ID: 1136491423

View in Genome Browser
Species Human (GRCh38)
Location 16:30610709-30610731
Sequence TTATCCTGAGTTCCTTTTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 195
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 182}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136491422_1136491423 -6 Left 1136491422 16:30610692-30610714 CCGAGTTAGAGCTGAGATTATCC 0: 1
1: 0
2: 0
3: 6
4: 96
Right 1136491423 16:30610709-30610731 TTATCCTGAGTTCCTTTTACTGG 0: 1
1: 0
2: 1
3: 11
4: 182
1136491421_1136491423 3 Left 1136491421 16:30610683-30610705 CCACTCTGGCCGAGTTAGAGCTG 0: 1
1: 0
2: 1
3: 8
4: 90
Right 1136491423 16:30610709-30610731 TTATCCTGAGTTCCTTTTACTGG 0: 1
1: 0
2: 1
3: 11
4: 182

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136491423 Original CRISPR TTATCCTGAGTTCCTTTTAC TGG Intronic
900795794 1:4707586-4707608 TAATCCTGCCTTCCTTTTAAAGG + Intronic
907498405 1:54860638-54860660 TCATCCTTGGTTCCTTTCACCGG + Intronic
909340170 1:74522833-74522855 TAATCTTGAATTCCTTCTACAGG - Intronic
909355564 1:74705060-74705082 TTATCCACTGTTTCTTTTACAGG - Intergenic
910150564 1:84138092-84138114 GGAGCCTTAGTTCCTTTTACTGG - Intronic
911458559 1:98159653-98159675 TTCTTCTGGGTCCCTTTTACTGG - Intergenic
913705282 1:121415358-121415380 TTCTCTTGAATTCCTTTTTCAGG + Intergenic
914794681 1:150910040-150910062 TTATGTTGAGTTCCTTCTTCAGG - Intergenic
915790849 1:158669355-158669377 TTATCAGGAGTTCCTTTCATTGG - Intronic
917442993 1:175083339-175083361 TTATCCTGAGGTCGTCTTAGAGG + Intronic
917566891 1:176221618-176221640 TTCTCATGTGTTCCTTTTTCAGG + Intergenic
918356635 1:183711051-183711073 TTATCCTGAGCTCCTGCTCCTGG + Intronic
919579017 1:199348300-199348322 TTTTCCTCAGTTTCTTTTGCAGG - Intergenic
922396371 1:225205295-225205317 TTCTCTTGAGCTCCTTTTTCAGG - Intronic
923602528 1:235415723-235415745 TTATTCTGAGTTTTTTTTAATGG - Intronic
923950476 1:238945999-238946021 TTATTCTCAGTTCCCTTTATTGG + Intergenic
924358017 1:243204628-243204650 TTCTCCTTAGTCTCTTTTACTGG + Intronic
1063115613 10:3069236-3069258 TGATGCTGGGGTCCTTTTACTGG - Intronic
1065331791 10:24609513-24609535 TTATAATAAATTCCTTTTACTGG + Intronic
1065411916 10:25438746-25438768 ATATCCTGAGTTCCTACGACAGG - Intronic
1068941466 10:62684987-62685009 TTCTCCTGAGCACCTTTTCCAGG - Intergenic
1071064586 10:81615384-81615406 TTTTTCTGAGTTCTTTGTACTGG - Intergenic
1073568947 10:104559809-104559831 CTCTCCTGAGTTCCTGCTACTGG + Intergenic
1075063764 10:119275023-119275045 CTATCATGAGCTCATTTTACAGG - Intronic
1081023290 11:37974411-37974433 TGATCCAAAGTACCTTTTACTGG - Intergenic
1086305373 11:85473840-85473862 TTATTCTTTCTTCCTTTTACTGG - Intronic
1086609790 11:88741975-88741997 TTTTCATGAATTTCTTTTACTGG - Intronic
1091140321 11:133228850-133228872 TTAAACTGATTTCCTTTTCCTGG - Intronic
1095635607 12:44429619-44429641 TTATCCTCAGTCTCCTTTACTGG - Intergenic
1098054823 12:66493855-66493877 TAAACCTGTGTTCCTTTTCCTGG + Intronic
1098194005 12:67980116-67980138 ATATACTGATTTCCTTTTATTGG - Intergenic
1098596919 12:72283990-72284012 TTATACTGAGTACCTAATACAGG + Intronic
1098739441 12:74153546-74153568 TTTCCTTCAGTTCCTTTTACAGG + Intergenic
1099477502 12:83125013-83125035 TTCTTCTTAGTTCCTTTTCCAGG - Intronic
1099763947 12:86958551-86958573 TTTTCCTGTCTTCCTTTTAGTGG + Intergenic
1102563228 12:113777614-113777636 GTGTCCTGAGTTCCTGTGACTGG + Intergenic
1104222437 12:126797897-126797919 TTTTCCTGTGTGCCTTTCACAGG - Intergenic
1104523063 12:129493433-129493455 TTCTCCTGACTTACTTTTAATGG - Intronic
1108735639 13:53280918-53280940 GTTTCCTGAGTTCCTATTAAAGG - Intergenic
1108752072 13:53457973-53457995 TTATCTTGAGTTCCTTCTTCAGG - Intergenic
1108828280 13:54442907-54442929 ATATCCAGAGTTCCTATAACTGG - Intergenic
1110455251 13:75684088-75684110 TTATCCTGAACTCGTTTTTCAGG + Intronic
1110916530 13:81028252-81028274 TTTTCCTGTCTTCCTTTTAGGGG + Intergenic
1111106624 13:83653558-83653580 TTTTCCTGACTGCCTTTTATAGG + Intergenic
1114839774 14:26249468-26249490 TTATTCTGAGTTCTGTTTACAGG + Intergenic
1120485452 14:85108185-85108207 CTATCCTAAGTTGATTTTACAGG - Intergenic
1121834817 14:97082475-97082497 TTAACTTTATTTCCTTTTACAGG + Intergenic
1122307512 14:100775311-100775333 ATAGGCTGAGTTCCTTTAACTGG + Intergenic
1123806852 15:23882547-23882569 GGAGCCTCAGTTCCTTTTACTGG + Intergenic
1124060099 15:26283412-26283434 ATATTCTGAGTTCCTTTTTTTGG - Intergenic
1124645683 15:31436299-31436321 TCACCCTGAGTTCCTCCTACTGG - Intergenic
1125899601 15:43332742-43332764 TTATTCTGAGTTCCCTTTTGGGG + Intronic
1127014003 15:54662764-54662786 CGATCCTAAGCTCCTTTTACAGG + Intergenic
1128093356 15:64933948-64933970 CCATAATGAGTTCCTTTTACTGG + Intronic
1130957995 15:88640568-88640590 TTATCCTTCTTTTCTTTTACTGG - Intronic
1131535977 15:93238417-93238439 TTATACTGACTTCCTTTATCAGG - Intergenic
1132261771 15:100432039-100432061 TACTCCTGAGTTCCTTTAATAGG + Intronic
1135903729 16:26491011-26491033 TTATCCTGAGTTCTTTCCAGAGG - Intergenic
1136129795 16:28212262-28212284 TTTTAGTGAGTGCCTTTTACGGG + Intergenic
1136491423 16:30610709-30610731 TTATCCTGAGTTCCTTTTACTGG + Intronic
1137233552 16:46592895-46592917 TTTTTCTGAGTTCCTTTCTCAGG - Intronic
1137622492 16:49885344-49885366 TTATCCCCAGTTCCTGATACTGG + Intergenic
1137819862 16:51433812-51433834 CTACCCTGAGTTCCTTTTCTTGG - Intergenic
1139176456 16:64695118-64695140 TGATCATGAGTTTCTTTTTCAGG - Intergenic
1143874969 17:9984746-9984768 TTATCCTAAGTGCTTTGTACAGG - Intronic
1147972537 17:44227145-44227167 AGTTCCTGAGTACCTTTTACAGG - Intergenic
1149652031 17:58281581-58281603 TTATCCAGGGTTCCTTTGAAAGG + Intergenic
1154192516 18:12242729-12242751 GCATCCTGAATTCCTTTTGCAGG + Intergenic
1155600238 18:27537559-27537581 TGATCCTTGGTTCCTTTTATTGG - Intergenic
1156554429 18:38050994-38051016 TTATCCTGCATTTCTTTTATGGG + Intergenic
1159497860 18:69229282-69229304 ATTTCCTGAGTGACTTTTACAGG + Intergenic
1159611330 18:70528505-70528527 TTCTCCTGCCTTCCTTTTCCAGG - Intergenic
1159994186 18:74946877-74946899 TTTTACTGAATTCCTTTTAGAGG + Intronic
1165674072 19:37706354-37706376 TTCACCTCAGTTCCTATTACAGG - Intronic
1166879176 19:45916721-45916743 ATATCCTGTGTTCCTCTTCCTGG - Intergenic
926768492 2:16346748-16346770 TTGTCCTCACTTCCTTTTTCTGG - Intergenic
930057952 2:47266353-47266375 TTTTCATGAGATCCTTCTACTGG + Intergenic
933037249 2:77415674-77415696 TCCTCTTGAATTCCTTTTACAGG + Intronic
933186127 2:79280995-79281017 TTTTCCTGAGTTCCTGCTCCTGG + Intronic
934043408 2:88148511-88148533 TTATTTTGAATTCCTTTTTCAGG - Intergenic
934140744 2:89044934-89044956 TTAATCTGAGTTCTTTTTTCAGG + Intergenic
934228492 2:90155608-90155630 TTAATCTGAGTTCTTTTTTCAGG - Intergenic
935388016 2:102521661-102521683 TTGTCCTGAGTTGCATTTTCAGG - Intronic
939298949 2:140307617-140307639 TTATCCTTAGTTCCCATTAAAGG + Intronic
941875125 2:170424213-170424235 TCTTCCTGAGTTCCTTTTCCAGG + Intronic
942208706 2:173649285-173649307 TTTTCTTGAGTTCCTTTGACAGG + Intergenic
943662112 2:190570407-190570429 TTCTCCAGAGTTCTTTTTACAGG - Intergenic
945513394 2:210730895-210730917 TTATCCTTAGTTCTTTTTACAGG + Intergenic
945812704 2:214568147-214568169 TTATCATGATCTCCTTTCACAGG - Intronic
949071966 2:242030762-242030784 TTGTCTTGAGTTCCTTTCTCAGG - Intergenic
1169042984 20:2511034-2511056 TTGTCCTGAGTTCCTTTCTCAGG - Intronic
1170608527 20:17892876-17892898 TTATGCTGATTTCCTTTTTTGGG - Intergenic
1172740194 20:37160639-37160661 TTATTCTGAGTTACTTGTCCCGG + Intronic
1172864928 20:38088641-38088663 TTATCAAGAGTACCTTTTTCCGG + Intronic
1173061570 20:39666745-39666767 AAATCCAGAGTTCCTATTACAGG + Intergenic
1174382362 20:50164271-50164293 TTATACTGAGAACCTTTTTCTGG + Intergenic
1174801321 20:53565361-53565383 GGATCCTGGGTTCCTTTTATGGG - Intergenic
1177052972 21:16262166-16262188 TTATGCAGAGTTCCTGTTAGTGG + Intergenic
1177201276 21:17959058-17959080 TTTTCCTTATTTCCTTTTAGCGG - Intronic
1180326819 22:11437139-11437161 TTATCCTGATTTCCGAATACAGG + Intergenic
1182336038 22:29584121-29584143 TTTTCCTGAGTGGCTTTGACTGG - Intergenic
950402823 3:12783309-12783331 GTATCCCTGGTTCCTTTTACTGG - Intergenic
951839079 3:27014190-27014212 TTTTCCTGACTTCATGTTACAGG + Intergenic
956494185 3:69806593-69806615 TTAGCCTGAGTTCTTAGTACTGG - Intronic
956690852 3:71876560-71876582 TTAAACTGAGTTCCCTTTGCTGG + Intergenic
957234261 3:77564649-77564671 TTGGCCTCTGTTCCTTTTACAGG + Intronic
960088051 3:113611651-113611673 TTATCCAGTGGTCTTTTTACAGG - Intronic
962109535 3:132429669-132429691 TTATCCTGATTTCCATTTTGAGG + Intronic
963291602 3:143495748-143495770 TTAGCTTCAGTTTCTTTTACAGG - Intronic
967233191 3:187360325-187360347 TTCTCCTGAGTTCCTTCTGATGG - Intergenic
967413651 3:189193876-189193898 TTATTTTGAATTCCTTTTCCTGG + Intronic
968326948 3:197826023-197826045 TTCTTCTGAGTTCCTTTTTTTGG + Intronic
969877208 4:10144618-10144640 TTATTCTGAGCTCCTTTGCCTGG - Intergenic
970870324 4:20809669-20809691 TTATCCTGTTTTCCTATTATAGG + Intronic
973848887 4:54941473-54941495 TGATCCTTATTTCATTTTACTGG - Intergenic
974403545 4:61436102-61436124 TAATACAGAGTTCCTTTTGCAGG + Intronic
974882220 4:67773960-67773982 ATTTCTTGAGTTCCTTTTATGGG - Intergenic
975543763 4:75540719-75540741 TTATGTTGAGTACATTTTACTGG - Intronic
977860028 4:101945984-101946006 ATATCCTGTGTTACTTTTAAAGG - Intronic
979243794 4:118474854-118474876 TTCTCCTTAGTCTCTTTTACTGG - Intergenic
979374049 4:119923376-119923398 TTTTCCTATGTTTCTTTTACAGG - Intergenic
979445990 4:120812269-120812291 ATATACTGATTTCCTTTCACTGG + Intronic
979598657 4:122562098-122562120 TTATCCTGAATTCCTTTATTTGG + Intergenic
981236393 4:142420766-142420788 TTCTCCTTTGTTCCTATTACAGG - Intronic
983007438 4:162501248-162501270 TTATCCACAGTTCTTTTTACCGG - Intergenic
984272385 4:177563105-177563127 TCATCCTGAGAGCCCTTTACAGG + Intergenic
984344115 4:178499157-178499179 AAATCCTAGGTTCCTTTTACTGG + Intergenic
984344680 4:178507376-178507398 TCTTCCTGAGTTCATTTCACTGG - Intergenic
985198605 4:187460484-187460506 TTATCCTGTTTTCCTTTAGCCGG - Intergenic
985283184 4:188307068-188307090 CTTACCTGAGTTCCTTTAACAGG - Intergenic
985298702 4:188463857-188463879 TTTTTCTGAGTTCCTTCTTCAGG + Intergenic
988133758 5:27140915-27140937 TTATCCTCAGTTACTTTTTCTGG + Intergenic
988150643 5:27374254-27374276 TTTTGCTGAATTCTTTTTACTGG - Intergenic
993656608 5:90585572-90585594 TTAGCCTGAGGTCATTTTAAAGG + Intronic
994571477 5:101520365-101520387 TTTACATGAGTTCCTTTCACAGG + Intergenic
998528336 5:142862718-142862740 TTGTCCTGAATTCCATTTATTGG + Intronic
1000295506 5:159909881-159909903 TTTTCCTGAATTCCTTATAGGGG - Intergenic
1000568416 5:162880820-162880842 TTAACCTGAGTTCCTTCCTCAGG - Intergenic
1000809855 5:165847513-165847535 CTATACTGAGTTCATTTCACTGG - Intergenic
1002790265 6:432354-432376 TTCTCCTGTGGTCTTTTTACAGG - Intergenic
1002874048 6:1195417-1195439 TTATTTTGAGTTTCATTTACTGG - Intergenic
1004180299 6:13375594-13375616 CCATCCTGACTTCCTTTCACTGG - Intronic
1005279363 6:24256103-24256125 TTATGCTTGGTTTCTTTTACTGG - Intronic
1005654998 6:27926832-27926854 GGATCCTTGGTTCCTTTTACTGG + Intergenic
1006412224 6:33880731-33880753 TTGTCCTGGGTTGCTTATACTGG + Intergenic
1006992758 6:38229453-38229475 TTATCCCTAGTTCCTTTAATTGG + Intronic
1008102927 6:47412150-47412172 TTTTTCTGAGTGCCTTTTTCTGG - Intergenic
1009451947 6:63811556-63811578 TGATCATGAGTACCGTTTACAGG + Intronic
1010419546 6:75656331-75656353 TTATGCTGAATCCCTCTTACAGG - Intronic
1012297287 6:97540927-97540949 TTATCAGGAGTATCTTTTACTGG - Intergenic
1014909035 6:127066928-127066950 TTATTGTGAGTTCATCTTACTGG + Intergenic
1015413551 6:132922148-132922170 ATATCCTGATTTCCTTTTTTTGG + Intergenic
1020927622 7:14352214-14352236 TTAACCTGAATTACTTTTACAGG + Intronic
1020982194 7:15084857-15084879 ACATACTGTGTTCCTTTTACAGG - Intergenic
1021266131 7:18525142-18525164 GTTTCCTCAGTTGCTTTTACAGG + Intronic
1022062535 7:26812265-26812287 ATATCCTAAGGTCCTTTTACTGG + Intronic
1022079938 7:27009669-27009691 TTATGCTGTCTTCCTTCTACAGG - Intergenic
1022527340 7:31046852-31046874 TTATCCTGAGCTGCTTTTCTGGG + Intergenic
1023198923 7:37672508-37672530 TTAGCCTTAATTCCTTTTAGTGG - Intergenic
1024780586 7:52843446-52843468 TTTTTCTGGATTCCTTTTACAGG + Intergenic
1030318161 7:108137497-108137519 TTCTCCTGCCTTCCTTTTACAGG + Intergenic
1033002335 7:137520552-137520574 TTACCCTCATTTCCTTTTATAGG - Intronic
1036125882 8:6061631-6061653 TTATCCTGAGTGCTCTTTCCAGG - Intergenic
1037747370 8:21657533-21657555 TGATCCTTTATTCCTTTTACTGG + Intergenic
1037973925 8:23196038-23196060 TTTATCTGAGTTCCTTTTTCAGG + Intronic
1040046864 8:42973217-42973239 TTATCCTTATTTTCTTCTACAGG - Intronic
1040821896 8:51569188-51569210 TTTACCTCAGTTCCTGTTACAGG - Intronic
1042732072 8:71947193-71947215 TTTTCCTGAGTCTCTTTTAAAGG + Intronic
1042765267 8:72314359-72314381 TTAGCATTAGTTCCTTCTACTGG - Intergenic
1044743311 8:95349422-95349444 TTATCCTGCATTCCTGGTACAGG - Intergenic
1046170462 8:110498465-110498487 TTAACTTGATTTCATTTTACAGG + Intergenic
1046616446 8:116482788-116482810 TTATCAAGAGCTACTTTTACGGG - Intergenic
1047455411 8:125004973-125004995 TTGTCCTGAGTCACTTTTAATGG + Intronic
1050409959 9:5353541-5353563 TTATCCTGACAGCCTTTCACAGG + Intergenic
1051994983 9:23203996-23204018 TTAATCTGAGTTCCTTTTGTGGG - Intergenic
1053453636 9:38213979-38214001 CTATCCTGGGTTCCCTTTTCTGG - Intergenic
1054710384 9:68505082-68505104 TTATCCTGCTTTGCTTTTGCAGG + Intronic
1054944203 9:70777382-70777404 TTATCCAGAGTTTCTTCTTCAGG - Intronic
1055090182 9:72356456-72356478 TTATCCTGCGTTGCATCTACAGG - Intronic
1056894097 9:90524851-90524873 TTCTCCTCAGTTCCACTTACCGG + Intergenic
1057030942 9:91774823-91774845 TTATCTTGACTTCCTTCTTCAGG - Intronic
1057715564 9:97492692-97492714 ATGTCCTGAGTTCCTTTTCTAGG + Intronic
1059334543 9:113560570-113560592 GTATCCTTAGTTCCTAGTACCGG + Intronic
1060892744 9:127198993-127199015 TTGACCTGTGTTCCTTTTCCAGG + Exonic
1187720985 X:22150622-22150644 GTATCCTGAATTTATTTTACAGG + Intronic
1188178152 X:27020242-27020264 TTTTTCTAAGTTCCTTTTAGAGG - Intergenic
1188906877 X:35800702-35800724 TTATCCTGAGTTCACTGAACAGG - Intronic
1189094761 X:38126478-38126500 TTCACCAGAGTACCTTTTACTGG - Intronic
1191078519 X:56483768-56483790 TTGTCTTGAGTTCTGTTTACGGG + Intergenic
1195223065 X:102765119-102765141 TTATTCTGAGATCCTGTTATTGG - Intergenic
1196619195 X:117803204-117803226 TAAGCCTTAGTTCCTATTACAGG - Intergenic
1199100522 X:143794114-143794136 TTATCATGGATTCCCTTTACTGG + Intergenic
1199339105 X:146655209-146655231 ATTTCTTGAGTTCCTTTTATGGG + Intergenic
1199360855 X:146916578-146916600 TCGTCCTCAGTTACTTTTACAGG - Intergenic
1200300020 X:154964252-154964274 GTATTTTGAGTTACTTTTACTGG - Intronic