ID: 1136487479

View in Genome Browser
Species Human (GRCh38)
Location 16:30582740-30582762
Sequence CCTTCCCCTGCGTGGAGTGT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 141}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136487479_1136487491 19 Left 1136487479 16:30582740-30582762 CCCACACTCCACGCAGGGGAAGG 0: 1
1: 0
2: 0
3: 17
4: 141
Right 1136487491 16:30582782-30582804 GCGCCGGTGACTGAGGAGGAGGG 0: 1
1: 0
2: 1
3: 15
4: 175
1136487479_1136487490 18 Left 1136487479 16:30582740-30582762 CCCACACTCCACGCAGGGGAAGG 0: 1
1: 0
2: 0
3: 17
4: 141
Right 1136487490 16:30582781-30582803 TGCGCCGGTGACTGAGGAGGAGG 0: 1
1: 0
2: 3
3: 14
4: 144
1136487479_1136487489 15 Left 1136487479 16:30582740-30582762 CCCACACTCCACGCAGGGGAAGG 0: 1
1: 0
2: 0
3: 17
4: 141
Right 1136487489 16:30582778-30582800 GAATGCGCCGGTGACTGAGGAGG 0: 1
1: 0
2: 0
3: 4
4: 64
1136487479_1136487493 28 Left 1136487479 16:30582740-30582762 CCCACACTCCACGCAGGGGAAGG 0: 1
1: 0
2: 0
3: 17
4: 141
Right 1136487493 16:30582791-30582813 ACTGAGGAGGAGGGAAGAATAGG 0: 1
1: 2
2: 3
3: 68
4: 643
1136487479_1136487488 12 Left 1136487479 16:30582740-30582762 CCCACACTCCACGCAGGGGAAGG 0: 1
1: 0
2: 0
3: 17
4: 141
Right 1136487488 16:30582775-30582797 AGTGAATGCGCCGGTGACTGAGG 0: 1
1: 0
2: 0
3: 3
4: 73
1136487479_1136487487 3 Left 1136487479 16:30582740-30582762 CCCACACTCCACGCAGGGGAAGG 0: 1
1: 0
2: 0
3: 17
4: 141
Right 1136487487 16:30582766-30582788 GGCTGTCGGAGTGAATGCGCCGG 0: 1
1: 0
2: 0
3: 6
4: 60

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136487479 Original CRISPR CCTTCCCCTGCGTGGAGTGT GGG (reversed) Exonic