ID: 1136498379

View in Genome Browser
Species Human (GRCh38)
Location 16:30657904-30657926
Sequence TGCTGTGCCTGCGCCTGCGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136498379_1136498386 7 Left 1136498379 16:30657904-30657926 CCGGCGCAGGCGCAGGCACAGCA No data
Right 1136498386 16:30657934-30657956 GCTCGGGCCACCCCGGGCCGCGG No data
1136498379_1136498383 0 Left 1136498379 16:30657904-30657926 CCGGCGCAGGCGCAGGCACAGCA No data
Right 1136498383 16:30657927-30657949 CGCGGCCGCTCGGGCCACCCCGG No data
1136498379_1136498381 -10 Left 1136498379 16:30657904-30657926 CCGGCGCAGGCGCAGGCACAGCA No data
Right 1136498381 16:30657917-30657939 AGGCACAGCACGCGGCCGCTCGG No data
1136498379_1136498384 1 Left 1136498379 16:30657904-30657926 CCGGCGCAGGCGCAGGCACAGCA No data
Right 1136498384 16:30657928-30657950 GCGGCCGCTCGGGCCACCCCGGG No data
1136498379_1136498382 -9 Left 1136498379 16:30657904-30657926 CCGGCGCAGGCGCAGGCACAGCA No data
Right 1136498382 16:30657918-30657940 GGCACAGCACGCGGCCGCTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136498379 Original CRISPR TGCTGTGCCTGCGCCTGCGC CGG (reversed) Intergenic