ID: 1136487484

View in Genome Browser
Species Human (GRCh38)
Location 16:30582748-30582770
Sequence CAGCCGGCCCTTCCCCTGCG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 270
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 247}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136487484_1136487494 28 Left 1136487484 16:30582748-30582770 CCACGCAGGGGAAGGGCCGGCTG 0: 1
1: 0
2: 1
3: 21
4: 247
Right 1136487494 16:30582799-30582821 GGAGGGAAGAATAGGTGAAGCGG 0: 1
1: 0
2: 2
3: 73
4: 812
1136487484_1136487491 11 Left 1136487484 16:30582748-30582770 CCACGCAGGGGAAGGGCCGGCTG 0: 1
1: 0
2: 1
3: 21
4: 247
Right 1136487491 16:30582782-30582804 GCGCCGGTGACTGAGGAGGAGGG 0: 1
1: 0
2: 1
3: 15
4: 175
1136487484_1136487488 4 Left 1136487484 16:30582748-30582770 CCACGCAGGGGAAGGGCCGGCTG 0: 1
1: 0
2: 1
3: 21
4: 247
Right 1136487488 16:30582775-30582797 AGTGAATGCGCCGGTGACTGAGG 0: 1
1: 0
2: 0
3: 3
4: 73
1136487484_1136487493 20 Left 1136487484 16:30582748-30582770 CCACGCAGGGGAAGGGCCGGCTG 0: 1
1: 0
2: 1
3: 21
4: 247
Right 1136487493 16:30582791-30582813 ACTGAGGAGGAGGGAAGAATAGG 0: 1
1: 2
2: 3
3: 68
4: 643
1136487484_1136487487 -5 Left 1136487484 16:30582748-30582770 CCACGCAGGGGAAGGGCCGGCTG 0: 1
1: 0
2: 1
3: 21
4: 247
Right 1136487487 16:30582766-30582788 GGCTGTCGGAGTGAATGCGCCGG 0: 1
1: 0
2: 0
3: 6
4: 60
1136487484_1136487490 10 Left 1136487484 16:30582748-30582770 CCACGCAGGGGAAGGGCCGGCTG 0: 1
1: 0
2: 1
3: 21
4: 247
Right 1136487490 16:30582781-30582803 TGCGCCGGTGACTGAGGAGGAGG 0: 1
1: 0
2: 3
3: 14
4: 144
1136487484_1136487489 7 Left 1136487484 16:30582748-30582770 CCACGCAGGGGAAGGGCCGGCTG 0: 1
1: 0
2: 1
3: 21
4: 247
Right 1136487489 16:30582778-30582800 GAATGCGCCGGTGACTGAGGAGG 0: 1
1: 0
2: 0
3: 4
4: 64

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136487484 Original CRISPR CAGCCGGCCCTTCCCCTGCG TGG (reversed) Exonic