ID: 1136498758

View in Genome Browser
Species Human (GRCh38)
Location 16:30659413-30659435
Sequence GGCGGCTGCACAGTGACGAG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 93}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136498758_1136498762 0 Left 1136498758 16:30659413-30659435 CCTCTCGTCACTGTGCAGCCGCC 0: 1
1: 0
2: 0
3: 9
4: 93
Right 1136498762 16:30659436-30659458 AGCGCCGCGCCTGCGACCCCGGG 0: 1
1: 0
2: 0
3: 6
4: 120
1136498758_1136498761 -1 Left 1136498758 16:30659413-30659435 CCTCTCGTCACTGTGCAGCCGCC 0: 1
1: 0
2: 0
3: 9
4: 93
Right 1136498761 16:30659435-30659457 CAGCGCCGCGCCTGCGACCCCGG 0: 1
1: 0
2: 0
3: 17
4: 170
1136498758_1136498764 7 Left 1136498758 16:30659413-30659435 CCTCTCGTCACTGTGCAGCCGCC 0: 1
1: 0
2: 0
3: 9
4: 93
Right 1136498764 16:30659443-30659465 CGCCTGCGACCCCGGGCCTGCGG 0: 1
1: 0
2: 1
3: 18
4: 192
1136498758_1136498770 21 Left 1136498758 16:30659413-30659435 CCTCTCGTCACTGTGCAGCCGCC 0: 1
1: 0
2: 0
3: 9
4: 93
Right 1136498770 16:30659457-30659479 GGCCTGCGGACAGGCCGCTTCGG 0: 1
1: 0
2: 0
3: 6
4: 113
1136498758_1136498766 12 Left 1136498758 16:30659413-30659435 CCTCTCGTCACTGTGCAGCCGCC 0: 1
1: 0
2: 0
3: 9
4: 93
Right 1136498766 16:30659448-30659470 GCGACCCCGGGCCTGCGGACAGG 0: 1
1: 0
2: 0
3: 4
4: 119
1136498758_1136498771 22 Left 1136498758 16:30659413-30659435 CCTCTCGTCACTGTGCAGCCGCC 0: 1
1: 0
2: 0
3: 9
4: 93
Right 1136498771 16:30659458-30659480 GCCTGCGGACAGGCCGCTTCGGG 0: 1
1: 0
2: 0
3: 8
4: 70

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136498758 Original CRISPR GGCGGCTGCACAGTGACGAG AGG (reversed) Exonic
900411221 1:2513565-2513587 GGAGGCTGGACAGTGACCAGAGG - Intronic
902554299 1:17237957-17237979 GGAGGCTTCCCAGTGACCAGTGG + Intronic
903176600 1:21585255-21585277 GGCGGGTGCACAGGGAACAGAGG + Intergenic
903285901 1:22276503-22276525 GGAGGCTTCACAGAGAAGAGAGG + Intergenic
905456461 1:38091554-38091576 AGAAGCTGCACAGTGAGGAGAGG + Intergenic
907827466 1:58032699-58032721 GGTGGCTACACAGTGAAGGGTGG - Intronic
915751442 1:158214045-158214067 GCCAGGTGCACAGTGACAAGAGG - Intergenic
917135415 1:171784287-171784309 TGCGGCTGGAGAGTGCCGAGCGG + Exonic
918177222 1:182057096-182057118 GGCGCCTGCACACGGGCGAGCGG - Exonic
922857308 1:228785920-228785942 GGAGGCTGAACAGTGATGCGTGG - Intergenic
1075676440 10:124299142-124299164 GGCCTCTGCCCAGTGACCAGTGG + Intergenic
1075773984 10:124967576-124967598 GGCTGCTGCACACTGGAGAGGGG + Intronic
1076895554 10:133309544-133309566 GGCGGCCGCACATGGAAGAGCGG - Intronic
1078860682 11:15243554-15243576 GGCTGCTGCACACTGAGGAGGGG + Intronic
1080948750 11:37004500-37004522 GACGGAGGCACAGTGAGGAGTGG - Intergenic
1089613908 11:119684648-119684670 AGCGGCTGCACTGGGAGGAGGGG - Intronic
1089635982 11:119812013-119812035 GGAGGAGGCACAGTGAGGAGAGG + Intergenic
1091768437 12:3136896-3136918 GGCGGCTCCACAGTGCACAGTGG - Intronic
1100282190 12:93128482-93128504 GGCGCCAGCACAGTGACTGGAGG - Intergenic
1102191926 12:110995160-110995182 GGTGGCAGCACAGTCACGGGCGG - Intergenic
1103275522 12:119708339-119708361 AACGGCTTCACACTGACGAGAGG - Intronic
1104917086 12:132271336-132271358 GGCGGAGGCAGAGTGACGGGTGG - Intronic
1108855665 13:54789752-54789774 GGCTGCTTCACACTGAGGAGGGG + Intergenic
1114181750 14:20373694-20373716 GGCAGCTGCACAGTGGCTAATGG + Exonic
1117452616 14:55865698-55865720 GGCAGCTGCACTGTGCCGGGGGG + Intergenic
1119410269 14:74426036-74426058 GGCGGCTGCTCAGGGACGCGGGG - Exonic
1122066910 14:99180141-99180163 GGAGGCTGCACTGTGGAGAGGGG + Intronic
1122115720 14:99526380-99526402 GGGGACTGCACAGTGACCACGGG - Intronic
1123987054 15:25655202-25655224 GGAGGATGCACAGTGAAAAGGGG + Intergenic
1128079033 15:64845357-64845379 GTCAGCTGCTCAGTGAGGAGAGG + Intronic
1129539379 15:76338348-76338370 GGCGGCTGCACACGGAGCAGCGG - Exonic
1131071581 15:89469874-89469896 GGGGGCTGCACAGGGAGGGGAGG - Intergenic
1136498758 16:30659413-30659435 GGCGGCTGCACAGTGACGAGAGG - Exonic
1138414868 16:56865868-56865890 GGAGGCTGGACTGTGAAGAGTGG + Intronic
1139950023 16:70664134-70664156 GGCGTCTTCACAGGGACGATGGG + Exonic
1141786324 16:86203250-86203272 GGCGGGTGCACAGGGGAGAGAGG - Intergenic
1143512628 17:7404860-7404882 GGCGGCCGCGCGGTGACGCGCGG + Intronic
1143709525 17:8724808-8724830 GCCAGCTGCACAGCGACGCGAGG - Intergenic
1148149663 17:45389157-45389179 GGCAGCTGCAGAGAGACGTGGGG + Intergenic
1148475415 17:47925437-47925459 TGCGCCTGCACACTGGCGAGCGG + Exonic
1148863914 17:50618873-50618895 AGGGGCTGCCCAGTGGCGAGTGG - Exonic
1160586971 18:79918394-79918416 GGCGGATCCCCAGTGAGGAGCGG + Intronic
1161273098 19:3401129-3401151 GGCTGCAGCAGAGTGAGGAGAGG + Intronic
1161649886 19:5477957-5477979 GGCTGCAGCAGAGTGAGGAGGGG - Intergenic
1161741097 19:6021683-6021705 GGCTGGAGCACAGTGAGGAGTGG + Intronic
1161756424 19:6137448-6137470 GGCTGCAGCAGAGTGAGGAGGGG + Intronic
1161857044 19:6772139-6772161 GGCTGGAGCACAGTGAAGAGGGG + Intergenic
1162612640 19:11767966-11767988 GGAGGCTGCACGGTGATGACAGG + Intronic
1162675210 19:12293887-12293909 GGAGGCTGCACGGTGACGGTGGG - Intronic
1164913144 19:32028238-32028260 GGCGGCTGCACTGGAATGAGTGG - Intergenic
1167258479 19:48444280-48444302 GGGAGCTGCACAGTGATGTGGGG - Exonic
1168315413 19:55482779-55482801 TGCGGCTGCACTCTGGCGAGCGG + Exonic
1168722642 19:58562660-58562682 GGCGCGTGCACAGTGGCGAGCGG - Exonic
925585594 2:5461178-5461200 GGAGGCTGCACACTGTCAAGTGG + Intergenic
925597279 2:5568336-5568358 GTGGGCTGCACTGTGACGTGGGG - Intergenic
928081138 2:28313351-28313373 GGAGGCTGCACATTGAGAAGAGG + Intronic
930226247 2:48796925-48796947 GGAGCCTGCATAGTGAAGAGTGG - Intergenic
932073602 2:68643920-68643942 GGCGGCTTCTGAGTGAAGAGGGG + Intronic
945314127 2:208352266-208352288 GGTGGCTGCTCAATGACAAGTGG - Intronic
945988249 2:216371700-216371722 GGCGGCTGGGGAGTGAGGAGGGG + Exonic
1171360446 20:24583092-24583114 GCTGGCTGCACAGTGATTAGAGG + Intronic
1171544405 20:25989457-25989479 GGCGACTGCACAGTGGCAGGGGG - Intergenic
1171858950 20:30377115-30377137 GGCGGCTGCAGAGGGCCGAAAGG - Intergenic
1174272551 20:49380343-49380365 GGCGCCTGCACAGGGAGGAATGG + Intronic
1181509860 22:23384328-23384350 GGTGGCTGCACAGCGAGGAGGGG + Intergenic
1182094991 22:27620060-27620082 GTCAGCTGCACAGTAACAAGAGG - Intergenic
1184506462 22:44906765-44906787 GGCGGCTGCACAGTAGCGGGGGG - Intronic
1184572741 22:45336815-45336837 GGAGGCTGGACAGTGACAAGGGG - Intronic
953792078 3:45955238-45955260 TGCGGCTGAACAGTGAGTAGAGG - Exonic
953992631 3:47495936-47495958 GGCGACTCCACTGTGACCAGAGG - Exonic
955768968 3:62371361-62371383 GGCGAGTGCACAGTAAGGAGAGG + Intronic
965617012 3:170604228-170604250 GGGGGCAGCACAGTGAGTAGAGG + Intronic
967486924 3:190043366-190043388 TGAGGCTGCAGAGTGATGAGTGG + Intronic
968993596 4:3931004-3931026 AGCCGCTGCACAGAGACGTGAGG - Intergenic
969212957 4:5701755-5701777 GGCTGCTGCACATTAACCAGTGG + Intronic
972165583 4:36280471-36280493 GGTGGCTGCAGAGTGGAGAGGGG - Intergenic
982166458 4:152617899-152617921 GCTGGCTGCACAGTGAACAGGGG - Intergenic
995244854 5:109923739-109923761 AGCAGATACACAGTGACGAGTGG - Intergenic
999742236 5:154565094-154565116 GGCTGCGGCAGAGTGAGGAGTGG + Intergenic
1002817448 6:693568-693590 GGGGGCTGCACCGAGACCAGAGG + Intergenic
1006306683 6:33225635-33225657 GGTGGCTGCACAGGGGCTAGGGG + Intergenic
1016086894 6:139925496-139925518 GCAGGCTTCACAGTGATGAGAGG - Intergenic
1019129086 6:169860371-169860393 AGCTGCTGCACAGTGAGGTGAGG - Intergenic
1019379216 7:712441-712463 GGCGGCTGCGCGGGGACGCGGGG + Intronic
1027429408 7:78094923-78094945 GGCGGCTGCAGAGGGGAGAGAGG - Intronic
1029110900 7:98212536-98212558 GGCGGCTGGAGAGCAACGAGAGG + Exonic
1032191386 7:129767786-129767808 GGGGGCTGCACTGTGGCCAGTGG - Intergenic
1032912216 7:136446304-136446326 GGTGACTGCACAGTGACTTGTGG + Intergenic
1033545329 7:142394370-142394392 GGCTGCCGCACATTGACCAGGGG - Intergenic
1034186249 7:149179461-149179483 GGCGGCTGCACACAGGCGAGCGG + Exonic
1034192785 7:149224409-149224431 AGCGGCTGCACACGGGCGAGCGG + Exonic
1034431596 7:151043842-151043864 GGAGGGTGCACAGTGCTGAGAGG + Intronic
1037947256 8:22997181-22997203 GGCGGCTTGACAGTGACAAGGGG + Intronic
1041215917 8:55600092-55600114 GGCTGGAGCACAGTGGCGAGTGG + Intergenic
1044591317 8:93916853-93916875 ATTGGCTGCGCAGTGACGAGTGG - Intronic
1049624905 8:143615579-143615601 GGCTGCTGCCCAGTGACTGGTGG + Intronic
1053725204 9:40992198-40992220 GGCGGCTGCAGAGGGCCGAAAGG - Intergenic
1054340747 9:63859696-63859718 GGCGGCTGCAGAGGGCCGAAAGG + Intergenic
1057757202 9:97848061-97848083 GGCGGTGGCACGGTGAGGAGGGG - Intergenic
1057949528 9:99358909-99358931 GGCAGCCACACAGTGTCGAGTGG - Intergenic
1061234948 9:129336864-129336886 CGCGGCTGCACAGTCACACGCGG + Intergenic
1062521872 9:136961336-136961358 GGCTGTTGCACAGAGATGAGCGG + Intergenic
1192265410 X:69534079-69534101 GGCGGCTGCACTGTGCCTGGCGG + Intergenic