ID: 1136497473

View in Genome Browser
Species Human (GRCh38)
Location 16:30653008-30653030
Sequence TTTTGTGAAGGGCCCTCCTC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 125}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136497473_1136497482 9 Left 1136497473 16:30653008-30653030 CCAGAGGAGGGCCCTTCACAAAA 0: 1
1: 0
2: 1
3: 15
4: 125
Right 1136497482 16:30653040-30653062 GGCCCCCCAGCCCACCCTGGTGG 0: 1
1: 1
2: 5
3: 61
4: 449
1136497473_1136497488 18 Left 1136497473 16:30653008-30653030 CCAGAGGAGGGCCCTTCACAAAA 0: 1
1: 0
2: 1
3: 15
4: 125
Right 1136497488 16:30653049-30653071 GCCCACCCTGGTGGTGATGCTGG 0: 1
1: 0
2: 0
3: 24
4: 203
1136497473_1136497481 6 Left 1136497473 16:30653008-30653030 CCAGAGGAGGGCCCTTCACAAAA 0: 1
1: 0
2: 1
3: 15
4: 125
Right 1136497481 16:30653037-30653059 CCGGGCCCCCCAGCCCACCCTGG 0: 1
1: 0
2: 4
3: 98
4: 695

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136497473 Original CRISPR TTTTGTGAAGGGCCCTCCTC TGG (reversed) Exonic
902275837 1:15338635-15338657 TGTTCTGAAGCGCCCTCCCCCGG + Intronic
903125087 1:21242364-21242386 TTTTGTGAATGGCCTTCATTCGG - Intronic
906256689 1:44355789-44355811 ATTTGTGAAGGGCCGTCCTAAGG + Intergenic
907537767 1:55180451-55180473 TCATGTGAAGGCTCCTCCTCTGG - Intronic
909295333 1:73940409-73940431 TTTTGGTGAGGGCCCTCATCTGG - Intergenic
912454922 1:109790977-109790999 CTTCCTGCAGGGCCCTCCTCAGG + Intergenic
913664766 1:121037230-121037252 TTTTGTGAAGGGCCCTGAACTGG - Intergenic
914016159 1:143820505-143820527 TTTTGTGAAGGGCCCTGAACTGG - Intergenic
914161623 1:145140503-145140525 TTTTGTGAAGGGCCCTGAACTGG + Intergenic
914654778 1:149729046-149729068 TTTTGTGAAGGGCCCTGAACTGG - Intergenic
917659045 1:177159747-177159769 ATTTCTGTAGGACCCTCCTCAGG + Intronic
921037145 1:211391474-211391496 TGTTGTGAAGGGCTTTCCTATGG - Intergenic
1062772761 10:116043-116065 TTTTGTGAGGGGCTCCCCGCAGG - Intergenic
1071174898 10:82914717-82914739 ACTTGTGAAGGACCCACCTCTGG - Intronic
1073891318 10:108105518-108105540 TGTTGTGTATGTCCCTCCTCAGG - Intergenic
1074412654 10:113241791-113241813 TTTTGGGAAGGGGCCTACTTAGG + Intergenic
1076133689 10:128030360-128030382 TTCTGGAAAAGGCCCTCCTCTGG + Intronic
1078415618 11:11162342-11162364 TTTTCTGAAGGGTCATCCTCAGG - Intergenic
1078679469 11:13462717-13462739 TATTGTGATGCGCCTTCCTCAGG + Intronic
1084081118 11:66825574-66825596 TTCTGGTGAGGGCCCTCCTCTGG - Intronic
1084414842 11:69025810-69025832 TTGGGTGAGGGGCCCTCCTGAGG + Intergenic
1084754374 11:71225784-71225806 TTTGGTGAAAGGCACTGCTCTGG - Intronic
1087025184 11:93642567-93642589 TTTTGTTAGGGGCCCTTCCCTGG - Intergenic
1090404298 11:126467796-126467818 CTCTGTGAAGGGCACCCCTCTGG - Intronic
1090834223 11:130442260-130442282 TTTTGTGTTGGGACCTCATCTGG + Intergenic
1092084095 12:5741511-5741533 TTGTGTGCACAGCCCTCCTCGGG - Intronic
1092109698 12:5950379-5950401 CTTTGTGAAGGCCTCTCTTCGGG + Intronic
1092920071 12:13223273-13223295 TTTTCTGAAGGTCCTTCCCCTGG + Intergenic
1093115669 12:15207789-15207811 TTTTGTGAAGGGCTGTCATAAGG + Intronic
1094012119 12:25820677-25820699 TTTTGTGCAGGGAACTCTTCTGG + Intergenic
1098385807 12:69917241-69917263 TTTTAAAAAGGGGCCTCCTCTGG + Intronic
1107736793 13:43407175-43407197 TTTTCAGAAGGCCCCACCTCTGG - Intronic
1107966964 13:45605643-45605665 TTTGGAGGAGAGCCCTCCTCAGG + Intronic
1108918844 13:55652657-55652679 TTTTGTGAAGGTCCCTGAACCGG - Intergenic
1112177197 13:97037819-97037841 TCTGCTGAAGGGCTCTCCTCTGG - Intergenic
1113739750 13:112703208-112703230 TCTGGTGAGGGGCCCTCCTGGGG + Intronic
1116347655 14:43815523-43815545 TTTTGTGTAGGGTCTTCCTGGGG + Intergenic
1116587990 14:46734427-46734449 ATTTGTGAAGGGCACAGCTCAGG + Intergenic
1117730019 14:58713019-58713041 TTCTGTGAGGGGCCCTCCCCTGG + Intergenic
1119485315 14:74982898-74982920 TTTTTTGGAGGGCCCTCCTGTGG - Intergenic
1125437965 15:39668304-39668326 TTTTGTGAAGTCCCCTCCCCAGG + Intronic
1127141139 15:55978645-55978667 TTTAGTGAAGAGCCCTGGTCTGG - Intronic
1129255459 15:74331567-74331589 TAGTCTGCAGGGCCCTCCTCTGG - Intronic
1129440938 15:75580155-75580177 TTGTCTGAAGGCCCCTCCTTTGG - Intergenic
1133419306 16:5632109-5632131 CTTTGTGAAGAGGCCTCTTCTGG - Intergenic
1136497473 16:30653008-30653030 TTTTGTGAAGGGCCCTCCTCTGG - Exonic
1138941244 16:61793159-61793181 TTCTGGTAAGGGCCCTCTTCTGG - Intronic
1143796652 17:9342402-9342424 TTCTCTGAAGGGCCCCCCACTGG - Intronic
1144628934 17:16860381-16860403 ATTAGTGAAGGGCCATCCTGAGG - Intergenic
1144652475 17:17015734-17015756 ATTAGTGAAGGGCCATCCTGCGG + Intergenic
1145160508 17:20570948-20570970 ATTAGTGAAGGGCCATCCTGCGG - Intergenic
1148879290 17:50713398-50713420 TTCTGTCGAGGGCCCTCTTCTGG + Intergenic
1151034604 17:70783634-70783656 TTTTGGTGAGGGCCCTCTTCTGG + Intergenic
1153824104 18:8859049-8859071 TTTTGAGAAGTGCCCTGTTCAGG - Intergenic
1155313437 18:24547390-24547412 TTTTGTGAAAGGCCCTTTTATGG + Intergenic
1155657068 18:28204785-28204807 TTTGGTGAAGGGAGGTCCTCTGG + Intergenic
1161762718 19:6186207-6186229 TTTACTAAAGGGCCCTCTTCAGG - Intronic
1162449845 19:10748144-10748166 CTTTGTTATGGGCCCTCCTTGGG - Intronic
1162806089 19:13138729-13138751 TCTTGGGAAGGCCCCTCCCCAGG + Exonic
1164585440 19:29469089-29469111 TTTTGTGGATGGCCCTAATCAGG - Intergenic
1165390470 19:35535747-35535769 TTCTAGGAAGAGCCCTCCTCAGG + Intronic
925868133 2:8246609-8246631 GTCTGTGAAGGGCCCTTCTATGG + Intergenic
927380931 2:22478078-22478100 TTTTGTGAAGGACCATTTTCCGG - Intergenic
929570821 2:43021930-43021952 CTTTGTGCAGTGCCGTCCTCGGG - Intergenic
929780936 2:44956431-44956453 TTGTTTCAAAGGCCCTCCTCGGG - Intergenic
930705155 2:54497803-54497825 TTTTGGGAAGGGCTACCCTCTGG + Intronic
933269360 2:80216630-80216652 TTCTGGGGAGGGCCCTCTTCTGG - Intronic
937259246 2:120574900-120574922 TGCTCTGAAGGCCCCTCCTCAGG + Intergenic
938199093 2:129358354-129358376 TCTTGTGAAGAGCCCTCTTCAGG + Intergenic
938782670 2:134599498-134599520 TTCTGCTGAGGGCCCTCCTCCGG - Intronic
938977977 2:136497361-136497383 TTTCCTGAAGGGCCATACTCCGG - Intergenic
944916453 2:204365421-204365443 TTATGAAAAGTGCCCTCCTCTGG + Intergenic
1172418857 20:34797066-34797088 TTTTTTGAAGGGGGCTCCTCTGG + Intronic
1175916617 20:62428800-62428822 CTTCGTGGAGGCCCCTCCTCCGG + Intergenic
1175928045 20:62480503-62480525 TTCTGGGAAGGGCCCTCCCTGGG - Intergenic
1179949861 21:44703488-44703510 TTCTGTGCAGGGCCCTCTGCAGG + Intronic
1184401104 22:44275137-44275159 TGTTCTGCCGGGCCCTCCTCTGG + Intronic
1185138928 22:49089489-49089511 TGCTGTGAAGGGGCCTCCTTGGG + Intergenic
950964025 3:17133730-17133752 TTTTGTGAAGGATCTTTCTCTGG + Intergenic
953456764 3:43048574-43048596 GTCTGTCAAGGGCCCTCATCTGG - Intronic
954297109 3:49680407-49680429 GTTTGTGAAAGGCACTTCTCGGG + Intronic
958903269 3:99913106-99913128 TTCTGGTAAGGGCCCTCTTCTGG - Intronic
961772295 3:129258816-129258838 CTCTGTGCAGGGCCCTGCTCTGG + Intronic
963052444 3:141153555-141153577 TTCTGGCAAGGGCCCTCTTCCGG + Intergenic
963196096 3:142532055-142532077 TTTTGAGAAGTGCCCTGCTTCGG + Intronic
965861329 3:173154448-173154470 TTTTGTTAAGGGCAGTCCTAGGG + Intergenic
966827487 3:183977285-183977307 TTTTGTGAACGGCCATGATCTGG - Intronic
969015325 4:4100015-4100037 CTTGGTGGAGGGCCCTGCTCTGG - Intergenic
969669845 4:8583584-8583606 GTTTGTGTAGGGTCCTCCTGAGG + Intronic
972024557 4:34361125-34361147 TTGTCTTAAGGGCACTCCTCAGG - Intergenic
974066760 4:57085954-57085976 TTTGGTGAAGGGCCCTGTCCTGG + Intronic
975017106 4:69435674-69435696 GTTAGTGAAGGTCCCTCCACAGG + Intergenic
975393716 4:73851221-73851243 TTTTCTGAAGGGCCTTCCAGAGG + Intergenic
976288399 4:83392468-83392490 CTTTGTGAACTGCCCGCCTCAGG + Intergenic
977472733 4:97461533-97461555 TTCTGGTAAGGGCCCTCTTCTGG - Intronic
978866820 4:113523078-113523100 TTTTGGTGAGGGCCCTCTTCAGG - Intronic
980098385 4:128517090-128517112 TATTTTGAAGGGCCCTGCTTTGG - Intergenic
980521096 4:133935373-133935395 TTTTTTGCAATGCCCTCCTCAGG + Intergenic
982973255 4:162018039-162018061 TTCTGTGAGTTGCCCTCCTCTGG + Intronic
986350970 5:6878994-6879016 TTCTGCGGAGGGCCCTCTTCAGG - Intergenic
988558984 5:32263301-32263323 TTATGTGAAAGTCCCTCCTTAGG + Intronic
989158706 5:38369739-38369761 TTCTCTGAAGGGCCCTCCAAAGG + Intronic
989232219 5:39099605-39099627 TTCTGGGGAGGGCCCTCTTCCGG - Intergenic
989281435 5:39648637-39648659 TTTTGTCAAGGGCCTTGCTTTGG + Intergenic
990322049 5:54639797-54639819 TTTTCTGAAGGGGCCTCCTGGGG + Intergenic
999753357 5:154646786-154646808 CTTGGTCAAGGGCTCTCCTCTGG + Intergenic
1001165709 5:169364376-169364398 TTTTGTAAATGGCCCTCATCAGG + Intergenic
1003397973 6:5769725-5769747 TTTTCTGTAGGGACCTCCTGGGG - Intronic
1005418005 6:25621935-25621957 TTTGCTCTAGGGCCCTCCTCTGG + Intergenic
1006328800 6:33374377-33374399 TTTTGGGAAAGGACCTGCTCAGG - Intergenic
1007193830 6:40041999-40042021 TTGGGTGCAGGGCCCTCCTGTGG - Intergenic
1007414870 6:41685513-41685535 TTGTGTAAAGGGCCAGCCTCAGG + Intronic
1008899569 6:56595792-56595814 TTTTGTGCAAAGCCCTTCTCGGG - Intronic
1009011542 6:57848847-57848869 TTTTTTGTAGTGCTCTCCTCAGG + Intergenic
1013590046 6:111612334-111612356 TTTGGATAAGGGCCCTTCTCAGG - Intergenic
1017224654 6:152006884-152006906 TTTTGTAAATAGCACTCCTCAGG + Intronic
1017363825 6:153608896-153608918 TTTTGTGGATGGCCTTCATCAGG - Intergenic
1017882346 6:158570710-158570732 TTATGTGAAGTGCCCCCCTGAGG - Intronic
1018330843 6:162726728-162726750 TTTTGTAAAGGACCCTCCTCAGG + Intronic
1025199843 7:56955441-56955463 TGGGGTGAAGGGCCCTGCTCGGG + Intergenic
1025672103 7:63621491-63621513 TGGGGTGAAGGGCCCTGCTCAGG - Intergenic
1026685853 7:72509531-72509553 TTTTGTGAACTGCTCTGCTCTGG + Intergenic
1031936802 7:127743355-127743377 TTTTGTGAAGGCTTCTCCTCAGG + Intronic
1033104117 7:138504354-138504376 TTTTGTGAAGGACACTACTGAGG + Exonic
1033872634 7:145774792-145774814 TTTTGGGGAGGGCCCTCTTCTGG - Intergenic
1034244404 7:149633757-149633779 TTTTGTGAAGAGCCACCCCCTGG + Intergenic
1034887895 7:154812492-154812514 TTCTGGTAAGGGCCCTCTTCTGG + Intronic
1037551563 8:19977375-19977397 TTTTGTGGATGGCCTTCATCAGG - Intergenic
1039774865 8:40725350-40725372 TTTCCTGAGGGGCCTTCCTCAGG + Intronic
1042535179 8:69851474-69851496 TTTTGTAAAGAGCCCTTTTCAGG - Intergenic
1043846596 8:85170687-85170709 TTTTGTCAATGTGCCTCCTCTGG + Intergenic
1048789029 8:138083310-138083332 TTTTTTGAAGAGCCCTCGTGTGG - Intergenic
1049295105 8:141828888-141828910 CTCTGGGGAGGGCCCTCCTCTGG + Intergenic
1052930348 9:34050626-34050648 TCTTGTGATCCGCCCTCCTCCGG - Intergenic
1056750275 9:89345611-89345633 TTGTAGGAAGGACCCTCCTCAGG + Intronic
1057822253 9:98341798-98341820 TTTTGTCAAGAGCCCACTTCTGG - Intronic
1057904882 9:98975687-98975709 TTTTGGGGTGGCCCCTCCTCAGG - Intronic
1061120903 9:128641645-128641667 ATCTGTGAGGGGCTCTCCTCGGG + Intronic
1187823050 X:23308579-23308601 TTTGGGGAAGGGCCCTTCTGGGG - Intergenic
1188745021 X:33830736-33830758 ATTTGTTAAGGGCCGTCCTTGGG + Intergenic
1189286387 X:39854948-39854970 TTTGGGGGAGGGCCCTCTTCTGG - Intergenic
1201738205 Y:17293988-17294010 TTCAGTAAAGGGCCCTTCTCAGG + Intergenic