ID: 1136487486

View in Genome Browser
Species Human (GRCh38)
Location 16:30582764-30582786
Sequence GGCGCATTCACTCCGACAGC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 30
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 29}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136487486_1136487493 4 Left 1136487486 16:30582764-30582786 CCGGCTGTCGGAGTGAATGCGCC 0: 1
1: 0
2: 0
3: 0
4: 29
Right 1136487493 16:30582791-30582813 ACTGAGGAGGAGGGAAGAATAGG 0: 1
1: 2
2: 3
3: 68
4: 643
1136487486_1136487489 -9 Left 1136487486 16:30582764-30582786 CCGGCTGTCGGAGTGAATGCGCC 0: 1
1: 0
2: 0
3: 0
4: 29
Right 1136487489 16:30582778-30582800 GAATGCGCCGGTGACTGAGGAGG 0: 1
1: 0
2: 0
3: 4
4: 64
1136487486_1136487494 12 Left 1136487486 16:30582764-30582786 CCGGCTGTCGGAGTGAATGCGCC 0: 1
1: 0
2: 0
3: 0
4: 29
Right 1136487494 16:30582799-30582821 GGAGGGAAGAATAGGTGAAGCGG 0: 1
1: 0
2: 2
3: 73
4: 812
1136487486_1136487496 26 Left 1136487486 16:30582764-30582786 CCGGCTGTCGGAGTGAATGCGCC 0: 1
1: 0
2: 0
3: 0
4: 29
Right 1136487496 16:30582813-30582835 GTGAAGCGGCGGCCGCAGTCAGG 0: 1
1: 2
2: 4
3: 11
4: 64
1136487486_1136487495 15 Left 1136487486 16:30582764-30582786 CCGGCTGTCGGAGTGAATGCGCC 0: 1
1: 0
2: 0
3: 0
4: 29
Right 1136487495 16:30582802-30582824 GGGAAGAATAGGTGAAGCGGCGG 0: 1
1: 0
2: 1
3: 30
4: 351
1136487486_1136487490 -6 Left 1136487486 16:30582764-30582786 CCGGCTGTCGGAGTGAATGCGCC 0: 1
1: 0
2: 0
3: 0
4: 29
Right 1136487490 16:30582781-30582803 TGCGCCGGTGACTGAGGAGGAGG 0: 1
1: 0
2: 3
3: 14
4: 144
1136487486_1136487491 -5 Left 1136487486 16:30582764-30582786 CCGGCTGTCGGAGTGAATGCGCC 0: 1
1: 0
2: 0
3: 0
4: 29
Right 1136487491 16:30582782-30582804 GCGCCGGTGACTGAGGAGGAGGG 0: 1
1: 0
2: 1
3: 15
4: 175

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136487486 Original CRISPR GGCGCATTCACTCCGACAGC CGG (reversed) Exonic