ID: 1136498758

View in Genome Browser
Species Human (GRCh38)
Location 16:30659413-30659435
Sequence GGCGGCTGCACAGTGACGAG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 93}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136498758_1136498761 -1 Left 1136498758 16:30659413-30659435 CCTCTCGTCACTGTGCAGCCGCC 0: 1
1: 0
2: 0
3: 9
4: 93
Right 1136498761 16:30659435-30659457 CAGCGCCGCGCCTGCGACCCCGG 0: 1
1: 0
2: 0
3: 17
4: 170
1136498758_1136498766 12 Left 1136498758 16:30659413-30659435 CCTCTCGTCACTGTGCAGCCGCC 0: 1
1: 0
2: 0
3: 9
4: 93
Right 1136498766 16:30659448-30659470 GCGACCCCGGGCCTGCGGACAGG 0: 1
1: 0
2: 0
3: 4
4: 119
1136498758_1136498764 7 Left 1136498758 16:30659413-30659435 CCTCTCGTCACTGTGCAGCCGCC 0: 1
1: 0
2: 0
3: 9
4: 93
Right 1136498764 16:30659443-30659465 CGCCTGCGACCCCGGGCCTGCGG 0: 1
1: 0
2: 1
3: 18
4: 192
1136498758_1136498770 21 Left 1136498758 16:30659413-30659435 CCTCTCGTCACTGTGCAGCCGCC 0: 1
1: 0
2: 0
3: 9
4: 93
Right 1136498770 16:30659457-30659479 GGCCTGCGGACAGGCCGCTTCGG 0: 1
1: 0
2: 0
3: 6
4: 113
1136498758_1136498762 0 Left 1136498758 16:30659413-30659435 CCTCTCGTCACTGTGCAGCCGCC 0: 1
1: 0
2: 0
3: 9
4: 93
Right 1136498762 16:30659436-30659458 AGCGCCGCGCCTGCGACCCCGGG 0: 1
1: 0
2: 0
3: 6
4: 120
1136498758_1136498771 22 Left 1136498758 16:30659413-30659435 CCTCTCGTCACTGTGCAGCCGCC 0: 1
1: 0
2: 0
3: 9
4: 93
Right 1136498771 16:30659458-30659480 GCCTGCGGACAGGCCGCTTCGGG 0: 1
1: 0
2: 0
3: 8
4: 70

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136498758 Original CRISPR GGCGGCTGCACAGTGACGAG AGG (reversed) Exonic