ID: 1136487476

View in Genome Browser
Species Human (GRCh38)
Location 16:30582735-30582757
Sequence CCCTGCGTGGAGTGTGGGAA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 271
Summary {0: 1, 1: 0, 2: 4, 3: 21, 4: 245}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136487476_1136487491 24 Left 1136487476 16:30582735-30582757 CCTTTCCCACACTCCACGCAGGG 0: 1
1: 0
2: 4
3: 21
4: 245
Right 1136487491 16:30582782-30582804 GCGCCGGTGACTGAGGAGGAGGG 0: 1
1: 0
2: 1
3: 15
4: 175
1136487476_1136487488 17 Left 1136487476 16:30582735-30582757 CCTTTCCCACACTCCACGCAGGG 0: 1
1: 0
2: 4
3: 21
4: 245
Right 1136487488 16:30582775-30582797 AGTGAATGCGCCGGTGACTGAGG 0: 1
1: 0
2: 0
3: 3
4: 73
1136487476_1136487485 -6 Left 1136487476 16:30582735-30582757 CCTTTCCCACACTCCACGCAGGG 0: 1
1: 0
2: 4
3: 21
4: 245
Right 1136487485 16:30582752-30582774 GCAGGGGAAGGGCCGGCTGTCGG 0: 1
1: 0
2: 2
3: 66
4: 645
1136487476_1136487490 23 Left 1136487476 16:30582735-30582757 CCTTTCCCACACTCCACGCAGGG 0: 1
1: 0
2: 4
3: 21
4: 245
Right 1136487490 16:30582781-30582803 TGCGCCGGTGACTGAGGAGGAGG 0: 1
1: 0
2: 3
3: 14
4: 144
1136487476_1136487487 8 Left 1136487476 16:30582735-30582757 CCTTTCCCACACTCCACGCAGGG 0: 1
1: 0
2: 4
3: 21
4: 245
Right 1136487487 16:30582766-30582788 GGCTGTCGGAGTGAATGCGCCGG 0: 1
1: 0
2: 0
3: 6
4: 60
1136487476_1136487489 20 Left 1136487476 16:30582735-30582757 CCTTTCCCACACTCCACGCAGGG 0: 1
1: 0
2: 4
3: 21
4: 245
Right 1136487489 16:30582778-30582800 GAATGCGCCGGTGACTGAGGAGG 0: 1
1: 0
2: 0
3: 4
4: 64

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136487476 Original CRISPR CCCTGCGTGGAGTGTGGGAA AGG (reversed) Exonic