ID: 1136487490

View in Genome Browser
Species Human (GRCh38)
Location 16:30582781-30582803
Sequence TGCGCCGGTGACTGAGGAGG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 3, 3: 14, 4: 144}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136487484_1136487490 10 Left 1136487484 16:30582748-30582770 CCACGCAGGGGAAGGGCCGGCTG 0: 1
1: 0
2: 1
3: 21
4: 247
Right 1136487490 16:30582781-30582803 TGCGCCGGTGACTGAGGAGGAGG 0: 1
1: 0
2: 3
3: 14
4: 144
1136487486_1136487490 -6 Left 1136487486 16:30582764-30582786 CCGGCTGTCGGAGTGAATGCGCC 0: 1
1: 0
2: 0
3: 0
4: 29
Right 1136487490 16:30582781-30582803 TGCGCCGGTGACTGAGGAGGAGG 0: 1
1: 0
2: 3
3: 14
4: 144
1136487476_1136487490 23 Left 1136487476 16:30582735-30582757 CCTTTCCCACACTCCACGCAGGG 0: 1
1: 0
2: 4
3: 21
4: 245
Right 1136487490 16:30582781-30582803 TGCGCCGGTGACTGAGGAGGAGG 0: 1
1: 0
2: 3
3: 14
4: 144
1136487481_1136487490 17 Left 1136487481 16:30582741-30582763 CCACACTCCACGCAGGGGAAGGG 0: 1
1: 0
2: 8
3: 26
4: 253
Right 1136487490 16:30582781-30582803 TGCGCCGGTGACTGAGGAGGAGG 0: 1
1: 0
2: 3
3: 14
4: 144
1136487479_1136487490 18 Left 1136487479 16:30582740-30582762 CCCACACTCCACGCAGGGGAAGG 0: 1
1: 0
2: 0
3: 17
4: 141
Right 1136487490 16:30582781-30582803 TGCGCCGGTGACTGAGGAGGAGG 0: 1
1: 0
2: 3
3: 14
4: 144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136487490 Original CRISPR TGCGCCGGTGACTGAGGAGG AGG Exonic