ID: 1136499707

View in Genome Browser
Species Human (GRCh38)
Location 16:30664313-30664335
Sequence CGTCCGCGCAGCTCACCCAC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 39
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 37}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136499702_1136499707 -2 Left 1136499702 16:30664292-30664314 CCTCCTCATCTGCCTCCTCCTCG 0: 1
1: 5
2: 51
3: 1005
4: 6177
Right 1136499707 16:30664313-30664335 CGTCCGCGCAGCTCACCCACCGG 0: 1
1: 0
2: 0
3: 1
4: 37
1136499697_1136499707 23 Left 1136499697 16:30664267-30664289 CCCTCATCATCCTCTTCGTCCTC 0: 1
1: 0
2: 19
3: 319
4: 2356
Right 1136499707 16:30664313-30664335 CGTCCGCGCAGCTCACCCACCGG 0: 1
1: 0
2: 0
3: 1
4: 37
1136499698_1136499707 22 Left 1136499698 16:30664268-30664290 CCTCATCATCCTCTTCGTCCTCC 0: 1
1: 2
2: 42
3: 986
4: 6377
Right 1136499707 16:30664313-30664335 CGTCCGCGCAGCTCACCCACCGG 0: 1
1: 0
2: 0
3: 1
4: 37
1136499694_1136499707 26 Left 1136499694 16:30664264-30664286 CCCCCCTCATCATCCTCTTCGTC 0: 1
1: 0
2: 2
3: 84
4: 1039
Right 1136499707 16:30664313-30664335 CGTCCGCGCAGCTCACCCACCGG 0: 1
1: 0
2: 0
3: 1
4: 37
1136499695_1136499707 25 Left 1136499695 16:30664265-30664287 CCCCCTCATCATCCTCTTCGTCC 0: 1
1: 3
2: 36
3: 805
4: 6320
Right 1136499707 16:30664313-30664335 CGTCCGCGCAGCTCACCCACCGG 0: 1
1: 0
2: 0
3: 1
4: 37
1136499700_1136499707 4 Left 1136499700 16:30664286-30664308 CCTCCTCCTCCTCATCTGCCTCC 0: 1
1: 19
2: 488
3: 4425
4: 11766
Right 1136499707 16:30664313-30664335 CGTCCGCGCAGCTCACCCACCGG 0: 1
1: 0
2: 0
3: 1
4: 37
1136499696_1136499707 24 Left 1136499696 16:30664266-30664288 CCCCTCATCATCCTCTTCGTCCT 0: 1
1: 0
2: 4
3: 124
4: 1098
Right 1136499707 16:30664313-30664335 CGTCCGCGCAGCTCACCCACCGG 0: 1
1: 0
2: 0
3: 1
4: 37
1136499701_1136499707 1 Left 1136499701 16:30664289-30664311 CCTCCTCCTCATCTGCCTCCTCC 0: 1
1: 27
2: 620
3: 4416
4: 11211
Right 1136499707 16:30664313-30664335 CGTCCGCGCAGCTCACCCACCGG 0: 1
1: 0
2: 0
3: 1
4: 37
1136499703_1136499707 -5 Left 1136499703 16:30664295-30664317 CCTCATCTGCCTCCTCCTCGTCC 0: 1
1: 1
2: 45
3: 814
4: 6156
Right 1136499707 16:30664313-30664335 CGTCCGCGCAGCTCACCCACCGG 0: 1
1: 0
2: 0
3: 1
4: 37
1136499699_1136499707 13 Left 1136499699 16:30664277-30664299 CCTCTTCGTCCTCCTCCTCCTCA 0: 1
1: 43
2: 764
3: 5410
4: 12344
Right 1136499707 16:30664313-30664335 CGTCCGCGCAGCTCACCCACCGG 0: 1
1: 0
2: 0
3: 1
4: 37
1136499693_1136499707 29 Left 1136499693 16:30664261-30664283 CCTCCCCCCTCATCATCCTCTTC 0: 1
1: 0
2: 10
3: 174
4: 1737
Right 1136499707 16:30664313-30664335 CGTCCGCGCAGCTCACCCACCGG 0: 1
1: 0
2: 0
3: 1
4: 37

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136499707 Original CRISPR CGTCCGCGCAGCTCACCCAC CGG Exonic
900482276 1:2905080-2905102 CCACCGTGCTGCTCACCCACTGG + Intergenic
1063120340 10:3101463-3101485 CGTCCCCGCCGATCACACACAGG - Exonic
1076523111 10:131093448-131093470 GGTCAGAGCCGCTCACCCACCGG - Intronic
1083186492 11:61020778-61020800 CGTGTGCCCAGCTCACTCACAGG - Intergenic
1083788180 11:64966093-64966115 CTTCTGGGCAGCTCACCCAATGG - Intronic
1089698791 11:120231898-120231920 CGAGAGCACAGCTCACCCACAGG + Intergenic
1096691008 12:53321693-53321715 TGTCCGCGCTGCTCCCCCTCCGG - Intronic
1102473300 12:113172530-113172552 TGTGGGCGCAGCTCACCCGCTGG + Exonic
1104924858 12:132308816-132308838 CGTCCTCACACCTCACCCACGGG + Intronic
1118256160 14:64207947-64207969 CCTCCCCGCAGCCCACCCATGGG + Intronic
1118785443 14:69041952-69041974 CGTGCTCGCAGCCCACCCCCCGG - Intergenic
1121817380 14:96939098-96939120 CATCACCACAGCTCACCCACAGG - Intergenic
1122960438 14:105091614-105091636 CGTCCGCTCTGCTCAGGCACTGG + Intergenic
1129116334 15:73367442-73367464 CCACCGCGCAGGGCACCCACAGG + Intronic
1136499707 16:30664313-30664335 CGTCCGCGCAGCTCACCCACCGG + Exonic
1143323111 17:6080769-6080791 GGTCCGCGTGGCTCTCCCACAGG + Exonic
1145248337 17:21284332-21284354 CGCCCGCGCATCGCACCCGCCGG + Intergenic
1147643533 17:42019993-42020015 GGACCGCGCAGCTCCCCCAGAGG - Intronic
1160242285 18:77132560-77132582 CGTCCCCGAGGGTCACCCACCGG + Exonic
1161073918 19:2275876-2275898 CGGCCGCGCAGCTCAGGCCCGGG + Exonic
927499916 2:23575790-23575812 GGCCCCAGCAGCTCACCCACCGG + Intronic
936008226 2:108908579-108908601 CGCCCACCCAGCTCACCCGCTGG - Intronic
938403652 2:131015000-131015022 AGGCCCCGCAGCTCACACACAGG - Intronic
941043480 2:160648499-160648521 TGACCGCGCTGCTCCCCCACCGG - Intergenic
948228534 2:236332819-236332841 CAGCAGCTCAGCTCACCCACAGG - Intronic
948479456 2:238240697-238240719 CGCCCGCGCCGCTCTCCCCCTGG + Intergenic
1173148759 20:40547881-40547903 CGTTAACCCAGCTCACCCACAGG - Intergenic
1175813944 20:61873942-61873964 GGTCCCCGCAGGACACCCACAGG + Intronic
1185342556 22:50298186-50298208 TGTCCCCGCAGGTCACCCCCAGG + Intronic
950525632 3:13521105-13521127 CTTCCCAGCAGCTCACACACTGG - Intergenic
984771998 4:183444467-183444489 CGCCCGCCCACCTCACCCCCGGG + Intergenic
1002046302 5:176543392-176543414 CGTCCGCGGACCTCACCACCCGG + Intronic
1002364791 5:178701459-178701481 GGTCCGCACAGGTCACACACTGG + Intergenic
1022092175 7:27114680-27114702 CAGACACGCAGCTCACCCACAGG + Intronic
1024520893 7:50303868-50303890 CGCCCGCGCCGCGCCCCCACGGG + Intergenic
1032062871 7:128739379-128739401 CGTGGCCGCCGCTCACCCACCGG - Exonic
1034471142 7:151254987-151255009 AGTCCGCGCAGCACTTCCACGGG - Intronic
1061872896 9:133530097-133530119 CGTCCTCCCAGCACACACACAGG - Intergenic
1187245204 X:17547782-17547804 AGTCTGCCCAGCTGACCCACAGG - Intronic