ID: 1136498915

View in Genome Browser
Species Human (GRCh38)
Location 16:30659970-30659992
Sequence CCCATTAGGCCCCACCTGCA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 108}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136498915_1136498920 -8 Left 1136498915 16:30659970-30659992 CCTTGCAGGTGGGGCCTAATGGG 0: 1
1: 0
2: 1
3: 19
4: 108
Right 1136498920 16:30659985-30660007 CTAATGGGGCTAGGAGACTTTGG 0: 1
1: 0
2: 0
3: 7
4: 92
1136498915_1136498923 -5 Left 1136498915 16:30659970-30659992 CCTTGCAGGTGGGGCCTAATGGG 0: 1
1: 0
2: 1
3: 19
4: 108
Right 1136498923 16:30659988-30660010 ATGGGGCTAGGAGACTTTGGGGG 0: 1
1: 0
2: 1
3: 15
4: 180
1136498915_1136498927 14 Left 1136498915 16:30659970-30659992 CCTTGCAGGTGGGGCCTAATGGG 0: 1
1: 0
2: 1
3: 19
4: 108
Right 1136498927 16:30660007-30660029 GGGGTTTCCGAGGGGCAGCAAGG 0: 1
1: 0
2: 2
3: 15
4: 187
1136498915_1136498922 -6 Left 1136498915 16:30659970-30659992 CCTTGCAGGTGGGGCCTAATGGG 0: 1
1: 0
2: 1
3: 19
4: 108
Right 1136498922 16:30659987-30660009 AATGGGGCTAGGAGACTTTGGGG 0: 1
1: 0
2: 2
3: 18
4: 149
1136498915_1136498924 4 Left 1136498915 16:30659970-30659992 CCTTGCAGGTGGGGCCTAATGGG 0: 1
1: 0
2: 1
3: 19
4: 108
Right 1136498924 16:30659997-30660019 GGAGACTTTGGGGGTTTCCGAGG 0: 1
1: 0
2: 0
3: 4
4: 115
1136498915_1136498928 17 Left 1136498915 16:30659970-30659992 CCTTGCAGGTGGGGCCTAATGGG 0: 1
1: 0
2: 1
3: 19
4: 108
Right 1136498928 16:30660010-30660032 GTTTCCGAGGGGCAGCAAGGAGG 0: 1
1: 0
2: 1
3: 9
4: 182
1136498915_1136498926 6 Left 1136498915 16:30659970-30659992 CCTTGCAGGTGGGGCCTAATGGG 0: 1
1: 0
2: 1
3: 19
4: 108
Right 1136498926 16:30659999-30660021 AGACTTTGGGGGTTTCCGAGGGG 0: 1
1: 0
2: 0
3: 4
4: 86
1136498915_1136498929 18 Left 1136498915 16:30659970-30659992 CCTTGCAGGTGGGGCCTAATGGG 0: 1
1: 0
2: 1
3: 19
4: 108
Right 1136498929 16:30660011-30660033 TTTCCGAGGGGCAGCAAGGAGGG 0: 1
1: 0
2: 2
3: 12
4: 170
1136498915_1136498931 20 Left 1136498915 16:30659970-30659992 CCTTGCAGGTGGGGCCTAATGGG 0: 1
1: 0
2: 1
3: 19
4: 108
Right 1136498931 16:30660013-30660035 TCCGAGGGGCAGCAAGGAGGGGG 0: 1
1: 0
2: 0
3: 24
4: 334
1136498915_1136498930 19 Left 1136498915 16:30659970-30659992 CCTTGCAGGTGGGGCCTAATGGG 0: 1
1: 0
2: 1
3: 19
4: 108
Right 1136498930 16:30660012-30660034 TTCCGAGGGGCAGCAAGGAGGGG 0: 1
1: 0
2: 1
3: 14
4: 217
1136498915_1136498925 5 Left 1136498915 16:30659970-30659992 CCTTGCAGGTGGGGCCTAATGGG 0: 1
1: 0
2: 1
3: 19
4: 108
Right 1136498925 16:30659998-30660020 GAGACTTTGGGGGTTTCCGAGGG 0: 1
1: 0
2: 1
3: 4
4: 89
1136498915_1136498921 -7 Left 1136498915 16:30659970-30659992 CCTTGCAGGTGGGGCCTAATGGG 0: 1
1: 0
2: 1
3: 19
4: 108
Right 1136498921 16:30659986-30660008 TAATGGGGCTAGGAGACTTTGGG 0: 1
1: 0
2: 2
3: 5
4: 125

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136498915 Original CRISPR CCCATTAGGCCCCACCTGCA AGG (reversed) Exonic
902278599 1:15358029-15358051 CCCCTTATCCCCCACCTTCAAGG - Intronic
902381285 1:16053599-16053621 CCCATCAGGCCCCACAGTCAGGG - Intronic
904398672 1:30241238-30241260 CCCATAAGGCCCCTTCTGCCAGG + Intergenic
905390184 1:37631152-37631174 CCCAGCAGAGCCCACCTGCACGG + Intronic
910751314 1:90634139-90634161 CCCATTGGGCTGCACTTGCATGG + Intergenic
915956601 1:160225344-160225366 CTCATTAGGCCTCACCATCAAGG + Intronic
917528865 1:175815047-175815069 CCCAGGAGGCCCCACCTTCCTGG - Intergenic
918378543 1:183932834-183932856 CCCATGAGTCCCCACCTCCTTGG + Intronic
918513826 1:185340390-185340412 CCCATTAGGCCCCACTCTGACGG + Intergenic
920409658 1:205749608-205749630 CCCAAGAGGCCCCACCTCCTCGG - Intronic
922221732 1:223613513-223613535 ACCAAGAGGCCCCACCTGCCTGG - Intronic
922724773 1:227917747-227917769 CCCAGAAGACCCCACATGCAGGG + Intergenic
922766673 1:228159665-228159687 CCCATTGGGTCCAAGCTGCAAGG - Exonic
1067879363 10:50030081-50030103 CCCATGAGGCCACAGCTGCAAGG - Intergenic
1067892533 10:50149351-50149373 CCCATGAGGCAACAGCTGCAAGG + Intergenic
1073242656 10:102068357-102068379 CCCAGTAGCTCCCACCTGCTTGG + Intergenic
1075677944 10:124309123-124309145 CCAGTGAGGCCCCACCTGCCAGG - Intergenic
1075740012 10:124689589-124689611 ACCATCAGGCCCCACATCCAAGG + Intronic
1077026301 11:441513-441535 CCCCTTAGGGGCCAGCTGCAAGG + Intronic
1077545472 11:3167461-3167483 CCCAGTAGGCCCCACCATCCAGG + Intergenic
1078103211 11:8342134-8342156 CCCCTTCCTCCCCACCTGCAAGG - Intergenic
1078534193 11:12160220-12160242 CCCACTGGGCACCACCTGCCAGG - Intronic
1079168828 11:18072582-18072604 CCCATTATGCCATACCTGCTTGG + Intronic
1085288602 11:75380958-75380980 ACCCTTAGGCCTCACCTTCAAGG - Intergenic
1088728513 11:112660122-112660144 CTCATCAGGCCCAGCCTGCATGG + Intergenic
1090510976 11:127374812-127374834 CCCATCAGCCCCCTCCTGCACGG + Intergenic
1091600041 12:1912515-1912537 GCCATCAGGACCCACCTTCATGG - Intronic
1103233373 12:119351041-119351063 CCCACCAGTCCCCAGCTGCAGGG + Intronic
1105279437 13:18954582-18954604 CCCACCACGCTCCACCTGCAGGG - Intergenic
1107293680 13:38887319-38887341 CCCAGTAGAATCCACCTGCAGGG + Intergenic
1108907739 13:55500448-55500470 CCCCTCAGCCACCACCTGCAGGG - Intergenic
1113506125 13:110817158-110817180 CACAGGAGGCACCACCTGCAGGG + Intergenic
1113897636 13:113776077-113776099 CGCCTCAGGCCACACCTGCAGGG + Intronic
1113965777 13:114152879-114152901 CCAATTAGGCCCAACCTGAGGGG - Intergenic
1116315567 14:43387007-43387029 CCCATTATCCCCCACCAGAATGG - Intergenic
1116410748 14:44620091-44620113 CTCATTATACCCCAACTGCACGG + Intergenic
1129297282 15:74606493-74606515 CACTTTGGGCCCCACATGCAGGG - Intronic
1136498915 16:30659970-30659992 CCCATTAGGCCCCACCTGCAAGG - Exonic
1138084112 16:54118215-54118237 CCCTTTTGGCCCCACCTGTAGGG - Exonic
1141079481 16:81037491-81037513 ACAATTCGGCCCCACCTGCACGG - Intronic
1144313524 17:14036831-14036853 CCCATCAGGCCCCACCTCCAAGG + Intergenic
1145759739 17:27419378-27419400 CCCAGTGGCCCACACCTGCATGG - Intergenic
1145979248 17:29002190-29002212 CCAATTAAGCCCCATCTGCTGGG - Intronic
1146159707 17:30553307-30553329 CCCAGTGGCCCACACCTGCATGG - Intergenic
1149563401 17:57625477-57625499 TCCATTAGCCCTCACTTGCAGGG + Intronic
1150307358 17:64097180-64097202 GCCATCCTGCCCCACCTGCATGG - Intronic
1151505301 17:74523308-74523330 CCCATTAGGCCACCAATGCAAGG + Intronic
1151698585 17:75730727-75730749 CCTCTTAGCCCCCACCTGCTTGG - Intronic
1151845101 17:76648109-76648131 CCCTCTTGGCCACACCTGCATGG + Intergenic
1160945894 19:1643977-1643999 CCAACTAGGCCCCGCCTGGAAGG + Intronic
1161096062 19:2391708-2391730 CCCATCAGGACCCCCCTGAAAGG + Intronic
1161456132 19:4370530-4370552 CCCACAGGGCCCCACCTGGACGG + Intronic
1162927512 19:13937770-13937792 CTCCGTGGGCCCCACCTGCAGGG + Exonic
1162945328 19:14039822-14039844 TCCATTGGGCCCCACCTACATGG + Exonic
1164720591 19:30429057-30429079 CCCCTTAAACCACACCTGCATGG - Intronic
1164912676 19:32025536-32025558 CAGGGTAGGCCCCACCTGCAGGG + Intergenic
1165750161 19:38254603-38254625 CCAATGAGGCCCCACCTCTAAGG + Intronic
1165838554 19:38773514-38773536 CCCAGCAGGCCCCACCACCACGG - Intergenic
1165841005 19:38789183-38789205 CCCAGCAGGCCCCACCACCACGG + Intergenic
1168108818 19:54180720-54180742 CCCAGCAGCCCCCACCTCCAAGG - Intronic
925057939 2:869700-869722 CCCACCAGGTCCCACCTCCAGGG - Intergenic
925427483 2:3762702-3762724 CCCACCAGGCCCCACCTCCAAGG + Intronic
931900135 2:66779315-66779337 CTCATTTAGCACCACCTGCAAGG - Intergenic
933102584 2:78279668-78279690 CCCATTATGCACCAACTACATGG + Intergenic
933327165 2:80852663-80852685 CCAATGAGGCCCCTCCTCCAAGG - Intergenic
934877286 2:97936060-97936082 CCAGTGAGGCCCCACCTGGAAGG + Intronic
936295069 2:111261718-111261740 CCCACTAGGGCCCACCTCCAGGG - Intergenic
936403678 2:112184349-112184371 CCCATTGGGGCCCCGCTGCAGGG + Intronic
937460716 2:122083419-122083441 CCCAATGGGGTCCACCTGCAGGG - Intergenic
938794696 2:134707651-134707673 CCCTTTGTGCCCCTCCTGCATGG - Intronic
947039347 2:225897805-225897827 CCCATCACTCCCCTCCTGCATGG - Intergenic
947601868 2:231456375-231456397 TCCACTGGGCCCCACCTGCTTGG - Intronic
947612100 2:231530793-231530815 CCCATTCAGACCCACCTCCAAGG + Intergenic
1170804855 20:19620621-19620643 CAGATAAGGCCCCACCTGCTGGG + Intronic
1173497349 20:43529163-43529185 GCCTTTAGGCCCCACCCGCCTGG - Intronic
1174162212 20:48559462-48559484 GCCAACAGTCCCCACCTGCATGG + Intergenic
1175394044 20:58646458-58646480 CCCAACAGGCCCCACCTAAATGG - Intergenic
1175789382 20:61731912-61731934 CCCAGGTTGCCCCACCTGCACGG + Intronic
1175945419 20:62556363-62556385 ACCATCAGGCCACACGTGCAGGG - Intronic
1176868552 21:14070369-14070391 CCCTTGCCGCCCCACCTGCAAGG - Intergenic
1177169741 21:17641805-17641827 CCCAACAGGCCCCACCTGGGAGG + Intergenic
1177774412 21:25551891-25551913 CCCACCAGGCCCTACCTCCAAGG + Intergenic
950681072 3:14585488-14585510 CCCATTAGGCCCCCACTTCTGGG + Intergenic
959308237 3:104696579-104696601 CTCTTTAGACCCCACCTCCAGGG - Intergenic
960784647 3:121358596-121358618 CCCACCAGGCCCCACCTCCTGGG + Intronic
961531037 3:127540614-127540636 CTTATGAGGCCCCACATGCAGGG - Intergenic
961920561 3:130421029-130421051 CCAATTAGGCCCCTTCTGCATGG + Intronic
962343723 3:134605216-134605238 CCCATGAGGACCCACCTGCCTGG + Intronic
963349206 3:144132036-144132058 CCCACTAGGCCCCACCTGGTGGG + Intergenic
964444225 3:156741940-156741962 CCCCCTAGACCCCACCTTCAAGG - Intergenic
965712014 3:171564874-171564896 CCCATTAGGCCCAGCCTTGAGGG - Intergenic
968455798 4:699038-699060 CCCATGAGGCCTCCTCTGCAGGG + Intergenic
970359377 4:15293087-15293109 CCCACTATGCCTCACCTCCAGGG + Intergenic
970825599 4:20269705-20269727 TCCATTAGCCCCCACCTGGATGG + Intronic
972610813 4:40653845-40653867 CCCACTATGCCCCACCTTCAAGG - Intergenic
977169545 4:93743753-93743775 CCCATTAGGCCCCACCTAATGGG + Intronic
977359071 4:95981032-95981054 CCAGTGAGGCCCCACCTTCAGGG + Intergenic
980614078 4:135195202-135195224 CCCACCAGGCCCCACCTCCTGGG - Intergenic
987228001 5:15863645-15863667 CCCACTAGGCCCCACCTCCCAGG - Intronic
997371766 5:133366033-133366055 TCCACAAGGCCCCACCTGCCTGG + Intronic
998448612 5:142217475-142217497 CCCAGTAGATGCCACCTGCATGG - Intergenic
999255281 5:150206573-150206595 ACCACAAGGCTCCACCTGCAGGG + Intronic
1000963920 5:167632161-167632183 CCCAGTAGGGCCCACCTGAGAGG + Intronic
1001032226 5:168271351-168271373 CCCATTAGACTCCTCCTGGATGG - Intergenic
1002069684 5:176671940-176671962 CCCACCTGGCCCCACCTGCTAGG + Intergenic
1003487169 6:6589776-6589798 CAGATTAGGGCCCACCTCCATGG + Intronic
1006937885 6:37731128-37731150 CCCTGTAGCCTCCACCTGCATGG + Intergenic
1011086474 6:83546680-83546702 CTCAGCAGGTCCCACCTGCATGG + Intergenic
1015302060 6:131664248-131664270 CACATTAGCCCACACCTACATGG - Intronic
1019808027 7:3143017-3143039 CCCTTTCAGCCCCACCTGCAAGG - Intronic
1029700376 7:102242723-102242745 CCCAACAGGCCTCAGCTGCATGG + Intronic
1033719382 7:144041477-144041499 CCCATCAGGCCACACCTCAAAGG - Intergenic
1033973628 7:147072722-147072744 CCCATCAGTCCATACCTGCATGG - Intronic
1034866901 7:154649682-154649704 CCCATGAGGCCCCAGGTGCCAGG - Intronic
1041179440 8:55232317-55232339 CCCATTAGCACCCAGCTGCCAGG + Intronic
1048578259 8:135709801-135709823 CCCAATAGCCCCCGGCTGCAGGG + Intergenic
1049585873 8:143432166-143432188 AGCATGAGGACCCACCTGCAGGG + Intergenic
1051489038 9:17640567-17640589 CCCAGTAATGCCCACCTGCAAGG + Intronic
1057445950 9:95114759-95114781 CCCATGAGGAACCACCTGCAGGG + Intronic
1058955968 9:109949075-109949097 CCCTTTGGGCCACACCTGCAAGG - Intronic
1185431231 X:13300-13322 CCCATTCTGCCCCACCTGTCAGG + Intergenic
1185432085 X:17335-17357 CCCATTCGGCCCCACCTGTCAGG + Intergenic
1185440498 X:225697-225719 CCCATTCTGCCCCACCTGTCAGG + Intergenic
1185441401 X:230049-230071 CCCATTCGGCCCCACCTGTCAGG + Intergenic
1187191432 X:17038857-17038879 GCCATCAGCTCCCACCTGCAAGG - Intronic
1187633178 X:21197466-21197488 CCCATAAAGCCCCACCTCCTGGG + Intergenic
1191586519 X:62833284-62833306 CCCATTAGGTCCCACCTAATTGG + Intergenic
1195853734 X:109309033-109309055 CCCAAGAGGCACCTCCTGCAGGG - Intergenic
1198140068 X:133793613-133793635 CCCCTCAGGCCACAACTGCACGG + Intronic