ID: 1136487490

View in Genome Browser
Species Human (GRCh38)
Location 16:30582781-30582803
Sequence TGCGCCGGTGACTGAGGAGG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 3, 3: 14, 4: 144}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136487486_1136487490 -6 Left 1136487486 16:30582764-30582786 CCGGCTGTCGGAGTGAATGCGCC 0: 1
1: 0
2: 0
3: 0
4: 29
Right 1136487490 16:30582781-30582803 TGCGCCGGTGACTGAGGAGGAGG 0: 1
1: 0
2: 3
3: 14
4: 144
1136487484_1136487490 10 Left 1136487484 16:30582748-30582770 CCACGCAGGGGAAGGGCCGGCTG 0: 1
1: 0
2: 1
3: 21
4: 247
Right 1136487490 16:30582781-30582803 TGCGCCGGTGACTGAGGAGGAGG 0: 1
1: 0
2: 3
3: 14
4: 144
1136487481_1136487490 17 Left 1136487481 16:30582741-30582763 CCACACTCCACGCAGGGGAAGGG 0: 1
1: 0
2: 8
3: 26
4: 253
Right 1136487490 16:30582781-30582803 TGCGCCGGTGACTGAGGAGGAGG 0: 1
1: 0
2: 3
3: 14
4: 144
1136487479_1136487490 18 Left 1136487479 16:30582740-30582762 CCCACACTCCACGCAGGGGAAGG 0: 1
1: 0
2: 0
3: 17
4: 141
Right 1136487490 16:30582781-30582803 TGCGCCGGTGACTGAGGAGGAGG 0: 1
1: 0
2: 3
3: 14
4: 144
1136487476_1136487490 23 Left 1136487476 16:30582735-30582757 CCTTTCCCACACTCCACGCAGGG 0: 1
1: 0
2: 4
3: 21
4: 245
Right 1136487490 16:30582781-30582803 TGCGCCGGTGACTGAGGAGGAGG 0: 1
1: 0
2: 3
3: 14
4: 144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136487490 Original CRISPR TGCGCCGGTGACTGAGGAGG AGG Exonic
902614913 1:17618499-17618521 TGAGCAGGAGACAGAGGAGGAGG - Intronic
903133584 1:21294499-21294521 GGCACCGGGGACTGAGGACGGGG - Intronic
904852917 1:33472735-33472757 TGGGCTGGAGACTTAGGAGGTGG + Intronic
906226945 1:44130165-44130187 TGCGCTGGTGGCTCACGAGGTGG - Exonic
906680259 1:47721474-47721496 TGCGGAGGTGAGGGAGGAGGAGG - Intergenic
906771965 1:48493464-48493486 TGTGAAGGTGACTGAGGTGGAGG + Intergenic
908534649 1:65066751-65066773 GGCGGCGGTGCCGGAGGAGGAGG - Intergenic
910251262 1:85201122-85201144 TGCGCCCGAGCCTGAGGGGGCGG - Intergenic
912254785 1:108047552-108047574 TCCACCGGAGACTGGGGAGGGGG + Intergenic
912372947 1:109187757-109187779 TCCCCCGGGGACTGAGGGGGTGG - Intronic
915348388 1:155209362-155209384 TGCCCTGATGACTGGGGAGGGGG + Intronic
922175021 1:223190012-223190034 TGCGCTGGGGCCTCAGGAGGAGG + Intergenic
922307473 1:224356902-224356924 AGCGGCGGCGACGGAGGAGGAGG + Exonic
922314785 1:224433827-224433849 TGCGACGGTGGCTGAGGATGCGG + Exonic
922605473 1:226887377-226887399 TGAGCTGGTGACTGATGAGTTGG + Intronic
922740083 1:228009652-228009674 TGTGCCGGTGATGGTGGAGGGGG - Intronic
1063428609 10:5968410-5968432 TGCCCCTGTGACAGAGGAGAAGG - Intronic
1064230814 10:13528548-13528570 GGCGGCGGGGGCTGAGGAGGCGG + Intronic
1065589858 10:27252855-27252877 AGCGCCGGGGCCTGACGAGGAGG + Intergenic
1070321512 10:75358295-75358317 TGGCTCGGTGAGTGAGGAGGAGG - Intergenic
1070611055 10:77932857-77932879 TGCTCAGGTGACTGAGGAGGAGG + Intergenic
1071292583 10:84198138-84198160 AGCTCAGGTGACTGAGCAGGAGG - Intronic
1071532742 10:86401603-86401625 TGCGCGGGTGGCGGGGGAGGGGG - Intergenic
1072691198 10:97573213-97573235 TGCCCCAGTGACTGAGTGGGAGG + Intronic
1073607414 10:104910209-104910231 TGAGCAGGTGCCTGAGCAGGCGG + Intronic
1074541816 10:114371439-114371461 TTCGCGGGGGACTGATGAGGGGG - Intronic
1075280465 10:121134195-121134217 TGCGTGGGGGACTGAGGAGCTGG + Intergenic
1075464656 10:122642515-122642537 TGCCCCAGGGAATGAGGAGGGGG + Intronic
1075966123 10:126613344-126613366 TGCTCAGGAGACTGAGGTGGGGG - Intronic
1077907461 11:6545469-6545491 TGTGCTGGTGGCAGAGGAGGTGG + Exonic
1081973069 11:47213399-47213421 TGCTCCGGAGACTGAGGCAGGGG + Intergenic
1082833437 11:57636291-57636313 TGCTACCGTGACTGAGGAAGTGG - Intergenic
1083364444 11:62133077-62133099 TGGGGCGGTGACAGGGGAGGAGG + Intronic
1084021545 11:66420904-66420926 GGAGCCGCTGACTGGGGAGGGGG - Intergenic
1084596974 11:70122790-70122812 TGCGGCAGAGAGTGAGGAGGAGG - Intronic
1084967223 11:72751104-72751126 AGTACCGGTGACTGATGAGGTGG - Intronic
1085460287 11:76689324-76689346 TGAGCTGGTGCCAGAGGAGGAGG + Intergenic
1092111484 12:5967888-5967910 TGCACAGGTGCCTGAGGTGGGGG + Intronic
1092196415 12:6552233-6552255 TGCGGCTGTGAATGAGGAGATGG - Intronic
1092387646 12:8048235-8048257 TGTGCCTGTGGCTGTGGAGGTGG - Exonic
1092605237 12:10111522-10111544 TGAGGCGGCGGCTGAGGAGGAGG + Intronic
1102591395 12:113959233-113959255 TGGGCAGGAGAGTGAGGAGGAGG - Exonic
1105291548 13:19056676-19056698 TCCTCCTGTGACTGTGGAGGTGG - Intergenic
1106588032 13:31073890-31073912 TGGGCCTATGACTGTGGAGGTGG + Intergenic
1107851317 13:44576199-44576221 GGCGCCTTTGGCTGAGGAGGAGG - Exonic
1112379251 13:98873000-98873022 TCCACTGATGACTGAGGAGGAGG + Intronic
1113780469 13:112973898-112973920 GGGGCCAGTGACTCAGGAGGCGG - Intronic
1114683598 14:24507264-24507286 TGCACTGGGGACTGAAGAGGGGG - Intronic
1119798985 14:77425902-77425924 TGCTCCTGTGACTGTGGAGTGGG - Intergenic
1122120575 14:99551414-99551436 TGAGCAGGTGAATGAGCAGGTGG + Intronic
1122120598 14:99551566-99551588 TGTGCAGGTGAGTGAGCAGGTGG + Intronic
1122436607 14:101705664-101705686 TGCGCCGGTCACAGAGCACGGGG - Intergenic
1122543287 14:102509465-102509487 TGCGCGTGTGCCGGAGGAGGAGG + Intronic
1128313249 15:66644744-66644766 TACCCCAGTGACTGAGTAGGGGG + Intronic
1128582253 15:68818488-68818510 GGCGCGGGTGGCGGAGGAGGGGG - Intronic
1129086842 15:73102913-73102935 GGTGCCAGTCACTGAGGAGGAGG - Intronic
1132222166 15:100113098-100113120 TCCGCCGGGGACTGATGAGGGGG - Intronic
1132503985 16:297692-297714 TGCGCCTGTCAGTGAGGAGGGGG - Intronic
1132685717 16:1161289-1161311 TGAGCCGGTGGCAGAGGTGGGGG + Intronic
1133143892 16:3769291-3769313 TGCGCTGGCCACCGAGGAGGGGG + Exonic
1133221537 16:4321062-4321084 GGGGCGGGTGGCTGAGGAGGAGG + Intronic
1133787372 16:8983939-8983961 TGTGCCTGGGACTGAGGAGCAGG + Intergenic
1135043639 16:19136630-19136652 TGCCCCGAGAACTGAGGAGGAGG + Intronic
1136487490 16:30582781-30582803 TGCGCCGGTGACTGAGGAGGAGG + Exonic
1137716868 16:50603478-50603500 TGTGCCGGGGAAAGAGGAGGGGG - Intronic
1140811175 16:78579552-78579574 TGCGCCAGAGACTGCGGAAGTGG + Intronic
1141393002 16:83680357-83680379 AGGGCCGCTGACTGAGAAGGAGG + Intronic
1142112770 16:88341028-88341050 TGCTCAGGTGGCTCAGGAGGGGG - Intergenic
1144796071 17:17892137-17892159 GGCACCTGTGAATGAGGAGGAGG + Intronic
1145954112 17:28842756-28842778 TGCGCCGGTGACTGAGGGGCCGG - Exonic
1147326082 17:39670233-39670255 GGTGCCAGTGTCTGAGGAGGAGG + Exonic
1148054498 17:44786131-44786153 GCCGCCTGTGACTGAGGTGGAGG - Intergenic
1148860296 17:50601054-50601076 TGATCCGGTGACACAGGAGGCGG - Exonic
1149200683 17:54182675-54182697 AGTGAGGGTGACTGAGGAGGTGG - Intergenic
1150496397 17:65611196-65611218 TGGCCCAGTGACTGAGAAGGGGG + Intronic
1152007525 17:77691833-77691855 TGCCCGGGAGTCTGAGGAGGGGG + Intergenic
1152895878 17:82911013-82911035 CGCCCTGCTGACTGAGGAGGTGG - Intronic
1155928950 18:31685599-31685621 GGCGGCGGTGACGCAGGAGGCGG - Intronic
1160529108 18:79553280-79553302 TGCGCCGGTGAATCAGTGGGCGG - Intergenic
1160864577 19:1251107-1251129 TGCGCCGGGGAGGGAGGAGGAGG + Intronic
1161216206 19:3096060-3096082 GGCAGCGGTGACGGAGGAGGGGG + Intronic
1163586948 19:18169338-18169360 TGCGCCGGAGGCTGCGGCGGCGG + Exonic
1163633407 19:18428031-18428053 TGGGCCTGTGGCTGGGGAGGTGG + Intronic
1165231924 19:34392824-34392846 TGTGTCCGTGTCTGAGGAGGTGG + Intronic
1165231952 19:34392924-34392946 TGTGTCCGTGTCTGAGGAGGTGG + Intronic
1165473974 19:36018959-36018981 TGTGGAGGTGACAGAGGAGGGGG + Exonic
1166026510 19:40090720-40090742 TGCGCGGGTATCAGAGGAGGGGG - Intronic
1167258299 19:48443670-48443692 CGCGCCGGTGCCTGTGGTGGTGG - Exonic
1167550105 19:50154563-50154585 TCCACGGGGGACTGAGGAGGGGG + Intronic
1168115350 19:54219147-54219169 TGTGACGCTGACGGAGGAGGAGG + Exonic
1168286928 19:55339924-55339946 GGCGCGGGCGCCTGAGGAGGAGG + Exonic
927213835 2:20654854-20654876 TGCAGGGATGACTGAGGAGGAGG + Intergenic
927929158 2:27033088-27033110 GGCGCCGGCGGCCGAGGAGGCGG + Exonic
929619701 2:43342103-43342125 TGCTCAGGGGACTGAGGCGGAGG + Intronic
935301573 2:101697778-101697800 GGCGCCGGGGCCTGAGGCGGCGG + Intronic
936235641 2:110740384-110740406 TGGGCCGGTGAGTGGTGAGGTGG + Intronic
944715924 2:202376239-202376261 AGAGCCGGAGACTGAGGAGGAGG + Intergenic
947518770 2:230828569-230828591 GGCCCCGGCGACTGGGGAGGAGG + Intergenic
948468897 2:238165044-238165066 TGGGAGGGCGACTGAGGAGGGGG - Intronic
1172519792 20:35559214-35559236 TGAGCTGCTGACTGTGGAGGAGG - Intergenic
1174133016 20:48359349-48359371 TGCACCTGTGACTGAGGGGCGGG - Intergenic
1176423243 21:6532838-6532860 TGCGCCGGTCACTGCCGAGGAGG - Intergenic
1179698736 21:43141154-43141176 TGCGCCGGTCACTGCCGAGGAGG - Intergenic
1180005705 21:45019422-45019444 GGCGCCGGTGCCTGGGCAGGTGG + Intergenic
1183120686 22:35728069-35728091 TGGGCCGAGGACTTAGGAGGTGG + Intronic
1183359011 22:37373756-37373778 GGGGCCAGTGGCTGAGGAGGCGG + Exonic
1184254820 22:43280857-43280879 TGACAGGGTGACTGAGGAGGAGG - Intronic
1184254850 22:43280978-43281000 TGACAGGGTGACTGAGGAGGAGG - Intronic
1184254879 22:43281096-43281118 TGACAGGGTGACTGAGGAGGAGG - Intronic
1184254908 22:43281214-43281236 TGACAGGGTGACTGAGGAGGAGG - Intronic
1184254938 22:43281335-43281357 TGACAGGGTGACTGAGGAGGAGG - Intronic
1185094965 22:48801062-48801084 TGGGCCAGGGACTGAGGAGGGGG + Intronic
950266666 3:11578370-11578392 TGCTCCGGTGTGTGGGGAGGAGG - Intronic
952422580 3:33145194-33145216 TGTGCAGGTGAGTGAGGACGTGG - Exonic
961386062 3:126524145-126524167 GTCGCTGGGGACTGAGGAGGCGG - Intergenic
961858242 3:129893641-129893663 GGTGGCGGTGACTGAGGCGGCGG - Intergenic
968907600 4:3461893-3461915 TGCACAGGTGACTGCGGGGGTGG + Intergenic
969495821 4:7525653-7525675 GGGACAGGTGACTGAGGAGGTGG - Intronic
969587642 4:8103738-8103760 TGCCCAGGTGACAGAGGAGGGGG + Intronic
970557490 4:17249218-17249240 TACTCAGGAGACTGAGGAGGGGG + Intergenic
970942819 4:21655253-21655275 TGCCTCGGTGGCTGAGGAGATGG + Intronic
974793906 4:66723927-66723949 TGTGCCAGTGACTGTGGAGATGG + Intergenic
975823612 4:78296506-78296528 TGGGGCTGTGACTGGGGAGGAGG + Intronic
983649375 4:170023185-170023207 TGCACATGGGACTGAGGAGGCGG - Intronic
984547764 4:181127859-181127881 TTTGCTGGTGATTGAGGAGGAGG + Intergenic
985242024 4:187940712-187940734 TGTGGCTGTGAATGAGGAGGGGG - Intergenic
985652594 5:1113818-1113840 TGCTGGGGTGACTGAGGAGAGGG - Intergenic
988555218 5:32230629-32230651 TGCCCCTGTGACAGAGGAGGAGG - Intronic
995508590 5:112885429-112885451 TGCTCTGGTTACTGAAGAGGAGG + Intronic
998815868 5:146013630-146013652 TGAGCCAGTGACTGAGGAGGTGG + Intronic
999129604 5:149272465-149272487 TGCGCCAGGGAGGGAGGAGGCGG + Intronic
1004924415 6:20403549-20403571 CGCGCCTGTGACTGGGGAGGAGG + Intronic
1006548063 6:34795840-34795862 TGGGCAGGGGACTGAGGAAGAGG + Intronic
1006738290 6:36290792-36290814 TGGGCCGGTGAATCATGAGGAGG - Intronic
1007629097 6:43262951-43262973 GGTGCCGCTGGCTGAGGAGGAGG + Exonic
1008420699 6:51295858-51295880 TCTGCCCATGACTGAGGAGGGGG + Intergenic
1012450552 6:99349484-99349506 GGCGGCGGCGACTGAGGAGGCGG + Exonic
1012450556 6:99349502-99349524 GGCGGCGGCGACTGAGGAGGCGG + Exonic
1018227757 6:161645884-161645906 AGCGCAGGTGGCGGAGGAGGCGG + Intronic
1018387532 6:163318528-163318550 TGAGCCGGTCACTCAGGAGCTGG + Intergenic
1027414966 7:77964700-77964722 GGCGGTGGAGACTGAGGAGGTGG - Intergenic
1029432304 7:100539267-100539289 TGCGGAGGCGGCTGAGGAGGCGG + Exonic
1032182660 7:129694047-129694069 TGTGCTGGTGAATGAGGAGCTGG + Intronic
1034219334 7:149431961-149431983 TGCGCCGGTGTTCCAGGAGGTGG + Exonic
1034224881 7:149474560-149474582 TGCGCTGGTGCTTGCGGAGGTGG + Exonic
1034255886 7:149724525-149724547 TGAGCCGGTGACTGCCGTGGAGG + Intronic
1037567604 8:20130663-20130685 TGGGGCAGTGACTGAGGAGCTGG - Intergenic
1040478184 8:47799321-47799343 TGTGCAGGCGGCTGAGGAGGAGG - Exonic
1040581733 8:48704108-48704130 TGAGCCTGTGCCAGAGGAGGCGG - Intergenic
1047202897 8:122781536-122781558 TTCGCCGGTGTCTCCGGAGGGGG + Exonic
1049747663 8:144269847-144269869 GGCGCTGGTGAGTGAGGAGCAGG + Intronic
1049831913 8:144706036-144706058 TGCACAGGTGAGTGAGGAGGTGG + Intergenic
1057361121 9:94374664-94374686 GGCGCCGAGGGCTGAGGAGGCGG - Exonic
1057662237 9:97013488-97013510 GGCGCCGAGGGCTGAGGAGGCGG + Exonic
1059314232 9:113410467-113410489 TGCGCCGGTATTTGAGGCGGAGG - Intronic
1185474037 X:403121-403143 TGAGCCTGTGACTGAGCACGTGG + Intergenic
1186857014 X:13636379-13636401 TGGTGCAGTGACTGAGGAGGAGG - Intergenic
1190062211 X:47218899-47218921 GGCGGCGGTGGCTGAGGCGGAGG - Intronic
1191184294 X:57592771-57592793 AGCTCCGGCGCCTGAGGAGGAGG + Exonic
1191734530 X:64375240-64375262 TACTCAGGAGACTGAGGAGGTGG + Intronic
1195217668 X:102716096-102716118 TGAGCCAGGAACTGAGGAGGGGG + Exonic
1200229547 X:154437200-154437222 TGCTGCGGTGAAGGAGGAGGAGG + Exonic