ID: 1136498251

View in Genome Browser
Species Human (GRCh38)
Location 16:30657011-30657033
Sequence GAGACTGAAAGGCCTATAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136498244_1136498251 19 Left 1136498244 16:30656969-30656991 CCTAGACCGTGGTCTGGGTTCTC No data
Right 1136498251 16:30657011-30657033 GAGACTGAAAGGCCTATAGTGGG No data
1136498243_1136498251 20 Left 1136498243 16:30656968-30656990 CCCTAGACCGTGGTCTGGGTTCT No data
Right 1136498251 16:30657011-30657033 GAGACTGAAAGGCCTATAGTGGG No data
1136498245_1136498251 13 Left 1136498245 16:30656975-30656997 CCGTGGTCTGGGTTCTCCCAATT No data
Right 1136498251 16:30657011-30657033 GAGACTGAAAGGCCTATAGTGGG No data
1136498247_1136498251 -3 Left 1136498247 16:30656991-30657013 CCCAATTCATTTATATCAAGGAG No data
Right 1136498251 16:30657011-30657033 GAGACTGAAAGGCCTATAGTGGG No data
1136498248_1136498251 -4 Left 1136498248 16:30656992-30657014 CCAATTCATTTATATCAAGGAGA No data
Right 1136498251 16:30657011-30657033 GAGACTGAAAGGCCTATAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136498251 Original CRISPR GAGACTGAAAGGCCTATAGT GGG Intergenic
No off target data available for this crispr