433695 CAGTAGTGGGTGCATCGACCTGG - Intronic
1017326167 6:153143566-153143588 CACCATTGGGTTCTTCGGAGGGG + Intergenic
1017851966 6:158312277-158312299 CACCAGTGGGCTCAGGAGCCCGG + Intronic
1021097095 7:16547261-16547283 CACCAGTGGGTGACTCGGCCTGG - Intronic
1023209137 7:37784259-37784281 CACCTGTGGGTTTCTCTGCCTGG - Intronic
1032512671 7:132484374-132484396 CACCTGTGGGATCTTCTGCCTGG + Intronic
1035474452 7:159132247-159132269 CAGCAGTGGGTGCAGTGGCCCGG - Intronic
1035478803 7:159164641-159164663 CAGCAGTGGGTGCAGTGGCCCGG + Intergenic
1039770452 8:40681095-40681117 CACTAGTGGGTTCATCTCCCTGG - Intronic
1048382043 8:133873985-133874007 CACCAGTGGGTTTCTCAACCCGG - Intergenic
1052889921 9:33689277-33689299 AAGCAGTGGGTTCATTGGCTGGG - Intergenic
1054458672 9:65450246-65450268 CACCAGAGGGACCATGGGCCTGG + Intergenic
1056583785 9:87914954-87914976 AACCCGTGGGCTCAGCGGCCAGG + Intergenic
1056584277 9:87918423-87918445 AACCCGTGGGCTCAGCGGCCAGG + Intergenic
1056612594 9:88134501-88134523 AACCCGTGGGCTCAGCGGCCAGG - Intergenic
1056613090 9:88137991-88138013 AACCCGTGGGCTCAGCGGCCAGG - Intergenic
1057160061 9:92883036-92883058 AACCCGTGGGCTCAGCGGCCAGG + Intergenic
1060561568 9:124549254-124549276 CACATGTGGTTTCATCTGCCTGG - Intronic
1203516839 Un_GL000213v1:9283-9305 AGCCAGTGGGATCGTCGGCCAGG - Intergenic
1202045850 Y:20736733-20736755 CATCAGTGGGTTTAACAGCCTGG + Intergenic