ID: 1136487941

View in Genome Browser
Species Human (GRCh38)
Location 16:30585330-30585352
Sequence CGGTGTCCCCAGAGGCTAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 110}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136487941_1136487953 12 Left 1136487941 16:30585330-30585352 CCCACTAGCCTCTGGGGACACCG 0: 1
1: 0
2: 1
3: 13
4: 110
Right 1136487953 16:30585365-30585387 CACCGACGGACTGGGGGTCCCGG 0: 1
1: 0
2: 1
3: 3
4: 80
1136487941_1136487950 6 Left 1136487941 16:30585330-30585352 CCCACTAGCCTCTGGGGACACCG 0: 1
1: 0
2: 1
3: 13
4: 110
Right 1136487950 16:30585359-30585381 GCTTCCCACCGACGGACTGGGGG 0: 1
1: 0
2: 0
3: 3
4: 47
1136487941_1136487955 16 Left 1136487941 16:30585330-30585352 CCCACTAGCCTCTGGGGACACCG 0: 1
1: 0
2: 1
3: 13
4: 110
Right 1136487955 16:30585369-30585391 GACGGACTGGGGGTCCCGGCCGG 0: 1
1: 0
2: 0
3: 5
4: 136
1136487941_1136487948 4 Left 1136487941 16:30585330-30585352 CCCACTAGCCTCTGGGGACACCG 0: 1
1: 0
2: 1
3: 13
4: 110
Right 1136487948 16:30585357-30585379 CCGCTTCCCACCGACGGACTGGG 0: 1
1: 0
2: 0
3: 0
4: 25
1136487941_1136487945 -2 Left 1136487941 16:30585330-30585352 CCCACTAGCCTCTGGGGACACCG 0: 1
1: 0
2: 1
3: 13
4: 110
Right 1136487945 16:30585351-30585373 CGATCACCGCTTCCCACCGACGG 0: 1
1: 0
2: 0
3: 1
4: 15
1136487941_1136487957 20 Left 1136487941 16:30585330-30585352 CCCACTAGCCTCTGGGGACACCG 0: 1
1: 0
2: 1
3: 13
4: 110
Right 1136487957 16:30585373-30585395 GACTGGGGGTCCCGGCCGGAGGG 0: 1
1: 0
2: 0
3: 9
4: 127
1136487941_1136487949 5 Left 1136487941 16:30585330-30585352 CCCACTAGCCTCTGGGGACACCG 0: 1
1: 0
2: 1
3: 13
4: 110
Right 1136487949 16:30585358-30585380 CGCTTCCCACCGACGGACTGGGG 0: 1
1: 0
2: 0
3: 4
4: 42
1136487941_1136487956 19 Left 1136487941 16:30585330-30585352 CCCACTAGCCTCTGGGGACACCG 0: 1
1: 0
2: 1
3: 13
4: 110
Right 1136487956 16:30585372-30585394 GGACTGGGGGTCCCGGCCGGAGG 0: 1
1: 0
2: 1
3: 25
4: 240
1136487941_1136487946 3 Left 1136487941 16:30585330-30585352 CCCACTAGCCTCTGGGGACACCG 0: 1
1: 0
2: 1
3: 13
4: 110
Right 1136487946 16:30585356-30585378 ACCGCTTCCCACCGACGGACTGG 0: 1
1: 0
2: 0
3: 0
4: 22
1136487941_1136487958 25 Left 1136487941 16:30585330-30585352 CCCACTAGCCTCTGGGGACACCG 0: 1
1: 0
2: 1
3: 13
4: 110
Right 1136487958 16:30585378-30585400 GGGGTCCCGGCCGGAGGGCCCGG 0: 1
1: 0
2: 1
3: 39
4: 338

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136487941 Original CRISPR CGGTGTCCCCAGAGGCTAGT GGG (reversed) Intronic
900168267 1:1253631-1253653 CGGTGTCTCCCGAGGCTCATGGG - Intergenic
902288923 1:15424260-15424282 CGCTGTTCCCAGAGACCAGTAGG + Intronic
905695982 1:39973817-39973839 CTTTGTCCTCAGAGCCTAGTTGG - Intergenic
909510384 1:76446498-76446520 CGTGGTCGCCAGAGGTTAGTAGG - Intronic
912110021 1:106329932-106329954 GGGAGTCTACAGAGGCTAGTGGG - Intergenic
915516178 1:156413887-156413909 AGGAGTCTCCAGAGGCCAGTGGG - Intronic
917664044 1:177206695-177206717 AGGAGTCCCCAGATGTTAGTAGG + Intronic
917744882 1:177997294-177997316 CCCTGTCCCCAGGAGCTAGTCGG + Intergenic
1065304430 10:24355048-24355070 GGCTGTCTCCAGAGGTTAGTAGG + Intronic
1067714083 10:48673093-48673115 AGGTGGCCCCAGAGGCTGCTTGG - Intergenic
1068681886 10:59828872-59828894 CTTTTTCCCCAGACGCTAGTGGG - Intronic
1070510555 10:77156956-77156978 CAGTCTCCCCAAAGGCTAGGAGG - Intronic
1074478429 10:113795070-113795092 CGGGGTCCCCAGCAGTTAGTGGG + Intergenic
1076255192 10:129017648-129017670 CTGAGTCCCCAGAGGCTACAGGG - Intergenic
1076407253 10:130220787-130220809 CTGTGTCCCCCGTGGCTAGCAGG - Intergenic
1077090940 11:777889-777911 GGGTGTCCCCGGAGACTAGGAGG + Intronic
1081465321 11:43311653-43311675 CGGTGGCACTAGAGGCTAGTGGG - Intergenic
1081818645 11:45969066-45969088 CCTTCTCCCCAGAGGCTATTTGG + Intronic
1083832575 11:65242155-65242177 CAGTGTCCCCAGGGGCTCCTGGG - Intergenic
1084377943 11:68791275-68791297 CAGTGTCCCCAAAGGGAAGTGGG - Intronic
1084470065 11:69354131-69354153 TGGTGTCGTCAGGGGCTAGTGGG + Intronic
1086745790 11:90425188-90425210 GGGAGTCCCCAGAGGCAAGATGG + Intergenic
1091300072 11:134502057-134502079 CGGGGTCTCCAGAGCCTAGGAGG + Intergenic
1091381928 12:67295-67317 TTGTGTCCCCAGATGCTTGTGGG - Exonic
1091683956 12:2548307-2548329 TGGTGCTCCCAGAGCCTAGTAGG + Intronic
1092971255 12:13697422-13697444 AGGTGTTCCCAAAAGCTAGTAGG - Intronic
1097279445 12:57835558-57835580 GGGTGTCCGCAGAGGGTAGCAGG - Intronic
1102076585 12:110064861-110064883 CGGTATCCCCAGTGGCCTGTGGG + Intronic
1103133232 12:118486488-118486510 CCGTGTCCCCAAAGGCAAGTTGG + Intergenic
1103903723 12:124316634-124316656 GAGTGTCCCCAGAGGCTGCTGGG + Intergenic
1104225070 12:126823558-126823580 CAGTGTCCCCAGTGTCTATTGGG + Intergenic
1105303002 13:19152029-19152051 CGGTGGCCCCAGAGGCGGCTGGG - Intergenic
1110707324 13:78609766-78609788 CGGAGTCCCCAGAGGCTCTTGGG - Intergenic
1112103726 13:96218177-96218199 CTGTGTCCCCAGAGAGAAGTGGG + Intronic
1121728995 14:96173383-96173405 CTGTGTCCCCAGTGCCTAGAAGG - Intergenic
1122133768 14:99620820-99620842 GGGTGTCCCCAGAGGGAAATGGG - Intergenic
1125476951 15:40054196-40054218 TGCTGTCCCCAGAGGCTAGTGGG - Intergenic
1125814848 15:42575596-42575618 CGGCGTCCCCAGAGGCGCGTGGG + Intergenic
1126745892 15:51826256-51826278 CTGTGTCCCAAGAGGAGAGTAGG + Intergenic
1128558234 15:68646248-68646270 CGGAGTCCCCAGAGGCCCGTGGG + Intronic
1129115353 15:73362625-73362647 CAGTGTCCCCAGGGCCTTGTGGG - Intronic
1130894405 15:88159071-88159093 CAGGGTCCCCAAAGGCTGGTGGG + Intronic
1135742142 16:24985069-24985091 CTGTGTCCCCAGAGGACATTTGG + Intronic
1136487941 16:30585330-30585352 CGGTGTCCCCAGAGGCTAGTGGG - Intronic
1136565176 16:31065470-31065492 AGGTGTGCCCAGAGGCTAGGGGG + Intronic
1139438914 16:66954129-66954151 CGGTGCCCCGAGAGGCAAGTTGG - Intergenic
1141335183 16:83147772-83147794 CTGTGACCCCAGAGACCAGTGGG - Intronic
1141413902 16:83855352-83855374 CGGTTTCCCCAGGGGATGGTGGG - Intergenic
1141425206 16:83940379-83940401 CTGTGTCCCCAGAGCCCAGCAGG - Intronic
1142215882 16:88829603-88829625 CTGTGTCCCCAGCAGCCAGTGGG - Intronic
1142441788 16:90103188-90103210 CGGTCTGCCCAGAGGCCAGCAGG + Intergenic
1143473673 17:7191483-7191505 CTGTGGCCCCAGAGGATATTGGG - Intronic
1144052008 17:11504896-11504918 CTGTGTCCCAAGAGGCAACTGGG + Intronic
1148840764 17:50495401-50495423 CTGTGTCCCCCGAAGCCAGTTGG + Intergenic
1151960816 17:77404747-77404769 CTGAGTAGCCAGAGGCTAGTGGG + Intronic
1152595001 17:81233648-81233670 CGGGGTCCCCAGAGGCTGGGAGG + Exonic
1157158605 18:45291561-45291583 CAGTGTCCTCAGAGGCAAGAGGG + Intronic
1160718112 19:585543-585565 CGGTTTCCCCAGAGGTGAGATGG + Intergenic
1161374814 19:3933858-3933880 CGGTGTCCCCAGTGGGAAGGGGG + Intronic
1162315929 19:9937821-9937843 GGGTCTCCCCAGACGCTGGTGGG + Intergenic
1163832712 19:19554657-19554679 GGGTGTCCCCAAAGGCAAGAAGG + Intergenic
1164705211 19:30314526-30314548 CCGTGTTCCCAGAGCCTTGTAGG + Intronic
1165138967 19:33687932-33687954 CTGTGGCCTCAGAGGCTACTGGG + Intronic
1167433331 19:49465391-49465413 TAGGGTACCCAGAGGCTAGTGGG + Intronic
926425361 2:12734697-12734719 CTGTCTCCCCAGTGCCTAGTTGG + Intronic
926697793 2:15782782-15782804 CGGGGTACCCAGAGGCTGCTTGG + Intergenic
927953569 2:27191215-27191237 GTGTGTCAGCAGAGGCTAGTGGG + Intergenic
931187611 2:59968687-59968709 AGGTCTCCCCAGAGGGTTGTAGG + Intergenic
935480137 2:103576794-103576816 AGTGGTCCCCAGTGGCTAGTGGG - Intergenic
935654602 2:105411100-105411122 CTGTGTCCACAGAGGCTCGCTGG - Intronic
935718759 2:105961085-105961107 CTGCGTCCCCAGTGCCTAGTGGG + Intergenic
937260122 2:120580083-120580105 CGCTGTCCCCAGAGGAAGGTGGG + Intergenic
938119339 2:128622833-128622855 CTGTGTCCCCAGTGGCTAGCAGG - Intergenic
941125628 2:161580221-161580243 CAGTGTCCCCAGAAGCTGGTGGG - Intronic
944314112 2:198267130-198267152 CAGTCTCCCCAGAGGCTTGAAGG + Intronic
947712358 2:232323423-232323445 GGAAGTCCCCAGAGGCTAGATGG - Intronic
947719745 2:232363238-232363260 GGAAGTCCCCAGAGGCTAGGTGG - Intergenic
948595438 2:239076603-239076625 CGGAGTCCCCAGAGGCTTGCCGG - Intronic
1170572912 20:17642442-17642464 AGGTGTGCCCTGAGGCCAGTGGG - Intronic
1172838293 20:37886849-37886871 CTTTGTCCCCAGAGTCTAGCAGG - Intergenic
1176240299 20:64072821-64072843 CGGGGTCCCCAGAGGCAGGCTGG - Intergenic
1177152911 21:17472576-17472598 CGGAGTTCCCAGAGGATAGAAGG - Intergenic
1179668866 21:42931490-42931512 CAGTCTCCCCAGAGGCTTGCAGG - Intergenic
1180655706 22:17418972-17418994 CAGTGTCCCCTGAGGCGAGGCGG - Intronic
1181571756 22:23771765-23771787 AGGGGTCCCCAGGGGCTTGTTGG + Intronic
1183780144 22:39994560-39994582 CGGCGGCCCCAGAGGCCACTGGG + Intergenic
1184857108 22:47152344-47152366 CGGTGCCCCCAGGGGCCAGGGGG - Intronic
949119207 3:365414-365436 CAGTGTCTCCAGAGCCTAGAAGG - Intronic
953494525 3:43374578-43374600 AGGTGACCCCAGTGGATAGTTGG - Intronic
954697437 3:52435282-52435304 GGGTGTGCCCAGAGGCAAGAGGG - Exonic
962349163 3:134644292-134644314 AGTTGTCCTCAGAGCCTAGTGGG + Intronic
968362053 3:198154155-198154177 CGGTCTGCCCAGAGGCCAGCAGG + Intergenic
969285094 4:6198099-6198121 CCGTGTCCCCAGTCTCTAGTGGG + Intronic
969717550 4:8875107-8875129 CGGTGTCCCCAGTGCCTCGCTGG + Intergenic
971606250 4:28661618-28661640 CTGTATCCCCAGAGGGGAGTAGG - Intergenic
973934781 4:55832872-55832894 CTGTATCCTCAGAGCCTAGTGGG - Intergenic
984113682 4:175650842-175650864 CAGTGTCCCCAGGTGTTAGTAGG + Intronic
986826581 5:11528869-11528891 AGGTGGCCCCAGAGGCTGCTGGG + Intronic
990010231 5:50988874-50988896 TGGTGTCCCCAGAATCTACTTGG - Intergenic
996836754 5:127802165-127802187 CAATGTCCCTAGAGTCTAGTGGG - Intergenic
1003784313 6:9467138-9467160 AGGTGTACCCAGAGCCCAGTAGG - Intergenic
1003861853 6:10329743-10329765 AGGTGACCCCAGAGCCTTGTTGG + Intergenic
1006339287 6:33437799-33437821 CGGTGTCCCCAGAGGCAGAGCGG - Exonic
1014330380 6:120056246-120056268 CAGTCTACCCAAAGGCTAGTTGG + Intergenic
1019253627 7:34552-34574 CGGTCTGCCCAGAGGCCAGCAGG - Intergenic
1025789921 7:64679948-64679970 CGCTGTCGCCAGAGGGTGGTAGG - Intronic
1026944539 7:74307243-74307265 CGCTGTCCCCAGAGGCCAGGGGG + Intronic
1027151915 7:75739135-75739157 CGAGGCCCCGAGAGGCTAGTCGG - Intergenic
1040779147 8:51086395-51086417 CAGTGTTCACAGAGGCTAGTGGG - Intergenic
1047766326 8:127992855-127992877 CGGTGTCACCAAAGGCCAGGAGG - Intergenic
1049673617 8:143880236-143880258 AGGTGTCCCCAGAGGTCACTGGG - Intergenic
1052367788 9:27632513-27632535 CGGTTTCACCAGAGGCTTGACGG + Intergenic
1054768866 9:69066546-69066568 CTGAGGCCACAGAGGCTAGTTGG - Intronic
1054808235 9:69412919-69412941 TGGAGTCCCCATAGGCTACTGGG - Intergenic
1059419385 9:114181532-114181554 CAGTGTGCCTAGAGGCTGGTGGG + Intronic
1059535147 9:115073738-115073760 CAGTCTCCCCACAGGCCAGTGGG - Exonic
1061720070 9:132546037-132546059 CCTTGTCCCCAGAGGCCAGCAGG + Intronic
1061848276 9:133400326-133400348 CAGGGCCCCCAGAGGCTGGTAGG - Intronic
1062098819 9:134717371-134717393 CGCTGGCCCCAGAGGCTGCTGGG - Intronic
1062648552 9:137563669-137563691 GGGTGGCCCGAGAGGCTGGTGGG + Intronic
1062746741 9:138217817-138217839 CGGTCTGCCCAGAGGCCAGCAGG + Intergenic
1203686758 Un_GL000214v1:1898-1920 AGCTGTCCTCAGAGGCTATTAGG - Intergenic
1203649517 Un_KI270751v1:102155-102177 AGCTGTCCTCAGAGGCTATTAGG + Intergenic
1187283957 X:17884937-17884959 CTCTGTTCCCAGTGGCTAGTGGG + Intergenic
1199972645 X:152872295-152872317 CAGTGTCCCCACAGCATAGTGGG + Intergenic